Felis_catus Locus Mono:27:SNORA25
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:27:SNORA25
Felis_catus
Mono:27:SNORA25
scaffold_214328
SNORA25
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGCAGG
TGGCCTGACTGACTCTCTATCTCTCCACTGGCTGTTAGTTTAGCCTCCCTTAGGCTTTGC
CTTTATCCCGTTCTCTGCTTCTCAGTAAATAGAATTCCCTGGAGTGACCCCTGCTGACAT
CGCCATCTTCTTTGCGGATAGAGTCCTGCCTCCACTGATGCCATGGATGACATTTTCCAC
CTCTACACAAGAACCCAAACACCACTGGGGAGGTAAGCAGGATTTGGCATTGCCCTTTCC
CTCCAACTGTCTGTGGAGCATCAGACATTCCTTAGGGAAGCCACTGAGAGTTGACTCTCT
CCCACTCTGAAGTAGTAAAGATTCCTAGGGGAGGGAATCGCAGTCTGACCTCCAAACCAA
ATTGCTGAAGACCCAATGTATGTTGCTCACTTACCTTCATGCACCCCAGAGACCAATCTG
AAACAGCCCAAACAAAGCTAGCAAGCAGCAAGAAGCTAGATTCTCCATGCCCTGGGTCAC
TGTATTTTCACACCCATTACAGAAGTAACACACATGCCCCCAAAATAGCAGCTTCACTAA
ACCACAGTATCAGGAGCTGTAATTTGTCTCTAAAAATAGATTTGAAATAAAAGAAACAAT
GCTTCCTATTATATGCCCTTTTGAAGGACCAGATTTGTTTCTGCAGAAAATGAGATACAG
AAGAACATGTAAGAATGGACGAAGATATCAAACAGAACTGCCCACTAAAGTGGATTTCAT
TCCACAGAATATACAAATGTGACTGCCAATAGGATTTCTGATTCTCAAATTCTGCCTATG
TCATGCAAAGGTGAGGGGTCTTTCTGCCCCAGTTTATATACAGATCATTTCAAAGAGGGC
TTTTGGAGCTGTGAAACCAAGAGCTCTTAACTCTATGACTAAAGGTTGAAGGTCTCCATA
GGATGCCGTAGTCATTAAATAGTGCTGTTTTTCTGAGGAAATATAAGATGTAGCCACTCC
TATAATCATAAAAGTTCATGGTAGTTCATTCATAATAACCCATGATTGGTGATCCGGGAG
AGTAAGCATGTTCCAAAGTTAAATAATATATCATCACTTTCATGCCCCATTACACATACC
AATAGAGGATAGGCAGAACATGGCTGTATCACCATAGCTAGATAATTGGGGTTCACATCA
GAACCCAAACATTAACAGTTTCTTATCTGTTTCTCTAAGTCACTTCTCAGATGTGCTAAC
AAAGACCAAAATTGTCCAATGTGGATCACATTTTCCTGTTGGAGGAGGTCATTGAGAAGG
CATGACCCCTGGCTGACGTTTGACCTGGATCCAGGCAATAAGAGCAGAGGCTCCCCCCCC
CTCCCCTTTCCTTGGAAGGTATGTTCCACCCAGTGTTCCCACACTAGGAGCCACTACAAG
GATGCAGCCTTGAGAGTAATGTGTTATTGAGACCATCTGGACTGTGTACATGACTGAATC
CCATTAAGGCCTCTATAAAAATAAATTATGGTTCTGCAAGGTGGGTACAAAGATCTCATT
TTGCACAGCCCAAGGCAAGCATCAAATGGAAGTTCCCTTACTTCTTAAAACTGCCACCTA
TCAATCCAGAGAGGCCTGCCTCTGTCTTCGTCCTTGCCTTGTTCTCCACGTTCCGAATTT
CAGGGGCCAGCTCTGAATTTCACCTGGGGAACTCCTGAGGTTGAGAACCAACATTCCATT
ATATCCACCAAGTCAGCTTCTCCCTGCTCATGGCTCTAAGGATGATTAAAGTCCAAGTAG
CAGAATGAGACAGAAACAGAAACCCCACAATATCCAGAAACTTGACATTTTCAGTGAAGA
AGTACAAAAGAACTGCATCTTAATTATCCATGGCATGAAATCCCCCTTATCCACCCCCCA
ACCTGCTTGGCTTGGCAGAATTTCTGCTTTATCCCTTCCTGGGGGAGCCCAGGACTGCTC
CCTGAAAAGGCCAGCACAGTTCAGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved