Felis_catus Locus Mono:125:SNORD45
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:125:SNORD45
Felis_catus
Mono:125:SNORD45
GeneScaffold_1963
SNORD45
1001..1079
2079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTTTGGTAATCTACGTCATGACCTACC
TAACAATGAGGTAGTGCTGTCTCGATCACAATGAGCTAGATCAGAAGTGCAGGAACTGGA
GCAACGTCCTCATTTCTGAGAGCTTGCTGCAAATGAAGAAACTAAGACTAAAAAGCTGGA
AAAAATGAGGCTAAAGGAAATATTTCCTTGATAAATTGAATAATCTTTGGAGCGTGTAGA
GGTGGCTCTGAAACCTGAATTTCTAGGATTAGTAAAATTTCATTAAAGAACTTAACTGCA
AATTATACGCTAGGTATATATATATTTATGCTTCAACTTGCTGCTACATGTAAACCTTCA
GTTGGCCTGAATTGATAAGCTTGGATTTTCTGTGGTGTTTATTTTACTTAAAAGTCTTAA
GTGAACGGTAAGCAACAGCAGATATGGGTAATAATTTTTTGGGTCAATGATGAGCTGGCA
TGTATTCTGAATCCGAAGTTGATTATTACTACGTTAGCTCTAGAATTACTCTGAGACCTG
AAAAATTACCCGAATCTTACCACGGCTTTAGTGCTTACAGTTTTTGTGTGGCAAGATGAA
ATCAAAGTGAAAAATTCAAATGTATGTTGAATATACAAACTGGGGTCAAGTATTATAATA
AGAACAGTTATGAAATCACTGCTTTTTTGTTTTGAAAGGGCACACCGCAGAAGGATGTTA
CTATCAAATCAGATGCACCTGACACCCTCTTGTTAGAGAAGCATGCAGATTATATTGCAT
CCTATGGCTCAAAGAAAGACGATTATGTATGTATATGATTTTACATTGGAAATTTATTTT
GAAGTGAATCTATAATGCATAAGCAGTCAGTAGGTCAGTAATGGCCCANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAATGTGGAATTTTACGTAAGAATTGCTTA
AATGCAGATAAAGGAAGGCATTTTTACAGTAGTATGTTCTAGCATCCTGTTCCCCACCTC
TCCTGAACACCTATTTGCTTGTGCCAGAGAGGCAAATTGTGATTGTAAAGAGTATTTGTA
CTGTTGTACATTGTATCTGTAAATATTTGTCAAATAAAACTTGCTTTTTAGGGGCACCTA
GCTAGCTCTCTGTCCATAGAGCATGTGACTTGTGATCATGGAGTTGTGAGTTTGAGCCTC
ATGTTGGGTATAGAGATTACTTAAAAATAAAATCTTGGGAAAAAAAATTGGCTTTTAGCC
ATGAAGAAATTTTGACAATAGTATTTCATTGCAGAATTGGATCCTAGAATTAGTATGTTT
AGATTTGTTCAGGTAGTTAGGTGATATTTACATGTTTGCAATTCTAACTTTTTAATAGAA
ACCAAGTTTTTAGACATAAATTGGCTTTTTACTTGAGTAGTTTTTATCACTATTACTATT
GAAAAATTATTATATACATGTACTTTATGTCTGTAATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved