Felis_catus Locus Mono:129:SNORD20
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:129:SNORD20
Felis_catus
Mono:129:SNORD20
GeneScaffold_4422
SNORD20
1001..1080
2080
CCTTGTAGGGTGTCTATGGATGTAGGGGTGGCTGGCGGGTTCAGTCGGAAGAGCATGCG
ACTCTTGATCTCAGGGTCTTGAGTTTGAGCCCCACGCTGGCCATAAACACTACTTAAAAA
AAAATTAAAAAACAAAACAAAACAAAACAAACCTATGGCTGCTTTCCCACTATTGAGCCT
TGCCAGGAAGACGGCTGGGCAAACAGCTCTTAACTATAGTATGCAATCACTTGCTAAACA
TCAAATGATACATTTCAGAGAGGGAGTACTCTAATGTATGTTGCTATCTCATTCCTTACA
GGTGAAAACCGGGAACTTCAGTGAAGTTAGGTAACTCATTCAAGGACACACAGCTCGTAG
GCAGTGGAGCTAGCAATTCAACCAGGACTGTGTTACTCAAAAATGGCTTGAACATGCATG
GTGACGGTATTTGGATATTGTAGTCATCACTTGCACCTCATTTGTGACCCAGAAAGTCAC
AGTCACATCCAGCCACCCTGGCTGCCGCAGCGGGATGAGGAGGATGCACTCTTGGCTGAA
CTCGTCTGGCCCTGGAGGGGCTCTCCGCCCCTCCCCGGCTCACGCTCTTTTCCTCTCAAA
CATAAACATGAGAAAATAAGAGAGAGACAGAGATTCGGGTACTAAAATAACATGTACGGT
AGGGGTAGGAAGAGGAGCATGGTAAGCAGAGCCAAGTATAGCCCAAAACGTGGAAACAAG
GACACGTGGGGCATCTGAGAAAGGCACAAGATGGGGCAGAGAGTGGCTGGAGGGAGAAGG
TAGAGGCCCCACACACGCTGTGTCTTCGCAGAGTACCTCTGACCAGCACATTTGTTCTTT
CTGATGACTACGGTAGCGCCATGAATAGCAAGGACAGGAATTTCTAGTTTACATAGTATC
TTAGGCTCTCTTTTTGCTTGTTTACATCTTGGAGTGGCTCTTGTTCCCTCTGGGGGTGGA
GGAGGTGGAGGGGATATACCTATTTCAAAGGTCTATTAAATAGAGAGAGAGAAATAAAAG
AAGCAGAAGGGGATGATGGAATCTCAAGAAAATTCCTCTAGGTAGTTAAGTTCTGACCCA
GCTATCTTGTCTGAGAAAAAAAAAGAAAGAAAGTAGCAGAAGCTGAAACCAGTTTAACAA
CAGCGTCCTAAGGTTTCTGGCTTTCCTCCCCCCCAACAAGCAAATCCTACTGTGTTGACA
ATCAATCACTCCACAAATATTTATTGCCTTCCTAAATGGACATTTACTGCCTTCTCCGGA
GAGCGCAGGGGTCTCTGAAACTCACCGATGTCACTGAGTTAATGGGCTGCCACTGGATCT
GCAACTCCAGCTTTATCAAGTACAACAGCAGCCTTGTTTGTTTTTGTACCGAAATGCCAG
ATTCGTTTTTCCTGCCCTGAAAACAGTTCAACCCAAACTAAACCAGCAAGGAACCAAGAA
TTACACGCAAAGCAGCACGCTCTGGCTCGCTGCTGTCTCCCCACCCCCCACCCCCCCAAC
ACGTTTCATGTCTCTTCCCAAACCGCTCTCTAAACTGAAGATTGGAATAAGAACAAAAGG
AGGGACAAGAGTCACATCCAGTACCTGATCACACGCAGATGTAACTCCATTAGGAAAATT
AGTCTTCAAGGTCTCCACTAAATCTGATTTCATCTTTCCCTTTTGTTGCAACTTTGAGCA
AGACAGAGATGGGATCCACTTCAGGCAGGAACACGGCTGCAATGGTGGCAGGTCCACAGA
AAGGGCTAACAGCAAAGTCCTTTTATTAAAGGCACCTCAACTCTGAGTCCCGGAAGTAGC
TCATCGGGCCCTCTAGATGCAAGGTCGTAAGAGTGATAATTCGCACTGTCCAAACAGAGA
CCATCTTGGTTGTGGAAAATCCGCCCACTCTTTTATGTGCTCATAAGCTCAGCAGAATGA
TTTATTCTCAGGCCTAACTCCTCCTCTAAAGTAGAAGCAACTTAAAGGCAAGAGGTCTTT
CACTTCTGTGTCCCTCAGAATACCAAGCGATGCCTTGCACTAAGTAGGCCCTCAAAAAAG
ACTGCTACATGACAAATAGACATATGACTAAAGAGAAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved