Felis_catus Locus Poly:20:SNORD78
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:20:SNORD78
Felis_catus
Poly:20:SNORD78
GeneScaffold_1284
SNORD24, SNORD77, SNORD44, SNORD78
1001..1083, 1302..1368, 1681..1741, 1988..2052
3052
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGATGGCTTCTGATG
GCAGGTAAGAAACGGGTTATACAGTGGAATCAGATCTCTTGGAGGTGGGGTCTTTTGTAA
GCCTGTGATGGTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAAAATCCTATTCTGAGGC
TTAACCATACCTAAAACCTTGATAGTTACTTTGGCTGCGCAGTATGTTTAATCGGATGCT
CTTTGTTTTCTAGTTCTGTGCCAAAGGGGTGAAAACGGCTGCAAAGGTAAGTTACTGAAA
TTCCCTCACGAAGGGAAGTTAGGTTGAAAGTCCACTAAATGTGCTACAATGATGACATTA
TATTTGCTACTCTTGACTGTGAGAATGACGAGAGTTACTACCACCATTACACTTAACTGA
GGCACACAAAAGGTGATTTAGAGAACTTGGAGACTGACACTACTTTTACATGAAGCTGTT
TCTTCCTAGGTCCTAAAGTTCAAGTTGCACATGCTACCCATGGGCAAACAGGTGAGGAAC
CTTTTAGATAGTCCGTGTTTACCCAGTCCTTTTCAATTCTTTTTTTACATCTGAATGCCT
ACACTCTGGTATTCTGTATGAAATGCTTACAGCCTGAAACAGATACTATGATGGTTGCAT
AGTTCAGCAGATTGGATCATGAAGAGATAGCTATCTATCTGATGTATCGAAGTTGATAGG
AAAATTGGTTTGCTGTTAATAGCATAAGCAAAATGTCATTAACCTAGTTTCCTTCCTTCC
TTTTTTGTAGGCGCTAAAGGGAGTTGGCTGGAAATTGAGGAGGTGAGCAGAATTGTAATG
GAGCTAAATGTTGGTAACAGGGCAAACATCACAGTACAGCTAATGGCTGTTTAGAGTTGC
CTTATGCACAGGAAGCACTCCTACCACCAAGTGCTTGAATGCGTTGCTGAATGCAGTAAA
TACATGCCAGACCCTTGTCCTGTTACCGTTGGTTAGGACACTCATGATTTGTAAAAAGCA
GCCTGGATGATGATAAGCAAATACTGACTGAACATGAAGGTCTTAATTAGCTCTACCTGA
TTTCAGGCATTTTTGACATTGTGGGGAGAAAATTCATCTTTTGCCTCTTGTGAAACTGTC
TTTATTTCTTAGGTGGACTTGAGTCTCAGTCATGTTTGGAGCAACGATTTATTTTGGTAA
GTATTAAGCATTTTAGTAAGCTCAAAACTTAACTGAGTGCTGAAGAAATAGAATGCTTAA
CTACCAAGTTAACTAGTTTACTGTGGCTACTTAGTGGGTGCATGTTGAGCATGCTGTGAA
TGGGGTTTTTGAAATGATGTTGACCAAATGTCTGACCTGAAGTGAGCATGTAGACAAATT
TAACACTGAAGAACCCTGTGACAAATACTCTGAGAAGAATTCGGTGATAATTAACATTTT
AACGGAGTGTCTTGTTTTTTTTCTAGGTTACTGGCCACTATCCTGGATGGCTTGCTTTGG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved