Felis_catus Locus Mono:127:SNORA28
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:127:SNORA28
Felis_catus
Mono:127:SNORA28
GeneScaffold_4346
SNORA28
1001..1124
2124
AAACGTACTTTTTTGAAAATTTGAAAGTATAGATGGAAATACTACTCAGAAATAAAAAG
GAAAACTGATATACAACAACATGGATGAATCTCAAAGGCATTTTGCTAAGTCAAAGAAGC
TGACACAAAAGGCTACATATCATATAACATTCCATTCATATGACATTCTGAAGAGGTAAA
GCTACAGGGACAGAAGTCAGATCTGGATGCCCAGGCCCTGCATGGGGTGAGAGGAATGAC
TACAGAGTGGCATGAGGGCACTTTCCGGGGAAATGGAAATGTTCTCTTTCTCACTCACTG
TGGTAGAACTTCCATAACCACATACATTTATCAGAGTACACTGAATTATACATTTAAAAG
AGATGGATTTCACTGTGTATAAAAACAGAAGATAGAAGATTTCAGAATTGTGTCTAGCTG
AGAAGATAACAGTTAATGGCTTGTTTTGTTCGAGTATTTCTTATATGGGAATAATCTCTT
TCAAAGGCAGACTTGAATTTCAATGGCAGAAATCAGCCAAAAGAGAAAAACTTAGACTAA
ATCACTGTGCAACGTGACAGTGTTTGTTCATTCAATAAATATTGTTTAAATTCTTTTGAC
TATAGTTGACACACAATGTTACATTAGTTTCAGATGTACAACATAGTGATTCAACTTTTC
CAAATTGCTATGCTCATCCCAAGTGTAGCTACCATCTGTCTGTCACCATACAATGCTATT
ATAATATCATTGACTGTATTCCCTATGCTGTGCCTTTTCATTCAATATTTTTAAAACACC
TATGGTGTGTCAGGTACTGTGCCAGATGCTGGAGATAAAGACTGAAAATGTATGATTATC
CCATCTATGATACCTCACTCCCCTTCTAATATCCAGATCCATTTTACTCAGAGGACACAG
GTATGCTTCCAAACAACGATTTTTCCCCAAATTTTCTTCATATTTAATCTGAAAAATATT
AAGAAAAATTCACTAGCGCGATAGCTTTTCACAATTTATAGTTGTGACACTCTGTGTCAG
ATGATTGAAGTTGTCTGATGCAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCC
AGTGTTCCCCTCCATGAGACCAACTGTTATACAGACTTAAACATTGAGGGGAGAAAAAAA
AAAGAAAGAAAGAAATTAAACAACAATATCCCTTCCATTTCATTTATTTTCTATTGTGGC
ATAAATTCAAGACTAACATAAACACACCCTATGGATCACAGATAATTTTTTCTTAATATT
TACCAAGAATAAATGTGACAACAAAAAAATCCAATCCCAGAACAAAATTGTAATTAACAT
TTAGTTCCAAATAGGTCAAAGTACGAATTATTTTATTACACTTTTATTTAAATATCAAAC
ACTGTCACTGTGATATAACTGTATTTTTATTTTATCTTCAAAGACTTCTACAAGCAATCA
ACTATCACAGGATTTCTAATGCAGTGTTACCAGAGTTTGCTACATGCAAAAATTAAAACT
TGGAAACTTATCTAAATACAGTATAATAAAGGCAACTGAGTTATCTTTTTAAATAGCTTT
ATTGAGACATAATTCACATAACAATAAAATTCATCCTGTTAAAGCATACATAAAATTTAG
TGGTTTTTAGGATATTTACAAACTTAATCTGTAATGCACCCATCATTAGTATCTAATTTT
GGAACATATTCATCACCTCATAAAGAAATCCTGTGTATATCAGTAGTCACCTCCCATTCC
CTTTCCCTCCAGCCCCTGGCAACCACTAGACTACCTTCTGTCTCTATGAATCTACATTTT
CTGCACATTTCATGTAAGTGAAACTATACAAGTTTTTGTGTAGACAGATGTTTTCTGTCC
CAGGTATGGACAGAGTGGAATTTCTCTACATCCTTGCCCACACTTGTTATTATCTTTTTA
AGTATAGTCATCCTAGAGGACGTGAAGTAATACCTCATTGTGATTTTGATTTGCATTTCC
CTAATGACCAATCATGTTGAATATCTTTCCATGAGTTTGGATACTGGCCATTTGGATATT
TTCTTTGGAGAAATGTCTACTCAAATCCTTTATGTATTTTTTAATTGGTTTATTTGCCTT
TTTACTGTTGAATTGCAAGAGTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved