Felis_catus Locus Mono:80:SNORD39
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:80:SNORD39
Felis_catus
Mono:80:SNORD39
scaffold_123513
SNORD39
1001..1076
2076
AACACCAGTCATGGCACAGACTTCTGAAACTCCAGTATTTGAAGTCCATGGGTTTTAAA
ATCTCATGATAGGGGGTGCCTGGGTAGCTCAGTCAGTTAAACATTCAACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACCCCAGATTCGAATTTCAGCTGA
TCCCTATCCTGCCCCTGTGCTTTAGTGCAGACATACCTCTCTACCTACCTTTTTGACTGA
TGAACAAAAACAGTTTTTAGCAGTTCAACCACTATGTGATAGTATGATATTTAACCCTCA
TCTGTATGAATCTGTTTCCTCCATCTAAAAAGTGGCAATTTAGTGGATGATAACACCTTG
GTAATGTCAACTCCTGAATGTGCACTGGGGAGCAAACCTTGGAGAGCTGAGCATGCGAGG
GGAAAAAAGATCATCTAAAAAGTTTCACTAAAAATGAACTACTTAGACCTCATCAAAATA
AAAAGCTTCTGCACTGCTAAGGAAACAATCAGCAAAACTAAAAGGGAACCGAAAGAATGG
GAGAAGATATTTACAAACAACATATCAGATAAAGGGTTAGTATCCAAAATCTATAAAGAA
GTAATCAAACTCAACACCCCAAAAAACAAATAATCCAGCGAAGAAATGGGCAAAAGACAT
GAATAGACACTTCTCCAAAGAAGACATCCAGATGGCCATCTGAGACATGAAAAAATGCTC
ATCTTCACTCAGCATCAGGGAAATAAAAATCAAAACCACTATGAGATACCACATTACACC
TGTCAGAATGTCTAACATTAACAATTCAGGCAACAACAGATGTTGGTGAGGATGTGAAGA
AAGAGGATCTCTTTTGCGTTGTTGGTGGGAGTGAAAGCTGGTGCAGCCACTCTGGAAAAC
AGTATGGAGGATCCTGAAAAAATTAAAAATAGAACTACACTACAACCTATCAATTGCACT
ACTAGGCATTTATCCAAGGGATACAGGTGCGCTGTTTGAAGGGACATCTACACCCCCATG
TTTATAGCAGCACTATCAACAATAGCGAAAGTATGGAAAGAACCCAAATGTCCATCAATG
GATGAATGGATAAAGAAGATGTCGTATATATATACAATGAAGTATTACTCAGCAATCAAA
AGGAAAGAAATCTTGCCATTTGCAACTACATGGATGGAACTGGAAGGTATTATGTTAAGT
GAAATTAATCAGTCAGAGAAAGACAAATATCATATGGCTTCACTCATAAGAGGACTTAAG
AGACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACATAGGGAGA
GGGACAAAGCATAATACTCTTACATATAGAGAACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved