Felis_catus Locus Mono:68:SNORD113
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:68:SNORD113
Felis_catus
Mono:68:SNORD113
scaffold_100362
SNORD113
1001..1076
2076
CTTAATTCACACAGTTATCCTTATCTGGAAAGGACTGAGACTTTGGAAAGCTGTTATCA
AAAATAGAGGGAAAATTACTTCTCCCAATAAATACAAATGAAGAGGTTCTTGTATTTCTA
GTTATATTTAGTTATGTCTAGTTATATATATACATTTCTCTCTATAAAACACTAACATTT
ATACATTAAATCCTCTGGGTGGAAGAAAAAGCAGAAAGAAAACAATCTGAAAGGCAAAAA
AAACCTCCCTTAAAACAGAACTACGCATTGCAGAACAAATATAATTTCTACATTAAGTTC
AAGTTTGTACAAAGAGTAACTATTCTCTTTCACATGCCATTTCGAACAGTACAAACAGAT
ACAGAACACTAAAAAGTAATTCTGCTTTAGAGATGAAATTTTTACCCTAAGCACATACCT
TCAACTACACAGTGTAACCTATTTTATAATATGCCTACTTCTCTACAGTCAGCAGCAGAA
ACCTTGATATCAGAATACAGTTCTCTGCATCTGAAAACAAAGCTACTAAAATAGTANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCATATTGGCAATGCTGCGGTGCATGGCACAAGGA
GAACTAGTCTTGTAGCTCTGTAGGAAGTAAACTTTCATGGTCTTCATCTCTTCAAGGATG
TTGGTCTTATTTTCCTAACTCTTGCTCGTTGACCATATTATTAATGAGTCAAGGAATAAG
TCAAGAACAATATATTAAGTGAAGGCACAGAATACCAAGTCTGGATCAATGATGAGTGTG
CGTGGGGCATCTGAATAAAATTTTTGATTAAACCCAGTCTGTAACTCTGAGGTCCATTGC
ATCTATGGGAAATGTGCTTATAGAGGAAGTTAGAAATAGTCAAGAATCGTGTTCTTGATT
TTTTTTGTTGTTGTTCACAGATAGGGATTGTATTATTCTAAGTTAATCGATGCATGAGTG
AGTAAAGTTTAAGTGAAGAGATGGGTTGTACCTTATTTAATTATGAGAGGAGCTAATGAA
CCAAGGGTTACTGTTAATATAACTTTTTGGAATTTTGAGTTAAAATATAATGGTATAAGG
CTGCTCCTCCTTTGGGAATGTATAGATAGATATTTGTGAACATCAGTGTTGTTCTGAAGT
GGCAGTGAGTTGGTGGCCTATCTCATTTCAAAAAGGGACAAAAAACTCATATGATTACAT
AGCAATCAGCAATACATAATATAATACATGTATTCCACTGTAATAGAGCAAATCATGATA
AACCCATTAGTGTAAAATTAGTTTTAATAAGCAATAATTTAATACAATAAATAATAAAAA
ATAAAAGACATTATTCAATAACTGTTGAAACTTAGAAAAGTCTAAGCATGACACCAAGAG
TGAATATAGTAATTGTGTTCATTGATTTTTATTTAAAAAAAAAGTAANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTCTTCATTAGCAAA
ACACTGTTATCATTGCTATTTCGTTAGAATTATTTTAATAGTTTTGTTTTTAATAAAGCT
GGTTAGGTGTTACATATTATGTTACCAACTATATCCATTGACATTTATTTCATACCACAG
TTTGGCCAAAAAGGGATGGGTCATAACGGACTTTTACAAGGCGGAATACAGATTCTGACC
ATTCATTATCTGCTGTTAACATACAGAGAGGTCATTTTGTAAATCAGTTACTGTCAAGTC
ACGAGAGACTCTGATTCCACTGATGTACTGGTGGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved