Felis_catus Locus Mono:121:SNORA72
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:121:SNORA72
Felis_catus
Mono:121:SNORA72
GeneScaffold_4437
SNORA72
1001..1106
2106
AGCCCAGCGGGGGGGGCAGAACGGCTGCAAACCTTGGCAGGTCCCCGTCCCGCGGCATG
CGGAATCCCCGGGGGCCCTGGCGGGGACTAGGGGCTGGGCTCAACCGGCTGTTCCGGGAC
AAGGGGGGACGACGCTCCGTTAACCTTCTGGCTTGATTTGATACCGAGGCTGGATAAAGG
GAGGGATCCCATGCAAATTAGGGCCCGTGTCGCGGAAGGGTAAAGACTTTTAATTAAAGG
AAGGCACCTGGAGACCCAGCCGGTGGGAGGAGGTAAATAGAGCAAGTTGGCCACCGCTGG
GCGGGTTGGGAGAGAGCCAGCCCGGCCCACGCGGGGCTCATCCTCATCGCGCCCCCCCCC
CCCCGCTTCTCCCCATGCAGAGGAGGGCACCTGGAGGAGGCAAGGGGCCTTTCTGTCCTT
TGGAACAGCTCTGACATTGCACCGCTGGCCCAGCGCCCTGGGACCCAACTCTCAGACCCC
AGAATGGGAAATATTCTGGAGGAAATAAATGACACCGAGTGACCAGGCAAGTGAGAAATA
GAGTTGTACTCCCAGAACTGCCAGAGTCAAGACCTCTCTGCTGCGCAGCTGGAAATTCCA
GGTAGCACTAAGACCAAGGATCACATCTGGGGAAGGTTTTCGGATCCAACTCTATTTTAT
CATCATCATCCCTAAAAACTTCAGAGCATTTAGCAAGCCCTGTGCCATGTGCTTTGCGTA
TCTCATCTCATTTAATCATCAACAACACTCAAAATGTGGGCGTTCTAATTACCCCCATCT
CACAGGGGAGGCAACTGAGGTCGAAAGAGGCTAAGTCACATCTTAAGGTCCTCCAGTAAG
TGGCAGACCAAAGCCTCCAAGACTTTCCAGCTCCAAAATTCAAGGTCTCAGGGTCCTTTT
CTTTAGGAATAAGAGCACCCAGAACGGTGGGAATGGCAGCAGACAGCACCTTGGACAGCA
TCCACCACGTAGTTGATGCTTACTAAGTAGGTGCTCAATAATTGTAATGGTCCTCCCAGG
CTAATCATTCACTATATTAAGACCAGGGACATGTCCCCAGACCTAGTCCTTTGTCTAGGT
CTGGTTTGATAAGTGCTGGTGATCAACCAACTCTGACTCATCTTATGAGGGGGCATGTCT
GATCCTAGGTTATCTGATCAAGCCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved