Felis_catus Locus Poly:22:SNORA71
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:22:SNORA71
Felis_catus
Poly:22:SNORA71
GeneScaffold_1721
SNORA71, SNORA71, SNORA71
1001..1133, 2453..2585, 4049..4179
5179
GCGTTTCATCGGTTGCCCACGAAGTGACCATGTGGCCCGTTTTCTTGTCAACAGCCTTT
AAGAGAAAGCGTTAAAACCCCCGTTGTGCAGAGCGGTTGTGTGAGTTTTCAATTGGGGGC
GCTCGCGGGGCCCCAGGGCGGCAGAGGCCGATTCCGGTGTCTTTGTTTTGCACTAAAGCC
CCTTCCCCGTGCTGTCTCCTGCGTAGGCGTTGCGGGCTCTGGGGCTCTGTTGGAAGCAGA
TGGAAAGTCTCCGTTGGACGGCTTTGGGGGCTGTGCGTCAGGCAGCGCCCCCTTCTTTGC
TGCAGGACCCTGAGCCGCAGCGCCGGATGTGCCCCCGCGGTGTCCAGGGGGTGAGGCCTG
GGTAAGTGCTGCTGCTCAGGAGATCCTTGAGCAGGGACTCGTTGCCTTCCTGCCACACCA
CGGTGGGGGTTTGGGTGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTCCTGGAAGCTCCTGCCGGGTTTCTGAGAAAAGCCCCCCAGGAGGCCTGGTGTGGT
GGATGGGGGGGTGTGTCTGGGGGCCAGAAGAGGTCTGGGTTCAGATCCTGCCTCAGCCTG
TGGCCAGCGCATCACGTTGGCTAGGTTACGTCCTTCTGAGCTCCCAATGTGTTTTAAGTG
GGGAAAACTGCCGGAGCTCTGGGAGGACAGAAGTCTTGTCTGTGTTCTTTGTCATTGAGC
CCACGGTTGGTGGCGCATAGTAGATCGTCCGTCTGTATCTGTGGGGGACTAAACAATGTA
GGCGTTTTTGCCGCGAGTTGGTCTTCACGTGCCCCCTCTTGATGACGGGAGATGGCGTGT
TTACATGAGATGGTGATGGCGCTCAGGGTCCTGGGCTTGGCTGGGCAGCTGGGGGCTTAT
AGGGCCTTCTCTCTTCCTGGCTCACTTTCTGCCTTTTCTGCACCTGCATTCGAAAGTGAT
CATGGTCTGTCCGTGTCCTGGTCATCGATAGTGCAGGGAGAGGACTTGCAGAAAGCACTT
CCCCGTGTTTGGAGGGTCCCCTCTGTCCCTTCCAAACCCTGGAGCTTTCCCACACTTCTC
ACCACCTTTTTTCAGTTGCCTCTTGGCACCTGTTGTCTTGTTGTACGCTCTATGCCTGGC
TCAGCACAGTTTCTGTGAGGCTTTAAAAAGGGAGAGTGAGAGTGGGTCCTGTGTCTGTGT
GTCTGAGTTGGTGGCGGAGCCACAGCTGTGGTCTTTTTTTAAAATTTTTTTTTTAATTTT
TTTTTTAACTTTATTTATTTTTTTTTGGGACAGAGAGAGACAGAGCATGAACGGGGGAGG
GGCAGAGAGAGGGAGACACAGAATCAGAAGCAGGCTCCAGGCTCCGAGCCATCAGCCCAG
AGCCTGACGCGGGGCTCGAACTCACGGACCGCGAGATCGTGACCTGGCTGAAGTCGGACG
CTTAACCGACTGCGCCACCCAGGCGCCCCACAGCTGTGGTCTTCTGACATGGTTTCTAAT
TTCAGCAGCCCGGTGTCCTTTTCTGCTCCTGCGTTGAAGTGATTACAGGCTGCCTTTTTC
TTGGTCGTTGGTAACGCAGGCAAAGGAAGAGTCGCAGGGTTCTTTCTATATTCAGAGGTT
CCAAAATGGGACAACCTTAGGTGACCGAGAACAAGGTAGAGGGAGGGAGGCAGGCTTTCA
GTGTGCTTACCTCCTAAGACCCAGATTCCCCCAGTGTTTTCCTGTTGGTAAAGATAGTGG
GTTCCTGGGCGTGTAAGCAGTGCCACGGGCTTCTTGTCCCTTGCAGGAGTGGGTCGTGAC
TGCTGTGCCATGTTTGTGAAAGGCGACCTCAGGGAGAAGAACGTGGATTGGGAGGTCCCA
GGTAAGTGGGATTCTCTAGAGCTCAGGTCTTGTGCGGGCTGTGAGGCTGGAGGGGTTCAG
GTGATGAGGTGTGGGAAAGAGTGCCTTCTTCCCTCTGCCCCCAGCTGTCTGTGTCCCCTC
AGGCTGGTAGGCACAGGTCAGGTCCCTCCTCTGCTCCTGAGAGCCCCTGATGAAGGCTGC
TGTGACATTGAGAGGCAAGCAGCGGTGTCGGGATGGACAGAGAGAGGGCTGCGATTTAGA
GGCAAACCTAGACTCCTTTCCGGTTCCCAGCTGAGTGCTCTTACGTGAACCTGAGCGCTC
TTCTGTGATCACCCACGCCAAGTCTTTCAGAACCACGAATGCTCAGTATTTCTGCGCAGT
CTCCTCACCTCTTGGTAGGGAGCGGTAAATCGTCCGTGCAAATAAGGGGAAGCTTCTGTG
ATCTTAGGCTGTAAATCTGGCCATTAACCTGTCTGCTGGGCTCCTAGTTCAACTCAGTTC
CTGGGCTGCTGTCCGAGGTCTCCCTTCTCGGCCCACGCACTGCCCTTCTCTGCTCCTGCA
TTCGAAAGTGATCGTGGGCGGCCCGTGCCCTGGTCATTGATAGTGCAGGGAGAGGAATTG
CCGAAAGCGTTTCCCCGTGTTGGAAGGGCCCATCCTGTCCCTTCCAAACTCTGGAGCTTT
CGTACACATCTCTCTGTCCGCTGATTTGTATTGCTTTCTGGTACCTGGCGCTGGGTGGCT
CTCTGAGTGCCCTTTTGCCGAGTAGGGCCCTGCCTCAGCGTGTTTCTGTTCATGGGCCGG
TGGTGGAGTGCTGACAGGGGTCCCTCTTCCCCCAGGGCTCTCCCTGGGAAGCATTCTCTG
CCTTCTCATTGCACCGCTTCCCACACCCTCAGCCCCGTTGCTCAGCCCTGATCACATTGG
ATGTTGGTGATTTGCTTGTCATCCCCCTGTGCTGTGATCTCGAGGGCAGTGTCTCCATCT
TGGTGTCTGACATGTAGCACTGGGTCAAGACAGGACAAGGTGGGGGAGATCGAGATGCTA
CACGGTGAGGCAATGGGCTTTTCCCACTCTGGACTGTCAGTGGGGAGACCGTACCTGCTC
AAGGCTGAGGCATCCTGCTCTCCTTGGAAGTGTGTCTCTTGTCCTGGCCACGGGCTGGGC
CTGTGGTCCACTGGGGGTAACATTCCCTCTGCTCTTAGGTTAAGGAGCAAGGAAGGGAGT
AGTACCCCAGCTGGGCAGGACGTCGTCGTGGAGAATGCGTACGTAGGCAGCCCTTACGCA
CTAGATGGAGGACGTGGGGCCCTCCCGCCACCCGTTACCCCTCCTGCTCCAGGCTCATTG
CTGCCGGTCAGCGTGGCTCGCTCTCCAAAACCTGGCCTTGACAACTTTTTGATACAGATT
GCTTAGCAACAAATTGATCGTGGGTGCATAGGATAACACTGACATTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGCAAAGGCCCACGTAGTGGGT
GCTGGAATCGGCTAGCTGCCTTGCGAGGTACCTTATGCGTCCTCCCCCCCCCCCCCCCCC
AGGCCTGTTGTGAGTGCTCATTCACGGCTTGTCTCTTGCAGGTGGATCTGCATGTCCAGA
GGCTCCATGAGAGGTGTCTTACAGCCAGGCGCGAGGCCACAAATGCCCCGAGGTAAGGTT
TTGGAGCCTTCTCTGGAATTGTGTCTTTTTGCATCCGTAAAGTCACACACGTGTGCCCTG
GGGTCTGGATGAGGCAGCGAGATGAGAGTGGGCATCCATGAGTTCCCAGTTGTGTCCTGG
CTGGGAGGCAATCCCCCACATAGTGAGGGGGCGGGGGGGGAAGGCCTCTAGAAAGCTGCG
CTGGTGAAGGGCTTCCTTCCTGGTGTCAGCACCGTGCTGTGAGGGAAAGCCTGTAGATTT
AGGCACCAGAGACCTTGGTCCAGTTTCTGAGGCATGCATGTCTGGCTTTGTGAGCCATCC
TTCCTGGCGCTCTTTCTGTCCTTTTCTGCTCCCGTGTCTGAAAGTGACTGCAGGCTGCCT
GTGCCTTGGTCATTGGTAGGGCAGGGAGAGGAGTCACCGAGAGAAGTTCCCGTGTTTGAA
GGGTCCAGCCATCCTTTCCAAACCCTGGAGCTTTCCCACACTAGCTTTTCACCCCTGCCC
TTCCCTTCTGAGCTGGGGCCTCTGCTGGCCCCCATGTGAGCGGTAACTGGGCTAGCCCCC
GACCTGTGGGGCTCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved