Felis_catus Locus Poly:13:SNORD115
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:13:SNORD115
Felis_catus
Poly:13:SNORD115
scaffold_92069
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2511..2591, 4300..4380, 6104..6184, 7911..7991, 9743..9823, 11556..11635, 13359..13438, 15060..15140, 16578..16658
17658
GTCCTTAGGCAACCAAATGTCCAGACATGCTCATGATGTGGGGCTTTGTATGCTGAACT
ATAACTCCTTGGCCTTTTCATGCAATAGACAATTTAGATGGTGCCTTGCCCAAAGAAGAT
CAGACCTCCTCTTCCATACACACTCTTGCCAATAAAGTTCACATCTTTGGAAACCAGGAA
GCATCTCTCCATAAGGCCCCACTGGACTGATGGTCAGGAAGAAATGAGTGGACACTGCAG
AGGACATCTATATATCCTTGTTAGGAGATGGTGATGTTGATGCAATGCACACCAGGCCAT
TGAACATGCCAGGTATTTTCTGTGGGTCTCCATATGGAAGCATCTGGGGAGGAGTTTTGC
CTGCCAGGTAACTGTTGGTCAGCTCAAATTCTTGCTGAGGAGGAATTATATTCCATGGTT
CAATGGGCTTTGATTACCATGTCTTATACAGACCTGGCCAATCCCAGGATGCCAAGCCCA
CCTGTTCCTCAAAAGCCAAAGGCCAAGCCTACCAGCCATTGCTTATGATGCTGTATGCAA
CATGATCGAAAAAAACTGACCCATTCATTGGAGAGAATGTGTAGCAAGAATGCTGCCTAG
TGGTGCATGTGCAATGCTCAGACACATGTTGGGGCCGGTTTTCCCAAGATAGCATATACA
CATACAGGCTGAGGGCTTTGGGTGCCAGGCTGCAGCACTCCCGCCACCCCTCAATCCTTG
CTGGAATCATGAGTCAGGCCCCATGAATTCGAGTATCATGCACATGGCCCACCAGGTCAG
GGCCAAAGGGGAAGGGTATTGTCATAGCTTCCCTACCTTTCTCGATACAGACCCCATGCC
CAAACAAAGATTCCACATGGCATATGGTGGGAAATTGGCCCAATATGGGAATAGGCCCTA
GCCAGGTGCCCAAATGGCCAACCTGTGCTTCATAAATGATCTCTTGTAAGCAAGTTGAGC
TGGCAGAAAGAAGACAGAGGCTCGTGGAGACTGCCTTGGTTGGGTCAACGATGAGAACTC
ATATGGTCTTGAACAGAGATGATGACATAAAAATCATGCTCAATAAGATTACACTGAGGC
CCAATCGAAGAGACAATCATGGGGTGGGATCCAGGAGACCATGGGGCACTTGGAAATTGC
AGGCAAATTGGGCTTGAGGTGACCAATCCCTCGAGGCTCCCAGTGTGGCTCTCCCCAGGC
TTGGGGGCTTGAATGTGACCAAATTGGGCTCGTGCAATGGTGATTTGTGTGCTCGTAACT
AGTTACTCTGGATACACCTCATTTGCAGCCTTGGATTAGCTCCCTTGATGTCCGTGTGTC
TTTCAGTGGAACATCATCGTGACAGGGTCTCGAGGCAGCACCAATAAGAAGAGGTGAGTG
CATCCTTGTGCTCATACACTGAGGCAAGGGATTGCGTGGTCCTCCAAGGGATCCTCTTTC
CTGCCAGCCTGTAAGCTGTGTTCTCCACTGTAGGAAGGCTGTCAGGTTGATGTCAGAATC
ACTGAGGCCCTTGGAGGAATGCAAGGTATGGCAGTGGGCATTGGAGCCCCCCACCCATGA
CCTCCTATGGGGAAAAGTTCCCACCAAAATTTCATGCAATGGGCGATGGAGGAAGATGCT
GGGACTGGGGCTACCTGGCTGGACACTAGATAGCTTTGGCATAGCGCATAGATGGTGTCC
AAAAATTGCTGGAAACATGGACTGGACCTCGGGTGGCATTCGGGCTCCTGACTCCTAGAT
CTTCACCATTGGCCATGACTTATGGATTCATGTCCTTATGGGGCCTGTGGGAATTCCCCA
AACTGGATGGCACTTGGCCTGATGATAGCCTTTTGGTTGGTACCATGAGCCAGGGCATGC
TGGGGTTCTTGACTTGTGGCCCAATTCCCAATGAGGTTGAAGTCGCTGGGGAACCATGGT
AGCCCCTGTCCTAGCAATAACCTTAAGTGCAAAGACAGGAAAGGATGAGGTGTCCAAATG
GGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGTGCCTGATGCTG
CAGCCTCCATGATCAGTTTCCTGTGGGGCTCTGATTTCCCTGGTGTCCAGTGGAGCCACT
GGACTGAGGCTGAGGGACTTGGCGCCACGCTGGAGCCTTCCTTCCTGCCATCCCAGGATT
TTTGCTGGTGTCATGAATTCAGTCCACCACCACCCTTTCTGAGCTCTCTCCCAATGGCAA
AAGGTGAAGTATGATGGGGAAGTGCATCCTCATGGCTGAATTGCATCTTTCAGCACAGAG
CCCATGACAGGACATAGAACCCACCTGGTTCAGGGAGGGTAGATTGGCCCAGCTTCAGGA
ATAGGTTGCAAGCCAGAAGAAAAATTGCCAACCTGCGCTTCACAAACAAGCTGTGTTAAC
CATGTTGAGCCAGAGGGCTGAAGACAGAGGCATGTAGGGACTGCCTTAGTTGGGTCAATA
ATGAGAATTCATATGGTCATGAACAGAGATGATGACTTAAAAATTATGCTCAATAGGATT
CTGCAGAAGCCCAATGGAGGCCATTGCACTGAGGTATGATCCTGGAGAATCCTGTGGCCC
TGGATTACCACTGGAACCAGGGGCTCGAGGTGACAAATCCCTCCAGGTTACCGAGGGGGT
TCTCCTTGGTCTATGGACCTCCACATGCCTAAGACCTGTTCTGGCCCTGGGGTGTTGTGT
GTCCATCACTAGTGATTCTCGACTCATCCCTGGGAACCCAACTAAGCTCCCTCAGCGTCC
TTGTGTCTTTCAGTGGGACATCGCTTTGTGACCACTTTCTCACCATTGACCCCACCATGG
GAGGAGAGTGGATGCCTGTGTGAGTACCCGGAGACCCAGTGCACATGGGCATTTGGTGAA
GCTGACCTCAGGGCAAGGCGAGCCATCTTGTGGGACTGGGGCTCAAACATCGCCCCAGAG
AGGTGGCGTGTCCTTGAAACTCTACCCTGGACAGTAGGCTGTCTGGAAAAAACTGGTCAC
CTGCAACACCTGAAAGGGATGCCACAGTCCCCCGTGGGATCCTCTTAATTGACAGACCAT
AGGCTATGTTTTCCAGTGTGGGATGGCTCTCAGGTTAATGTCAGAATCACTGTCTCCCTG
GGAGGCACCAGAGTTGCTGTGGTGGGCATTGCAGACAGCCAAGGCAACCGACTGTGGGGA
TTCCGCCAATTTTCCTCACAATGGGCATTGGAGGAAGGGACCGGGCCCAGGGGTTCATGG
TTGGACACTAGAACTTTTGGAATAAGGGGTAGAATGTATCTGGAAAATGCTGACAGCTTG
CCCGGACCCAGAGTGTCACGTAGGCTTCTGGCTCCGGGTTCTTCACCATTGGCCCAGTCC
AATGGTCGTGTGTCCTTAAGGGGCCCATGGGTCATCTCGCAGCTGGATGGGGCTTTGCTT
GACAATGGCCCTTGGGTCAGTACCACGAGTCAGGGCAGGCTGGATATCTGGACTGGTGCC
CCCGAGTCCCAGTGAGGTTGAAGTCGCTGGGGAAACGTGCTGGCCCCTCACCCTTCCCTC
ACTGTAATCTCAAAGACAGGAAGGGATGGGGTTTCCACACAGAAGTCATGGAGGAGTGCT
GATGGAGACAGTGTTGGACGCTAGTGGGATGCCCATCAGGCCCTGATGCCCCAAGGGATG
TTGGCACTGCGTTTGCGTGGTAGCGTTGGTGGGCCCTTCTGGGGCCCCATGCCCGCCCAT
TCCTGGCAAAACTCAGGGCCACTCCATGAAAGGAAGGCCCAGGTTTCTGCCTGCCACCTA
CTCGCCAAGGTCTGTCCCAACCACGTTGCAGGAGGACCTGTGCCTGCTGTAGCAGCCTCC
ATGCTCAGATTCCTGTGGGGTTCTGAATTACCTTTTTTCCAGTGGAGCCACAGACTCTGA
GGGCCTTGTGGACACGCTGCAGCCTTCTTTCCTGCCAGGCCAGGATTGCAGAATTGTGTC
ATGAATGCAATTCCAGCCCCGCACATTCTGAGATCCCTCCCATTGCCACAGGTGAGGTCT
GAGGGGGAAGGCGTTTGTCATTGCTGACCTGCCTCTCTCTGCACAGATCCCACACCCCGA
CCGAGATCCCACCTGGCGCATGGAGGGGAATTTGGCCAATCATCTGGAACAGACCCTGAG
CCAGGGGCTCTCATGGCCACCAAGGACATCACAATCCATTTCTGGTAAGCATGTTGAGCT
GGTGGGTAGAAAGCAGAGGCGGGTGGGGACTGCCTTGGTTGGGTCAATGATGAGAACTCA
TAAAGTCTCAAAGACAGATGATTACCTACAAATTATGCTCAATAGGATTAAGCTGAGGCC
CAATGGAGGGCAATGCACTGAGGCGGGATCCTGGGGAACCCTGTGGCCCTGGCGTAGCAC
TGGCACCTGGGGCTCGAGGCGACTGATCCCTCGAGGTTCCTCAGTGCTGCACACCCAGGA
CTCTGAAACTCGGCACACCTAAGACGTGCTCCCGCCCTGGGGCATTGTGTGCCCATTACT
AGTGCTTCCCAGGACTCATCCCTGAGAACCCAACTAAGCTCCTTCGGTGTCCTGGTGTCT
TTCAGTGGGACATCATCTTGGCGACCAGGGTCTCACCATTGAGCCCACCATGGGAGGAAA
GTGGATGCCTGTGTGAGTACCCAGAGACCCAGTGCCCTTTGGCGGATTGGCGACGCTGCC
CTCAGGGCAACTCCAGCCATCTTGTGGGACCTGGGCTACGTCACTACAGCAGAGGGCTGA
CATGTCCCTGAAAGTCTGCCTTGTGCAGTAGGCTGCCTAGAAAAAACTAGTCACCCAGAC
ACCTGAAAGGGATGCCATGTTCCCCAGCGGGATCCTCTTCTTGAGGGACCATGGACCACA
TTTCCCAGTGTGGGAGGGTGCTCTGGTTGATGTCAGAATCACTAATGCATTAGTAGGCAC
ACGAGGTGTTGTGGTGGCCATTGCAGATGGCCAATGTGACCTCCTGCATGGAAGCGGTAC
GCCCAAATTTCATGCAATGGGCTTTGGAGGAAGGGGATGGGTCTGGGGCTACCTGCCTGG
ACACTAAACAGCATTGGCATAACAGGTAGATTGTATCTGAAAAATGTTGGCTAAGGGTCC
CAGACCCCGAGTGGCATGCAGGCTCCTGCCTCCGGGATCTTCAACATTGGCACCGTCTGG
TGGTTGCGTGTCCTTATGGGGTCTGTGGGTCGTTCCACAGCTGAATGGGGCTTTGCCTGA
TAATGGCCCTTTGGTTCGTGCCACTAGCCAGGGCACATTTTGTTATTTGATTTGTGACCC
CGACTCCCAGTGACTTTGAAGTCGATGGGGAACCAGGCTGGCCCCTCACCGTTCCCTCAC
CATAATCTCAAAGACAGGGAGGGTTGAGGTGTCCCCCCGGGAGCCATGGAGCAGCGCTGA
TGGAGACAGCTTTGGATGCTGGTGGGATACCCATCAGGGTCCTGATCCCCCAAGGGATTC
TTTCTGCGTGGTAGCATCCTTGGGCCCTTCTGGCACCCCATGCCCGCCCATTCCTGGCAA
AATGCAGGACCGGTCCCTGCCAACCAAGGCCCGGGATTCTGCCTGCAACCGACCAGCCAA
GGTCTGTCCCAATCCCACTGCGGGAGGACCTGTGTGTGTGGCCTGATGCCTGCTGTAGCA
GCCGCCATGCTCAGATTCCTGTGGGTCCTGAATTCCCTTGTTTCCAGTTGAGTCACAGAG
GCTGAGGGACTTGTGGACACGCTGCAGCCTTCCTTCCTGCTAGGCCAGGATTTTTGCTGG
CATCATGAATGCAGTTCCAGTTCCACACATTCTGAGATCCCACCTAATGTCACAAGGTGA
GGTCGGATGGGGAAGAGGTTTGTCATTGCTGAGCTACCTCTTTCTGTGCAGATCAGCGCC
CCTACCGAGATTGCACCTGGCGCACCGAGGGGAGTTTGGCTCAGCATCAGGAACAGGCCC
CGAGCCAGGGACCATCATGGCCACCCTGCACATCACAAACCCTCTCTGGTAAGAATGTTG
AGCTTGTGAATAGAAGGCAGAGACGGGTGGAGACTGCCTTGGTTGGGTCAATGATGAGAA
CTTATATGGTCTTGAAGACAGATGATGACCTAAAAATTATGCTCAACAGGATTACCCTGA
GTCCCAGTGGAGGGCACAGCACTTAGGCGGCATCCTGGGGACCCTAGTGGCCCTGGCATA
GCGCTGGCACCTGGGGCACATAGCAACCCACCCCTCGAGTCTCCCCAGTGGGGCTCTCCC
GTGTCTCTGGGCCTCCGTGCGCCTAACACGTGCTCCCGCCCTGGGGCGTGGTGTGCCCAT
TACTAGTGCTTCCCGGGACTCATCCTTGGGTACCCAACTAAGCTCCCTCGGTGTCCTGGT
GTCTTTCAGTGGGATGTCATCTTGGTGACCAGGGTCTCCCCATTGAGCCCAACATGGGAG
GAGAGTGGATGCTTGTGTGAAAACCCAGAGACCCAGTGCCCTTGGGCCAGTTGGCGAGGC
TGCACTTAGGTCAACGCCAGCCATCTTGTGGTACTGGGGCTTCATCCTCAACCCAGAGGG
CTGGTGTGTCCCTGAATGTGTGCACTGTACACTAAGCTGTCTGGAAAAAAAAGGTCAACC
ACGACACCTGCAAGAGATGCCACGGTCCTCTGCGTGATCCTCTTACTTGACGGTACATGG
GCCACGTTTCCCAGTGTGGGAGGGCACTCTGGGTGATGTCAGAATCACTGATGCCTTAGT
AGGCACGCGATGTGCTGTGGTGGGCATTGCAGACGGCCAATGTGACCGCCTTCATGGAAG
CAGTGTGTCCAAATTTCATGCAATGGGCTTTGGAGGCAAGGGCTGGACCCAGGGTTACCT
GGAAGGGCACTAGACAGCTCTGGCATAACGGGTAGATGGTATCTGAAAAATGCTGGCAGT
GTGGCCCAGACCTGAGTGCCATCCACTCTCCTGCCCCTGGGTTCTTCACCATTGGCACGG
TCTGGTGGTCTCATGTCCTTATGGGCCTCAGGGGTAGTCCCGCAACTGGATGGGGCTTTG
CCTGACAATGGCCCTTTGGTCGGTGCCACCAGTCAGAGCACGCTGTGGTTCTTGATTTTG
ACCCCGAGTCCCAGTGAGTTTGAAGGCACTGAAGAACTGTGCTGGCCCCTCACCCCTCCC
TCACCGTAATCTCAATGACAGGAAAGGATGAGGTGTCCCCATGGGAGCCATGGAGCAGCG
CTGATGGAGACAGAGTTGGATACTGATGGGATGTCCATCAGGGTCTGATCCCCAAAGAGA
TCTTGGCATTCCATCTGCGTGGTAGAGTTCGTGTGATCTTCCAGCGCCCCATGCCCACCC
ATTCCTGGCAAAACACAGGGCCATTCCCTGCCAATGACTGGGATGCTGTCTGCCATCGAC
CCACCAAGGTCTGTCCCAATCACACTGTGGGAGGACCTGTGCATGTGGCCTGGTGCCTGC
TGTGGAGACCTCCATGCTCATATTCCTGTTGGGCCCAAATTCCCTTGTTTCCAATGGATC
CACAGAGGCTAAGGGCCTTGTGGACATGCTGCTGCCTTCCTTCCTGCCAGGCCAGGATTG
CAGGATTATGTCATGAATGCAGTCTCAGCCCCACACATTCTGAGATCCCTCCCATTGCCA
CAGGTGAGGTCTGATGGGGAAGGCATGTGTCATTGCTGAACTGCCTGTTTCTGTGCAGAT
CCCCCGCCCCAACCAAGATCCCACCTGGCACCAGGAGGGGAGTTTGGCCCATCTTCTGGA
ACAGACCCTGAGCCAGGAGCCCTCAGGCCACACTGTGAATCACAAACCCTCCCTGGTAAG
CATGTTGAGCTGATGGATAGAAGGCAGAGGCGGTAGGGGACTGCCTTGGTTGAGTAAATG
ATGAGAAGTCATATGGTCTCGAAGACAGATGATGACCTAAAAATTATGTTCAATAGGATT
ATGCTGTGGCCCAATGGAGGCCACCTCACTGAGGCGGGATCCTGGGGACCCCTATGGCCC
TGGCTTACTGCTGACACATGGGGCTCAACTCGACCAATCCCTCAAGTCTCCCCAGTGGCG
CTCTCCCCAGTCTCTGACCCTCTGTGCACTGAAGACATGCTCCTGCCCTGGGACATTGTG
TGTCCATTACTAGTGCTTCCCGGAATTCATCCCTGGGAACCCAACTAAGATCCCTAGGTT
TTGGGTGTCGTTCAGTCTTGGTGACCAGGGACTTGCCACTGTGCCCACCATGGGAGGAGA
GTGGATGCCTGTGTGAGTACCCGGAGACCCAGTGCCCTTGGGCCTATTGGTGAGGATGCC
CTCAGGGCAACTCCAGCCATCTTGTGGGACTGGGGATTCATCGTTGCCCCAGAGGGCTGA
CGTCTCCCTGAACATCTGCCTTTTGCAGTAGACTGTCTGGAAAATACAGGTCACCCATGA
CACCAGCAAGGGAAGCCATGGTCCCCCACAGGATCCTTTTTATTGATGGCCCATGGGCCT
GTTTTCCCAGTGTGGGAGGGCATACTGGTTGATGTCAGAATCACTGATGCCTTAGTAGGC
ATGCAAGGTGCTGAGCTGGGCATTGCAGACGGCCACTGTGACTTCCTATGTGGAAGCGGT
GCAACCAAATTTCACTCAATTGGCTATGGAGGAAGCGGCCAGGCCCGGAGCTCCCTGGCT
GGACACAAGACAGCTTTGGTATAACGGGGAGACAGTGTCTGAAAAATTCTGGCAGTGTGG
CCCAGACCTCGAGTGGCATGTGGGCTCCTGCCTCTGGATTGTTCACCATTGGCACCGTCT
GGTGGTCACGAGTCATTATGGGGCCCGCGGGTCGTCCCGCAGCTGGATGGGGCTTTTCCT
GACAATAGCCCTTTGGTCAGTGCCACGAACCAGGCAACCTGGTGTTCTTCACTTGTGATC
CCGAGTCCCAGTGACTTAGAAGGGGCTGGGGAACCGTGATGGACCCTCACCCTTCCCTCA
CCATAATTTCAAAGACGGGAAGTGATGAGGGGTCCCCATAGGAGCCATGGAGCAGTGCTG
ATGGAGACAGTGTTGGGTGCTGGAGGGATGCCCAACAGCGCCCTGATGCCCCAAGGGGTC
TTGGTGTTGCATGTGCATGGTAGCATTCGTGGGCCCTTCCTGGACCCCATGCCCACCCAT
TCATGGCAAAACACAGGGCCAGTCCCTGCCAGCCAAGGCCTGGGATGGTGCCTGCCACCG
ACCAGTTAAGGTATGTCCCAATCACACTGCAAGAGGACCTGTGCATGTCCTGGTGCCTGT
GTAGGCCTGGTGTGCAGGCCTGGTGCCTGCTGGGGGAGCCTCCATGCTCAGAATCATTTG
AGGCTGAAATTCCCTTGTTTCCAGCAGAGCCACAGAGGGTGAGGGCCTAGTGGACACACT
GCAGCCTTCCTTCCTGCCAGGCCAGCATTGCAGGATTCCAACATGAATGCAGTCCCAGCC
CCCCACATTCTGAGATCCCTCCCATTGCCACAAGGTGAGGTCTGATGGGGAGGGTGTGTG
TCAATCTTGAGCTGCCTCTCTCTGCACAGATCCTGCGCCCCAACTGAGATCCCACCTGGC
ACCTGGAAGGGAGTTTGGCCCATCTTCGGGAACAGGCCCTGAGCCAGGGGCCTCCATGGC
CACCCTGTGCATCACAAACCCTCTCTGTTAAGCAGATTGACCTGGCAGGTAGAAGGCAGA
GGCGGGTGGGGACTGCCTTGCTTGGGTCAATGATGAGAACTCATATGGTCTCAAAGACAG
ATGATGACCTAAAAATTATGCTCAACATGATTATGCTGAGGCCCACTGGAGGGCACCAAA
CTGAGGCGGGATCCTGGGGACCACTGTGGCCATGGCGTAGTGCTGGCACCTGGGCTAGAG
GCGACCGATCCCTCAAGGCTCCCCAGTGGGGTTCTCCCTGGTCTCTGGGCCTCCACACGC
CTAAGACGTGCTACTGCCCTAGGGAGTTGTGTGCCCATTACTAGGGCTTCCCGGGACTCA
TTCCTGGGAACCCAACTAAGATCCCTCAGTGTCCTGGTGTCTTTCAGTGGGACATCGTCT
TTGTGACCAGGGTCTCGCCATTGAGCCCACCATGGGAGGAGAGTGGATGCCTGTGTGAGT
ACCCAGAGATCCAGTGACCTTGGGCCAATTGGCGAGGGAGCCCTCAGGGCAACGCCAGCC
ATCTTCTGGGACTGGGGCTTCGTCCTCACCCGGAGTGCTGGAATGTCTCTGAACATCTCC
CCTGTGCACTAGGGTGTCTGGAAAAAACAGATCACCCGCAACACCTGCAAGGGATGCCAC
GATCCCCCCCAAGATCCTATTACTTGATGGCCCATGGGCCACGTTTCCCAGTGTGGGAGG
GTGCTCTGGTTGATATCAGAATCACTGATACCTAAGTAGGCACGTGACGTGCTGCAGTGG
GCATTGCAGACGGTCAATGTGACCTCCTGCCTGGATGCAGTGTGCCCAAATTTCACACAA
TGGGCTTTGGAAGCAAGGGCCGGACTCAGGGTTGCATGGATGGACAATAGACAGCTTTGA
CATAACGGGTAGATGATATTTGAAAAATGCTGGCAGCGTGGCCCAGACCCAAGTGGCATA
CGGGCTCCTGCCCCTGGGTTCTTCATGATTGGCACCCTCAGGTGTTTGCCTGTCCTTATG
GAGCCTGTGGGTGGTCCCGCAGCTCGATGGTGTTTTGTCTGACTATGGCCCTTTGATTGG
TGCAACGAGCCAAGGCACGCTGTGGTTCTTGACTTGTGACCCCGAATCCTACTGAGTTTG
GAGGCACTGGGGAACCGTGTTGGGCCATCACCCTTCCCTCACCGTAATCTCAAAGATGGG
AAGGGATGAGGTGTCCCCACGGGAGCCATGGAGCAGTGCTGATGGAGAAAGTGTTGGATG
CTGATGGGATGCCCGTCAGGGCCCTGTTCCTCCAAGGGATCTTGGCGTTGCATCTGCGTG
GTAGGGTTCATGGGACATTCCAGGGCCCCATGCCCACCCATTCCTGGCAAAATTCAGGGC
CGGTCCCTGCCAGCCAAGGCCCAGGATTCTGCCTGCCACTGACCTGCCAAGGTCTGTCCC
AATCACGCTGCGGGAAGACCTGTGCATGTGGCCTGGTGCCTAATGTGGCAGTCTCCATGC
TCAGACTCCTGTGGGGCTTGAATTCCTTTGTTTCCAGTGGTGCCACAGAGCCTGAGAGCC
TTGTGGACATGCTTCAGCCTTCCTTCCCGCCAAGCCAGGATTGCAGGATTTCGTCATAAA
TGCACTCCCAGCCCCACAGATTCTGAGATCCCTCCCATTGCCACAAGGTGAGGTCTGATG
GGGAAGGCATTTGTCATTGCTGAGCTGCCTCTCTCTGCGCAGATCCCACACCCCGACCAA
GATCCCACCTGTCGCATGGAGGAGAGTTTGGCCCATCTTCAGGAACACACCCTGAGCCAG
GGGCCATCATGGACACCCTGCACATCACAAACCCTCTCTGGTAAGCATGTTGAGTTGGTG
GGTAGGAGGCATAGGAGGGAGGGGACTGCCTTGTTTGGGTCAATGATGAGAACTCATATG
GTCTCGAAGACAGATGATGACCTAAAAATTATGCTCAATACGATTACCTAAGGCCCAGTG
GAGGGCACCAAACTGAGGTGGGATCCTGGGAATTCCTGTGGTCCTGGCGAAGCTCTGGCA
ACTGGGGCTCGAGGCCACCGATCCCTCGAGGCTCCCCAGTGGGGCTCTCCCATGTCTCTG
GGCCTCCGCACACCTAAGACCTGCTCCCGCCCTGGGGCGTTGTGTGCCCATTACTAGTGC
TTCCTGGGACTCATCCCTGGAACCCAACTAAGCTCCCTTGGTGTCCTGATGTCTTTCAGT
GGGACGTCGTCTTGGTGACCAGGGTCTCGCCATTGAGACCACCATGGGAGGAGAGTGGAT
GCCTGTGTGAGTACCTGGAGATCCAGTGCCCTTGAGCCGATTGACGAGGCAGCCCTCAGT
GCAATGCCAGCCATCTTCTGGGACTGGGGCTTCATCCTTGCCCCAGAGGGCTGGCATGTC
CCTGAATGTCTGACCTGTGAACTTGGCTGTCTGGAAAAAACAGGTCACCCACAACACATG
TAAGGGATGCCACAGTCCTCCGCAGGATCTCTTACTTGACGGCCCATGGGACACTTTTCC
CAGTGTGGGAGAGCGCTCCAGTTGATGTCAGAATCACTGATGACTTAGTAGACACTCGAC
CTGCTAGAGTGGGTATTGCAGATGGCCAATGTGACCTCCTGCGTGGAAGTGGTGTGCCCA
AATTTCACGCAATGGGCTTTGAGGCAGGGGCCGGACTCGGGGATACCTGGATGGACACTA
GAGCTTTGGCATAACTGGTAGACAGTATCTGAAAAATGCTGGCAGCGTGGCCCAGACCCA
AGTGGCATGCAGGCTCCTGCACCCAGGTTCTTCACCATTGACACCCTCTGGTGGTGGCAT
GTCCATATGGGGCCCGTGGGTGGTCCCGTAGCTAGATGGGGTTTTGTCTGACAATGGCCC
TTTGGGTGATGCCACAAAGGCACGCTGTGGTTCTTGACTTCTGACCCCGAATCCTACTGA
GTTTGAAGGCGCTGGGGAACCGTGCAGGCCCCTCACCCTACCCACACCATGCTCTCAAAG
ATGGGAAAGGATGAGGTGTCCCCACAGGAGCCATGGAGCAGTGGTGATGGAGACAGTGTT
GGATGCTGGTGGGCTGCCCATCAGGGCCCTCTTCCCCAAAGGGATCTTGGTATTGCGTTT
GTGTGGTAGCATTCATGGGCCCTTCTGGGGCCCCATGCCCACACATTCATGGGGAACACA
TGGCCGGGCCCTGCCAGCCAAGGCCCGGGTTTCTGCCTGCAACCGACCCACCAAGGATCT
GTCCCAATCACGCTGTGGGAAGACCTGTGCGTGTAGCCTGGTGCCTGCTGTGGCAGCCTC
CATTTTCAGATGCCTGTGGGGCTTGAATTCCCTTGTTTCCAGTGGAGCCACAGGTATTGA
AGGCCTTGTGGACACGCTGCAGCCTTCCTTCTCGCCAGACCAGGATTGCAGGTTTGAGTC
ATGAATGCAGTCCCAGCCCCGCCCATTCTGAGATCCCTCCCATTGCCACAGGGAGGTCTG
ATGGGGAAGGCATTTGTCATTGCTGAGCTGCCTCTCTCTGTGCACATCCCGGGCCCCAAC
TGAGATCCCACCTGGCACACTGAGAGGAGTTTGGCCTATCTTCAGGAACAGGCCCCGAGC
CAGGGGCCCTAATGGCCACCCAGAGCATCACAAACACTCTCTGGTAATCATGTTGAGCTC
ACGGGTAGAAGGCAGAGGCGGGAGGGGACTGCTTCTGTTGGGTCAATGATGAGAACTCAT
ATGGTCTGGAAGACAGATGATGACCTAAAGATTATGCTCAATAGGATTACCTGAGGCCCA
TTGGAGGGCATCTCACTGAGGCAGAATCCTGTGGACCCCTGTGGCTCTCGTGTAGTGCCA
GTACCTGGGGCTCGAGGCGACCGATCACTCGAGGCTCCCCAGTGGGCTCTCCCTAGTCTC
TGAGCCTCTGTACACGTAGAATGTGCTCCCGCCCGGGAGTGTTGTGTGCCCATTACTAGT
CCTTCCCGGGATTCATCCCTGGGAACCCAACTAAGCTCCCTTGGTGTCCTGATGTCTTTC
AGTGGAATGTCGTCTTGGTGACGAGGGTCACCATCTTGTGGGACTGGGGCTTCGTCCTCT
CCCCAGAGGGTTGGCATGTCCCTGAACATCTCCCCTCTGCACTAGGCTGTCTGGAAAACA
CAGGACACCCTCGAAACCTGCAAGGGATGCCATGAACCCCGGGAGATCCTATTACTTGAA
GGACCATGGGCCACGTTTCCCATCAACTCTGGTTGATGTCACAATCACTGATGCCTTAGC
AGGCACATGACGTGCTGCGGTGGGCATTGCTGACAGCCAATGTGACCTCCTGCCTGGAAG
CGGTGCACTAAATTTCACGCAATGAGCTTTGGAGGCAGGGACCAGACCTGGGGTTACCAA
AAGGGACACTAGACAGCTTTGGTATAATGGGTAGATGGTATCTGAAAAAACCTGGCAGCA
TGGCCCGGACCCCAAGTGGCATGCTGGCTCCTGCCCCCGGTTTCTTCACAATTGGCACCG
TCTGGTGGTCACGTGTCTTTATGGGGCCCATGGGTCATTCCGCAGCTCAATGGGGTTTTG
TCTGACATTGGCCCTTTGGTTGGTGCCACATGCCAAGACACGCTGTGCTTCTTGACTTGT
GACCCCGAGTCCCAGTGAGTGTGAAGGCACTAAGGAACTGTGCTGGCTCCTCACCCTTCC
CTCACCATAATCTCAAAGACGAGTAGGGATGAGGTGCCCCCACAGGAGACATGGAGCAGT
GGTGATGGAGACAGTGTTAGATGCTGGTGGGATGCCCATCAGGGCCCCGTTCCCCCAAGG
GATCTTGGCATTGCGTCTGCGTGGTAGCGTTCGTGGGCCCTTCTGGGGCCTATGCCTGCC
TATTCCTGGCAAAACACAGGGCAGGTCCCTGCCAGCAAAGTCCCGGGATTGTGCCTGCCA
CAGACCCGCCAAGGTCTGTCCCAATCACACTGCAGGAAGACCTGTGCATATGGCCTGGTG
CCTGCTGTGGCAGCCTCCATGCTCAGACTTCTGTGGATCTTGAATTCCCTTGTTTTCTGT
GGAGCCACAGAGGCTGAGAACCTTGTGGACACACTGCAGCCTTCCTTCCTGCCAGGCCAG
GATTGCAGGATTGTGTTATGAATGCACTCCCAGCCCCACGGATTCTGAGATCTCTCCCAT
TGCCACAAAGTAAGGTCTGATGGGGAAGGTGTTGGTCACTGTTGAGCTGCCTCTCTCTGC
GCAGATCCCAAGCCCCGACCAAGATCCCACCTATGCATGAAGGGGAGTTTGGCCCATACT
CAGGAAGTTGCCCCGAACCAAGGGGCACCCCCATGGCCACCCTACACATCACAAATGCTC
TCTGGTAAGCATGTTGAGCTGGCGAGTAGAAGGCACAGGTGGGTGCGGACTGCCTTGTTT
GGGTCAATGATGAGAACTCATATGGTCTCGAAGACAGATGATGACCTAAAAATTATGCTC
AATAGGATTACGCTGAGGCCCAGTGGAGGGCACCACACTGAGGCGGGATGCTGGGGACTG
CTGTGGCCCTGGCAAAGTGCTGGCTCCTGGGGCTCAAGGCCACCGATCCCTCGAGGCTCT
CCAGGGGGGCTCTCCCTGGTCTCTGGGGCTCTACGCGCCTAAGACGTGCTCCTGCCCTAG
GGCGTTGTGTGCCCATTACTAGTGCTTCCCGGGACTTATTTCTGGGAACCCAACTAAGAT
GCCATGGTGTCCTGGTGTCATTCAGTAGGACGTTGCATTAGTGACCAGTATCTCGCCATT
GAGCCCACCATGGGAGGAGAATGGATGCCTGTGATACCCGAGACCAAATGCCCTTGGGCG
ATTGGCGAGGCATGTTCTAGGACTGGGACTTCAACCTCGTCCCAGAGAGCTGGCATGTCC
CTGAATGTCTGACCTGTGCACTAGGCTGTCTGGAAAAACAGGACACCCGTGACACCTGCA
AGGAATGACACAGTCCCCCAAGGGATCTTACTTGACAGCCCATGGGCCACATTTCCCAGT
GTGGGAGGGCACTCTGGTTGATGTCAGAATCACTGATGCCTTAGTAGGCAAGCAACATGC
TGCGGTGGGCATTGCAGATGGCCAATGTGACCACCTGCGTGGAAGCAGTGAGCCCAAATT
TCACGCAATGTGCTTCGGAGGCAGGGGCTGTGCCCGGGGTTACCTGGATGGACATTTGAC
AGCTTTGGCATAACGGGTAGACGGTACATGAAAAATGCTGGTAGCGTGGCCCAGACCCCG
AGTGGCAGGCAGGCTCCTGCCTCTGGGTTCTTCACCGTTAGCCCCATCTGGTGGTCGCAT
GTCCTATGGGCCCCAGGGGTCGTCCTGCAGCTGTATGGGGCTTTGTCTGACAATGGCCCT
TTGGTCGGTGCCATGAGGCTGGACAGACTGGGGTTCATGACTTGTGACCCCGAGTCCCAG
TGAGTTTGACCCGCCAATGACCAATGACCCGCCAAGGTCTGTCATATCATGCTGCAGGAA
GACCTGTGCATGTGGCCTGGTGCCTGCTGTGGCAGCCTCCATGCTCAGAGACCTATGGGG
CTTGAATTCCCTTGTTTCCAGCCGAGACACAGAGGCTGAGGGCCTTGTGGAAGCAGTGCA
GACTTCCTTCCCACCAGGCCAGGATTTTTCTGGCATCATGAATGCAGTCCCAGCCTCGTG
CATTCTGAGATCCCTTCCACTGCCACAAGGTGAGGTCTGATGGGGAAAGCGTTTTGTCAT
TCCTCAGCTGCCTCTCTCTGCAAAGATCCCGCGCCCCCACTGAGATCCCACATGGCACAC
GGAGGGGAGTTTGGCCCATCTTTGGGATCAACCCCAAGCCAGGGGCCCTCATGGCCATGC
CACACATCACAACACCTCTCTGGTAAGGATGTTGAGCTAGAAGGTAAAAGGCAGAGGCGG
GTGGGGACTGCCTTGGTTGGGTCAATGATGAGAACTCATATAATCCCGAAGACAGATGAA
GACCTAAAAATTATGCTCAATAGGATTACACTGAGGCCCAGTGAAGGGCACCACACTGAG
GCGGGATCCTGGTGACCCATGTGACCTGGCATAGCGCTGGCACCTGGGGATCAAGGCCAC
TGATCCCTCGAGATTCCCCAGTGAGATTCTCCCTGGCCTCTGTGCCTCTGTGTGCCTAAG
ATGTGCTCCCACCCTAGGGCATTGTGCGCCTATTACTAGGGCTTCCCGGGACTCATTCCT
GGGAACCCAACTAAGCTCCCTTGGTGTCCTGGTGTCTTTCAGTGGGACATCGTCTTGGTG
ACCAGGGTCTCGCCATTGAGCCCACCATGGGAGGAGAATGGATGCCTGTGAGTACCCGGA
GATTAGGGCCCTTGGGCCTATTGGTGAGGGAGCCCTCAGGGCAACACCAGCCATCTTTTG
GACTTAGGCTTCGTCTTCGCCCCAGAGGGCTGCTGTATCCCTGAAGGTCTCTCCTGTGCA
CTAGGCTGTCTGAAAAACACAGGTCACCCACAACACCTGCAAGGGATGCCACAATCCCTT
GCGAGATCCTCTTCCTTGTCAGCCCATGGGCCACATTTCCCAGTTTGGGAGGGCACTCCG
GTTGATGTCAGAATCACTGATGCCTTAGTAGGCACGCGACATGCTGCTGTGGGCATTGCA
GACGGCCAAGGTGACCACCTGTGTGGAAGCGGTGTGCCTAAATTTCACGCAATGGCCTTT
GGAGACAGTGGCCTGGCCCGGGGTTACCTGGCTGGACACTAGACAGCTTTGGCATGGCAG
GTAGACGGTACCTGAAAAATGTTGGCAGGGTGGCCCAGACTCTGAAGGCATGTGGGCTCC
TGTCTCCAGGTTCTTCACAATTGGCACCGTCTGGTGGTCACGTGTCCTTATGGGACCCTT
GGGTCGTCCCACAGCTTGATGGGGTTTTGTCTGACAAAGGCCCTTTGGCGGGTACACAAG
CCAGGGCACAATGTGGTTCTTGACTTGTGACCCCGAGTCCCAGTGAGTTTGAAGGTGCTG
GGAACCATGCTAGACCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved