Felis_catus Locus Poly:19:SNORA25
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:19:SNORA25
Felis_catus
Poly:19:SNORA25
GeneScaffold_3078
SNORA18, SNORA32, SNORA25
1001..1131, 4290..4414, 4694..4820
5820
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGAGTTCATACATTTTATAGT
GACAGATGCAAGCTTTACTTCACTTGCAGGAAGGGGTCCCCAAACTGTAACTTAGGTTAT
AGCAATAATCAGAATACAGGATATTCCCACTTTAAGCATCTACGTTAGCTTAAACTAGTG
CATAATCTAAAATGAGGTTTAGGACTTAATAGTGTAATGTTAGAAATGATTACATGAGAT
TTCCTAAACCTGAATGATGGAAAGGTTAATTCACAATCATCCAATTTGTTTTATTATCTT
CCAGGGATTCCTAAATGGGAAGAACATAAGTACAGCCATATTAATATTTTCCTGAATTTT
TTTTAAGTCAAATAACTGTAGTTCTTAAAATGAGGCAGAATCTTAAACATTTTGCTGTAA
TCCTGGGAATTTCATTGGAGTTTGTAAAAATCAAGACTTCAGACATGGAAATCTTTTTCC
TTTGGTGGTTCTAGAATAGTTACTTGGTACTTTGCATGTCTATCTCAGTATACACTCTTG
TAACCAACCATTCAGAAAATCCTTATGCGATTAAATTATGGAATAAGTTTGTTGTAAATA
GGATGTTTGGCTTTTTGCACAATTTTGAACTCAGATTTAGAGCAAATCACAGGTCTAATT
GTTTTCTTGTGGAATCTTCAGTTTTAAAACTGTAAACAGTGGTTGAGGTCTATCCCGATG
GGGCTTTTTCTGTAGACCTACATCGTTGGAAACGCCTCATAGAGTATATGTGTGGTTTCC
TTTATTCACAGAACTATGTGTTAGATCTGTGGGAAAGAACTACAAGACATCTATCTGCTA
AAACACTGAAAGACCTAACGGTCATATATTTTAAATCTTAGGTATTGGAGTATCCCAAGA
ATCTGTATAGTTCAGGGCGTGCTAGTTTAGGTAAGTTTTTGTTGGGGACAGTGTAATCTT
GGGGGCACCGTTACAGTTCACATGATGAATTTAACTGTTCAACTGCTGAATGATTACAGA
CATGAACTAAAACTTGATTCTGACGGAGCTGACGATAGCTTAAAAAAAACCATGGTTGTC
AATTTGGATGCTAAGCACCTATTTTAGATTTTAATCACACATTTAAATTGTTCTTAATCT
TTTATTTGGTATTTTATCTGTAGGGGTGAATATGATTTGAACTCATTTATGTTTAGAGGT
AGGTGGAATGTTTAATTTTTGTTGAAATTTATTAAGAATTCAAAAGTACTGAAAAAATGT
GAGTTGTGAGTACGGTATCCCGTTACTGTTGTGCCTCATAGTTATTTGGGTATGCCACAG
AAGTATTAGATCTTAGGGTGCCTAGGTGGTTCAGTCAGTTGAGCAGTCCGACTCAATTTT
GGCTCAGGTCATGATCCCAGGGTCATAGGATTGAGCCTTGTGTCAGGCTCTGCGCTGAGC
GGGGAGCCTGCTTGAGGTTTTCTTTCTTTCTCTCCCTCTGCCCATCTCCCCCACTTGTGT
GTTCTCTAAAATTAAAAAGGTATCGAGATCTTGGCAAAGGTACTTGCCATGATATTTATA
CACCGAATTGGACAAACTGAGGAGACTGCATGTCTAGGGAATAACATGAAAATGCCCCCT
CCCGTCTTGTATGCTTATGAAACCATTGCTATGGTTCATCCTAATAACCTGTGTATTTGG
ATATGTTACAGTACGGATATTGAATTTAAATTCTGCCTAATAGCAATCTGAGCTACAGAT
TGATTTCACAATCCACAAGCCACAGTCTTGATTTCTAATGCATCATTTCTTTTAGTATTT
GACTTAATAGTTCCGTATGTATAATACAGAGACAGGATAAAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTACATTGAGA
CACAGGTAATGCTTGCATCACAGCAAGTTTATTGCAGTGGTGACAATGAGACCTGTAACA
TTTTCTGCTAGGCCTGTGGAGTAGAGTGGAAGTAACAAGACTTTCCCATATTGGAAGCAA
TTAAGGGATAACAATTTTATAGATCATTTGCCAAAACAGCAATCAGTGTAATTCTTAAAA
CTTGATTTCTAGGGCCCTAAAGTAAAAAAAAAACTGGATCCCAAAGATTGCAGGTAAGAT
TTCCCCTCAAGTGCCCAATCTTACAGGAGTTGAAAGCTTTTTCTTTCATAACACTTCATT
AATGTTCCTAATGCTTTGGTTTACCTAATTTTGGCAACAGCTAATTCTGGTGGTTTATTG
TATCCTAATTAAAAAAAAAAACCCTAGATATTAACGTGTGTTTATACAACTTGCCAGTGA
TTTGTGATGTTATGATGATGGGCAAAATGTTCAACTGCTCTGACTGGGCTGAATGAAAGT
AGCCTTTCTGAACATCCATCTAAATGAAATCTGGGGGACACTGGATGGCTCTGTCAGTTC
AGTGACTTCAGCTCATGACCTCATGGTTGGTGTATTTGAGTTCGGGCTCTGGGCTGATAA
GCGCTGAGCCTGCTTGGGATCCTCTATCCCTCTCTCTCGTGCCCCTCCCGCACTGGCATG
TTCTTTCTTCCCAAAATAAATACAGTATTTAAAAAATAAGTGGGGGCGCCTGGGTGGCTC
AGTCAGTTGAGTGTCCAACTTTGGTTCAGGTCATGATCTCGTGGTTCATGAGTTTGAGTT
CCGTGTTGGGCTCTGTGCTGACAGATCAGAGCTTGAAGTGTGTCTCCCTCCTCTTGCCCC
CCCCCCCCCAAAAAAACATAAAAAAATGGAATGGGTTGAAAAATTAATTATTCTAACTCT
GCATTTTTAAGCCTGGAAATTTCAATACGTATTAGTTCAGAACTGGGTATCTGGCTACTT
TGGAACCTAATTAAAACCACATTTTGAGAAATTTAGTCTAAACTTGAAAATCGTCCATAG
GTGGGGAATTCCTGAAGTATGTCCATATTCAAGTGGAGATTAAAGAAGCCCAAGGGAAAG
AACTCTGGCAAGTTATCTTTAATGGTATAATGGTCATTACCAAGGCTTTGAGAATGTAGT
TTCTCATTTGCTGTGGACATGACCATAAAAAATTTTTCCACTAGGCTTGCTTTCTTTATG
CTACTTTGCTAGCGTTCAGCCTATTGGGAACATTTACAACAGCCGTATTTCAAATTCTCA
TCTGACCATACATAGTATTTTGAATGGTGCATGCCTAGATCTCTGTTGTTACTAGTAACT
GGGCAGCTTGTAATATTAATAATAGATCTAATAGAGGGAGATTGGCTTTATTTACAGGAT
CATCTCTGGAAATGGAGTTTTACTTTTCTATTCCTTTTCTATAGGATAGGACTGATGGTG
ACAACTGTGGATTGAACAAAAGCTCCTTTTAAAAGGTATGTACACATTTGAAAAAATTTA
AAGGTCTAATTTATAGGTCATTTCAAAGAGGGCTTGTGGGGCTAAAACCAAGAGCCCTTA
ACGCTGTGACCAGATATCGAAGTTCTCCATAGGATATAATAGTTACTCAGTGTTGCTATG
TTTTCCTGAGGAGATACAAGATTTAGCTCCTTTACAGCCATGTGGGAAAGAAATGTCTCC
CAAATTTAACCAATGTATACTCTCGTTCTCAGGGCTATTTTGAAGAATGTGATTCTGACT
CGGAGGAACGACGGTGCTTGGGAGTGGAAGGAATCCCGTGTTAAAATTCTTAAATAAAAA
TTTATTGACTTTAAATAACTTCACCTATGTTACACATAATTTAAACAAAGAATCTTTACA
CATTTTGTAGAAAGTCAGCACGTATTTTTGGCTCGAAGTTTCTCTAGTGTTTTCTGTGGA
GGGAATAGAAAAATGAAATTAACAGTTGCAGTGCCCTAGACCTGGAAAGATTATAGGGGG
CCTCACTCACCTTATGAAATTCTTTTGCCCTTGCTCGGTTTTGGGCATATGCATCTTGCT
TTGCTTTCTCTTCCCTTTGCTGTTTCACTTCAGCTAACTGATTGTATAATCTGTAAGAAA
TTTATTCTTACATATTCTTCGTACTCTCAGTAATACTTAAGGAATGTGAGTAACCACACA
CGACACAGAAACATACATACCTTAAAGCCCTTTGACGCATGAGGGCTTGTGCAGTCTTTC
TGTCTTCAGGAAGTGACACTCTGACCTTATTCACACCCTTCACGTGACTCACAGATGAGC
CTGAGCAGAGAATAAGTGATCTGGGCAAATATTACCCTGCTATATGCTCTTTGTGAGAAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved