Felis_catus Locus Mono:33:SNORA67
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:33:SNORA67
Felis_catus
Mono:33:SNORA67
scaffold_215108
SNORA67
1001..1143
2143
ACTGGATATTTGTGGATATTTTATACATGCTGACTTTGGAAAGAGGTATTCCAAGACCA
GATAACCTACTTTCTTTATAGTTTTCCAAAGTAAAATTTCTCAAACTGTGGTTTTTAAGG
TGACTTCCAGGAAACAGGAAGAATAAGAGCTATGAATGTCTCAATACTTATCAGATGTCA
TACTTCTGAGAGTCATAGCAAAGACAAAGAGTAAATCACCTTCACGCTTTAGTATTCCCA
TACCATCTTTTCTTATCTTTCATAGATCAGGTGCTGGTCTTCAAAACAAATTTGGGGTTG
GCAATGTCTGAATAGCAAAAAGTGAACTTTGATACTTTGAAAGGTAATGGACCTGTCAGG
GTATCATGGGAAAACCGTCTCATAGAGCAGTATTTAAAAAGTACATTTCATATTTGCCAT
TTTTCGGCGAATAGTTTATCCCACAGTTTTTATAAAAAGCAATCTCCCATTAGGTCTTCA
CACGTACATCTTCTCTTGCATGGTATTTTCTTTCTATCTCTTTACCTAGTTCACCTTCCG
GCAGCTTAAGATCCTCAGGAACTTCACCGGTTTCGTCAGCAGGGAGAAGTAACCATCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAAGAAATTATATTCATTT
GCAGTGATTTAGATTATATCACTTTGTAATATTTACATAGTTTAAGTTGCAATCCACATT
AATTTGTACAAGTACACAGTAATACGTTAATATATTCTGAGCTTAAATAATGCTAAACAT
ACAAAAACCATAAAAGATGTATAGAACTAAAAGTATAAGTTCACTCCTTCTTGCACACCA
TGTTCCCCCAACTCTCTCTCTCTCTCTCTCTAATATGCCCTGAAGCATTTATGTGTATGT
GCACAATACAAATATAGTTGCTTTAGAAAAAATAAATGAGAATCCAAGGTGATTCCGTCT
ACATGGCGTCTGCTCATGTCCCTCTTCAGGAAATTAGTAACGTGGAAAAAAATCTGACAT
GTCTTAGGTTGTTGGAGGGAAGGGGATGTTTGTTTCCTTTGCCTTCCTTTGGCTGCCTAC
ACGTATACTTCAACCTTTCTGGATAGGTTGCGTCTTCTTAAGCCCTTGACCTAGACCAGA
GGCATTGATACACATCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGGA
AACTATCCATAGAGTTGGTCCTGGTGGACGATTTGGCCATAAGGGTGTGGCCCTTAACAT
GGTGACAGAAGAAGACAGGATTCTTTGAGATTTCGAGACCTTCCACAGATCCTCAATTGA
GGAGATGCGCGTCAATGTTGCTGACCTCATCTGAAGGGCTGTCCTGTTACCTAGCCCTAT
CCAGGATTCAGGCCCTGGGAGCTGAAGAGGAGCAGGAGTGGGGAGGGAAGGGAGCCATGG
GATAGACATCTTGTCAGGTTTTTTTCTTTTCTTTGAATTAATGTCACTTTTTGTGTCAAA
AAAACATAAATGGGATATTACAGGTATTTTTCAGCAAGTTGTTTTCACTTAACAGTATGT
CTTAGAAATCTTTCCAAATTGGAAACTATAGGCCTACCTCCGTCTCTTTAACTACTCACA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAACTGGTACAGCCA
CTTCCACTCTGGAGAACAGTATGGAGGCTCCTCAAAAACACAAAAATAGAACTATCCTGC
CATCCAGCAACAGGTGCCTAGACTTCTAACAGATTTTATAAAAGGCAATTGTTCGGAATA
CCAGATGCTAACATTGACAAACACAAAAGGAGTTGAAGATTTGGTCCTTACTCCCCTTTA
CTGCTTTGTGTTACTGTTTGTAACACAAACCTACCATAGAGGTAGATTTCAAAGCTCCTC
TCTATGGCACTACCAAATCTGGCTATGGCTTCCCACAGATATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved