Felis_catus Locus Mono:104:SNORD56
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:104:SNORD56
Felis_catus
Mono:104:SNORD56
GeneScaffold_2241
SNORD56
1001..1071
2071
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAAGTAAAAAAATTCACACTGTCCGTTCCTTTCCAAATCAGA
TTGATAGGCAAAAAACAGCTGTAAGAATTAATCTTTGAATTGTATCTTGTGAATCTGCTT
TTGGGTACCCCACTGGTTGTTGATCCTTTCTCACCCAGGGACAGCTACTGCCTTCTTGTT
TATCTTGCTTTATGTCCTGAGAACCTGGCGAGGCAACCATCGGGTCAGAGGCTGGATAGA
AATAGGGGTGCCATCCCATTCATGGCTAGGGACCTACTGACCCCCAACACAATTCTCTTT
CTTTCGGTTACTTTGGGAGTGGCTCTGATCTTGGGAGGGTAGTATCTTTTGTGCTCTTTG
GGGATCTCTCTTATATTCAAGGGTTTAATACTGCTAGGAATATTTACTGTTTGTCCTGGC
TGAAACTTGGCAAGATATCTGGAAGAATTTAAAGGAGTTCTATGGTCAGAAGATGGCCAT
ATTCAGAGCCTGACAGACTTTTAAAAATTCCTTTCTCCTCTCTGCAATGATGGCACTATT
ACTGGTCAACAGCAGTTCACCTCCTGCTTGTTGATCCTTTGGGTCTGAGTGAAGATGAGG
GGAAAAAAAAAGTCTTCTCCCCTGAGCTAAGATGAAACTATGTACCCAGAGAGAAAGAGA
AACATTGTAAAGCCTCTGGGGAAGGATTTACTAGACATTCCAGACACACAGCTCTGAATC
TAGAACCTAAGAATCTTTTGACTTCCACCTTAGTTGAAGATCTTCTCCCTGGTGTAAAGA
AGCAAATAAAGATAATGTAGTTGGGTGAGTGGGTCAGCCCACGAATTAAAGGTTGCAACC
CAATTCTTTGAGAAATTAAAAACTGTACTTGTCTTATAAATCAAGTGTACAAGAACAGAA
ATTCAGCTCTAAAAACAATTCAAAGCCCTCTTGTTCTTTTTACTGATCCCCAAACCTCTC
TATTCATCTAATGTTTGCAGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAC
GTCAGATCAAAAAATTATTTGTTTCTTTCTATTCTTGCTGCTCTCTCTGACAATCCTTAT
CCTAATTCTTATATCCTGAAGGTCTTTATGATTGTTTTCCCCATGTTTTGCCTTGCTCTG
GCCTGCAAAGATGATGCCATTGCAAAGGGGGTAACGTAACCTCCAAACAACTGGTGAATT
TGCCACGATGCTGGTAATTCTATAGGTCTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved