Felis_catus Locus Mono:76:SNORD115
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:76:SNORD115
Felis_catus
Mono:76:SNORD115
scaffold_114892
SNORD115
1001..1081
1921
TTATTATTCTCAATTTAGTGACTATATTACTTGAAGCACTCTCAGGAAGAAAACTACTT
TTTTACTGAAAATTTATTGAAAGGATATGAGACTTTTTTGTGCTCTGGTTCTCACTCCAT
TTTGCAATTTTCTTTGGCCTAAATATACAAGTAAACATATGTACACTAATTATTGTATTT
TCCTTGTTCTGCTTTTGTCAAAATTGTGACATTTAAGAGAACTAACAACATAATACAATG
GCTTATTGGTCATGATCTGAAAACTCACTTATATAGTTCCAAAGAATTCATAAAATGGTC
ACAATTTCAATCATCCTGACCTCTTATTAGGTTTTCATGTGGCTGAAAGAGTATGATTTT
ATGTGAATTTATATGCAATGAACCATGGCAAATACTCTGACATGAACTCTTGACTGGATA
GAATATTATTGGCCAATGGATATCTCCCATGTTCACAACCACCACATGAAAGTTTATCCC
AAATTAAGAAACCTGTATATATTGTCTTTTTTATGCTTGGTAAATGAAAGATGCATGAAA
TCTGTAAGAGGTCATTTTTGCAGATATGGTCATAAGACTTCCTTAACATAGAGCATGGAT
AAATCACAAGCCCAGGACAGATGTAACAATATGTTTTGCAATCCATCTTACAACTAACTA
CACAGATAATGACTTTGAAAAAGAGCACTGTTTGCTGCCACAGAATGAAGCTATGTGAGT
CAGGTGTCCATGATGGTATATGACAAAAGTCATATCTATTTTGGCATCACAAATTACAAA
ATCTATATCTGATAAACATATACAGGTCAAAGCATATACATGGGTAGGTAATGCCATAGC
TAGATCAAAGTTGAGAATTCATATTGTCTTGAAGAGAAATTATGACCTAAAAATCATGCT
CCATAAAATTACAATGAAGCCCAATGTAGTCAATAATGCCAAAGCAAAACGTTGAAGTTC
CATATTTCCCTTGTAGAGTAATGCGATTTTGTTCTTCAGGCAACCAGTCCCTTCAGGGAA
TCTCTTATATAGGCTTCATGTCAACAACACATCCTCAAGTTTAAGCTATATTTGGTGAGC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCATTGGAATAGTACCCCTGCAAACCTTT
TAGTTATACCTAAAATGGGTAAGATTCCAAATGGATGAAATATTTCCTCCACTACCCCTC
CACCACAGAAACATTACCATCTGTCTGTGCACAGATTGAAAACTAACCGTAATACATTGA
TACACTGAAGAGATAATAACTTCTGGGATCTTCACTGCATACTCAAAAGAAAGTCCTAAA
AGGAAGGATCATGGCCATGACATCCAAAGAGTGAAATGCAAGAATTAATCTGCCAATTGG
TATTGGCTAAAAAAAAAACTGTTAAGTATTGAGATAACTACATCGTGACCCCTGAGTATT
ATTAGGGCTTTAAAATTTCAATTTAAGGAATTGTGGGTTATTGGTGATGACAGTTTTTCC
TAATTGGCCCTTTAATCTGTTTGATTTTGCCAAATGAAACACGAGCTTCACATTTGACAT
TCTTCTCAAGACACAAATCCTTTAGAAGCTGGCACCATAAAGGAAAAAGATTAAAAAAAA
TTAGGAAGAAAAATTTATCATATATATATATGATATTGAGATCTTTGAAGCTTTGTTCAA
AG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved