Felis_catus Locus Mono:97:SNORA61
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:97:SNORA61
Felis_catus
Mono:97:SNORA61
GeneScaffold_1651
SNORA61
1001..1133
2133
CGGGCTCCACGCTGAGTGTGGAACCTGCTTGGGATTCTCTCTCTGTCTCTGTCTCCCCA
CCCCCCAAAATAAATAAATAAACTTAAAAAGAGAAAGAAATAGGTTGTTGTGGTTTTTAA
ATTTTTTTTTAATATTTGTTTATTTTTGAGAGAGAGAGAGACAGAGAGACACAGAGCGTG
AGCAGGGAAGGGTCAGAGAGAGAGGGAGACACAGAATCCGAAGCAGGCTCCAGGCTTGGA
GCTGTCAGCACAGAGCCTGACGCGAAGCCCGAACTCACAAACTGTGAAATCGTGACCTGA
GCCTAAGTTGGCCGCTCAACCAACTGAGCCACCCGGGTGCCCCGAAAGAAAAAAAGGTTT
AAGTACATGACCAAACACACACAGCCAGGTGATCAAAGAACCAGAATGTGAATCCGAACC
CTTTGCTTCTAACCACTATCCTTCCCATGCCTCCTCCCCACCTCTCAGCATCACACATTC
CCTGCCAAGAAACCTAAAGAAACTGAAGCACAGAGGCTGGTTCTAGAACTGATGGGGCTG
GCAGCCAGGGCCCTTGGGAAACCCAGGAGAAGCCTGTGGGGACCTCAGGACACCCATACC
CTTTCCCCTTTTCTCTGCCCCACACCCAGCTAGGGAAGATGGGGCCCAAGGGAGAGGCTG
TAAGAATGGGGGGGGGGGGGGTTGGAGCAGGAGGACTCAGGGAAAGGGGGTGCAGGGCTG
CACCAAACCAGGGACAGGAGGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGTAGAGCTCCACGCTGGCAATGTGGAGCCTGCTTAGGATTCTCTCTCTCTCCGA
CACCCCCTTTCAAAATAAATAAATAAACTTTTAGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATAAAAACTGTATTACTAATAAGGATGATTTACCCTCCGGTTCCCTTTCC
CATCAAATCTGAACACTGGTTTTGGTGGTCATAAGAGGAGGAAGAGAAACACTGAAGCTG
GCCTCACAGTGCTTATGGTCTGGTATATAACCCATGGGCTAGTTTCAAACAAGGTAAAAA
AAAAAAAAAAAGGGCTGGCTGAGTCGTTGAGCCTGGGACTTTGGGTGGGAGGGGGCACTT
CGGGTCCTCTGTCCCCCTCTCTCTGCCCCTTCCCTGCTCTCTCTCAAAAATAAACGTTTT
TTTTAATTAAAAAAAATAAGGGGTGATCTGAGGATATGACAAAATTCCTCAAAGTGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved