Felis_catus Locus Mono:100:SNORA72
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:100:SNORA72
Felis_catus
Mono:100:SNORA72
GeneScaffold_2757
SNORA72
1001..1131
2131
GAGGTAGGTGTACCGCTCATGGGGTCCCCCTCCCCCACTTGTGCTCTGTCTCTGTCTTT
CAAAAATGAATAAACATAAAAAAAAAAAGATTTTATTATACCTCCAAATACTGAGCAAGC
AACAGCTATTATATTGCAGTTTTTTGTGGGGTTTTTTGTTGTTGTTGTTGTTTTAAATAA
CAACAAAGCAGGGGCTCCTGAGTGGCTCTGTTGGTTGACCAATAGGTCCTGATTTCCACC
CAGGTCATGATCTCATGGTTTGCGAGATCCAGCCCCCCACTGGCTCTGTGCCAACAGTAG
TGTGGAGCTTGCTAAGGATTCTCTCTTTCCCTCTCTCTGCCCCTCCCCACTCAAAAGAAA
TAAGTAAACATTAAAAAAAGAAAAGTAACAACAAAGCACATTTCACTTTCTAGTCATACT
CTTCCCTCCTAACTGGTATTACCATCATTTCTTATTCTTTTCCATTGTCACCTGTGTGGT
CCTTTACCTACCAACGACAAACCATTTCTAAAAGCAAGGTTGCGCAGAAGCTTTGCATTT
TGATTCTTAGAAATGAGACCCATCTGCTTTCAAGTGAAGGACTAAAGAGGAATTTAATTC
GCGGAATAGAAACAGTCTCTTCTGTTTTGCGTTCGCCGAGATGTCAATGTTGTTTCTTTG
GAGGGTGGGAGGTGGGGATGGGGAACGTTTGCAGAAAAAGGTCAAGAACAGGGGCCCTCC
CTTCCCCTGGCCCCAGGCCGCACTGGGTGGAGCCACGTCCCTGAGTGGCAGGAGGCTGAA
GGTAGTATCTAATTGTCATTGCCAGGAAGGATCTGGAGCCCAGGCTGATCCACCCCCTTC
GAGTGGATTGATGAGCATCTCAGCCGTGCTCACAGCAGGTTCAATGCCTGAGCGCCCTTC
CCCCCTTTCCTGGTCTTGGTCCAAACTCTAGCGAGCCCTGGAAAGTTGGACAGGTAACTG
GACTTGATTTCATTGACGTAGCAAAAAAAAATGATTCGCTACCACAACTATTCTCGCTGT
TCTGATTTTGTAATAATCAGGGCAGGCTAAACATTCTCTATGTAAGACCGTGCATGTGTC
CTCAGACCTAGTTCTTTCTCTAGCTCTGGTGTTGTCAATGCTGGTGATAAACCAAGTCTG
ATTTATACAAAGCATCTCATGTAGGAAATGTCTATGACTCTCAGGTCTCTGATTCTCCTT
GAGAAATGACAGCAAAGCTAGTGTGATAACTTTTGAAGATTAGATTCATTGCCAATTCAA
TGAATGGTGAAACTAAAGAAAAACAAAAACAAAAACCAAAAAAACTGATTCCATAGTTCT
TGTTTCTGAGTGTTGTGAAGTCAAAGCACAGGGGTGCCCACCTTTTTAAAAGATACACTT
TCGGGGCGCCTGGGTGGCTCGGTCGGTTAAGCGTCCGACTTCGGCTCAGGTCATGATCTC
TCTGTCCGTGAGTTCGAGCCCCGTGTCGGGCTCTGTGCTGACAGCTCAGAGCCTGGAGCC
TGTTTCAGATTCTGTGTCTCCCTCTCTCTCTGCCCCTCCCCTGTTCATGCTCTGTCTCAA
AAATAAATAAACGTTAAAAAAAATTTTTTTAAAGATACACTTTCTTGGGGTGCCTGAATG
TCCCAGTCGGTTAAGCGTCCAACTTCCGCTCAGGTCATGATCTCACATTTCAGTGTGCGG
GGGCGAGCCCTGCATCGGGCTCCCCCCTGACAGTGTGGAAGGAAGCCTGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved