Felis_catus Locus Poly:21:SNORD48
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:21:SNORD48
Felis_catus
Poly:21:SNORD48
GeneScaffold_4236
SNORD48, SNORD52
1001..1063, 2816..2884
3884
ACTTAAAAGGTTAGATTTTTTTTTTAAGTTATCAAATGGTCTATGTTAAAAAACTTTAT
TGTATGTTATTTATATCTTAATAAAGCTGTTAAAAAAAAAAAAGACACTAAGGTTAATGT
GACTGATAAGTCTGCGGGCTGGAGTGGGCGGTGAATTCAGATTTCTCTGGCTAGACAGAA
CAGGTGACAGTCTCTGAGCGTGACCAGGACCCCGAACTGGTGAGGACGAGGGAGGAGTTA
CTCCAGCGGGGACTTGTCAGCCCAGGAGGCCAATAAGGAAAAGCACTCAGCTGCGCAGGC
TTTCAGCTGCGCAGGCTTCCTGCCGCGCCAGGGACTGTCTCCGGCCCAGCCGATGGAGAG
ACGGTCATCTATCTTTTGTTTTTCAAAATTAACAAAATAGGTCTGAATTATTTGCCCGGA
AGAGTGTGAAACATTCACTCCTGGCCTCTCTTTCACTTGCTTTATTCTTGTTTGAACGAA
GGGGAAAATGCCGTGGGTCGAACAGGCATCGACGAAGACAGCCATGCCCGTCAGGCCCCC
GACCCCACGTCGCCATAAATAGCCGGGACTCCGCCATTATAGTTCTCTTTGTGCATGCAC
CTGCCTCTGGAGAATGTCCGCGTGCTGTGTTGCGCCGGGGGGCTGCTGTGGCGCCATCCC
CTACGCCAGGGGGAGGCGGCGGCCCCGGCGACCTGCGCTGTCTCTGCCAAGCTTCCTTCG
TGTAGGTATCTCGGGTTCCTGTTGGGTGAGGGGACCGCAGTCTCGGGCTGAGCAGGATGA
ACTGCCATTACAGACTAGAGTTTCTGATGTGTACGTGACGCCATCGTTTGGAACTGACCC
AGCCCAGGGCAGGGGGGTACTCGGCGGGGGTCGCCCCTGGCCCCTGCTGACTCATGGGTT
TCTTCCCAGGGCCCTGGTCTTCGTAGGCTGGTTCGCAGCGCCACGAGGGTGAGTGGATTG
TGCGAGATGGAATGGCTGGCGGTGGCCTTGGGGAAGACGGGGGTAATGATGAACCCAGGT
GATTCTGAGTGTCTCGCTGACGCCGTCACCGCAGCGCGCTGACCATCTCCCTCCCCCGGG
CTGGGTCTTCCTGGTACCTGTGCTGGGGAGAAGCTCGTGGCCAGAAAACACAAGTGGCCT
ATCCCTGTGTTTCATTTTTCCACTAGGTGTTTTAAGGTGCTCGTCGTGTGTTACCCTTGA
ATAAAGGTGAGTATTAGGTGTGAGATTCTTCTCCGTGCTTCTCAGACTGTTTTGATCCCA
GAACACTCTTTTCATGGGGTCACTGTGAAGTCTTTTTTTTTTTTTTTTTAACGTTTATTT
CTGAGAGAGGGAGACAGTATGAAGGGGTGCAGAACCTGATTGATGGCCAGCTCGAACCCA
TGAGCTGTGAGATCACGACCAGAGCCGAAGTCCCGCGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAAGAAGGACATCAGCCAGAACAAGCGAGCCGTGAGGCGGCTG
CGCACCGCCTGCGAGCGGGCCAAGAGGACCCTGTCGTCCAGCACCCAGGCCAGCCTGGAG
ATCGACTCCCTGTTCGAGGGCATCGACTTCTACACGTCCATCACGAGGGCGCGGTTCGAG
GAGCTGTGCTCGGACCTGTTCCGGAGCACCCTGGAGCCGGTGGAGAAGGCTCTGCGCGAC
GCCAAGCTGGACAAAGCCCAGATCCACGACCTGGTCCTGGTGGGGGGCTCCACCCGCATC
CCCAAGGTGCAGAAACTGCTGCAAGACTTCTTCAACGGGCGCGATCTCAACAAGAGCATC
AACCCCGACGAGGCAGTGGCCTACGGGGCGGCGGTGCAGGCGGCCATCCTGATGGGGGAC
AAGTCTGAGAACGTGCAGGACCTGTTGCTGCTGGACGTGGCGCCCCTGTCGCTGGGGCTG
GAGACGGCCGGCGGCGTGATGACTGCCCTGATCAAGCGCAACTCCACCATCCCCACCAAG
CAGACGCAGATCTTCACCACCTACTCGGACAACCAGCCTGGAGTGCTGATCCAGGTGTAC
GAGGGCGAGAGGGCCATGACGCGGGACAATAACCTGCTGGGGCGCTTCGAGCTGAGCGGC
ATCCCCCCGGCCCCACGGGGAGTGCCCCAGATCGAGGTGACCTTCGACATCGATGCCAAT
GGCATCCTGAACGTCACGGCCACGGACAAGAGCACGGGCAAAGCCAACAAGATCACCATC
ACCAACGACAAGGGCCGGCTGAGCAAGGAGGAGATCGAGCGCATGGTGCAGGAGGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGCTGCTAGCACAGAATCTTGA
TGTGAGCCCACGAACCCTGAGATCGTGACTGAGCCAAAAGTCTGATTTGCCACCCAGATG
CCCCTCTTGAACTTTTTAAAAAAAATTTTTGGTAACTTTTTATACATTTGCCTAATTGTG
GTTAAACCTGCCTCCTTACTGTACATTCTGTATTCCCCAGTGGAGGTTTTTTGGTTCTGT
GTGTGCACACACGCACAATTTTGGATTTTTTTTCACTGTAATTTAACTCTTGCGCTTGCC
ATCTCTGCACTCTTCTTTTGCTGCATCCTTATTTATATTGGATGAAAGACCATTGTCTTT
CAGTGTATTACATCGCTTTTCAGAATCACCTGCCTTCATCCAGGTCTCCCTAAATTGGGA
ATGATGATTGTCTCAGACTAGAGTCTCTGATGCTGGACTTGATGTCAAAAATTAAGTTCT
GACTCATTTGGAGAACTGGAGGCTTGGGTCTGAGAAGGGGCCAACAGGAGGGCCTTTAAA
TTTATTTGCTTGGGCTTCTCGATGGTTGTCTTTTTACTTTTCTAGCCTGATTATTCTAGA
AGCCTACTTGGGGCAGTGCCCTTTTACAGATCAGTGTCTAATCTGGTGACTGAATGGCTG
AAGTTGGGAACTTAGCCTCTTGGAGAAGTGCTGTTGAGACTTCTGGGTCGCCTAGATAGT
GGCTCCTGCCACTTGAATCTTTGGGCTGCAGTGAGGAGTGAAGAGCCATGTCCTTTCTCC
CTGGCTCCTATGGTGAGTACCAGTTTCTCTTCAGCCCCAGAATGGTAATGGTAACTTTCT
TGGACCATTAACATTTCTCTGAGGATATTTGAAACCACGAATCACTCCTGCTTTCTCTAC
CCACCCAAGTTCATGTTTTAATTCCAGTTGTGTGCGTGTTTCTAATAGATGTTCTTTTAT
GAATTTCAGGATTTTGCTAACGAGAGGATGTGTCTTATTTGGTGTTGAGCAAATCCTAGG
AACTTCATCTAGCTGTCCTGCATTAACCTGTGAGCAGCTTTGAACTTGAGAAAAAAAACT
GCATAGAAATTTTGAGATATTTAAATATCATTCAGACCACTTTGCTTCGTTGTAATCAAA
TACTTGGTCTTGTCAAAATATTCTAATAAAATGCTTTAGAGCAAAGTAAAAGTTTGGTTT
TTGTATAAGCGAAGTCGTACAAAAAGATTTAGGGAAGTGAAAGGTAACTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved