Felis_catus Locus Mono:25:SNORD59
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:25:SNORD59
Felis_catus
Mono:25:SNORD59
scaffold_214055
SNORD59
1001..1072
2072
CACAGACAGCCCATTTACAGGAAGAATCGACTCTAGGGTACTCTGGCAGTCCCATGCCT
GTGATGTAGTCATCAAAATTGCAAAAATAAGGAAGATATGGGAACTCTTACATACCACTG
AGTGGAAAATAAATTGGTACAATTACATTAGAAGGCAATCTAGCAACATCTATTAAAACG
AAAGATGCCCTTATCTTACAATCCAGCAATTCCATTTCTCTCTCTATATTTGCAAGAAAC
TCTCCCATCAACGCATAAGGAGTCATGTAAATGAATATTCATTGAAGCATCATGTATAAC
AGGAAAATAATTGGAGACAATCTAAATGTTCATCATCCTGAGAATGGTTAAGTAAATTGT
TGTATGACCACACAGTGAAATACCATATCATAGTTAAAATAAATGAACTAGAACTGGAGC
TATAATATGCATCAATCTCAAAAAATAGAATATCTAGTGAAAACAAAAAAGTGGCAGGAG
ACCCATAAGGCTTGCTACCATTTACATTAACTTCAGACCCATGGAACAATAGTACATATT
TCCATGTGTGATAAAACATTTTAAAATACTCTTAGTGATAGTAACTCCAAATTTAGGATA
GTTGTTACCTCTGCTGAAAGAGAAGGATAATGACAGAGTACGTAGAAGCCTTTAGCCAAA
TCTGTATTTCCCCCAAAGTGGATTGGAAAAAATATATGGCAAAAAGTAAATGTTTGACAA
AAACTGGTGGGAAAGATGAGTTTGTAATATTATTTTCTATATCATATATACTTGAAATAT
TTCACTTAAAAATATAAATGTTCTTTTAATGGTGGAATTACAGGATTTTTCTCTTTGTGC
AGAAATTTCTTTTTTTTCCTTTTTCCATGTTAAAATTCCATCCATACTTTGATATTTAAT
TCAAGTCTCACTACCTTATTGAGAATTTCTATGACAATCTTGTCAGTCCATACTATGCTC
TCCCTTTTCTAAACCACAATAGGTCTATAAAGTTCTCTTGTATTCTATGATGATTTTATC
AAAATGACTTTTGTTCTCAGTATGTTGAAGCCACATTTTAGGTACTGAGAAGGAGTAGGA
AAAAAAAAATAAAGTTCTCTCGTATACAATGTTTGTATGACCAGAATTCTTTCATGTTGT
TTAAATATATATTGCATTGCAGTAATATTCGGCTTTATTGTACACAAACCTTGTTTCTCC
AATTATATTGTAAGAACCTTAAGAGCAGAGATAATGTCTTGAACTTTGAAAATCCTTCCC
CAGTGCCCAGCAGAGTCTAACCAGACATTTATTAAAAGAAAAGTGGCGTATAAACCAATA
ATTATTACTCTTGCTACAAAGCCTTTATCTAGAAAGTTGAAAATACTAGTTGGAGCTACA
TTTGCTTTTATTTTCCCAGAGAGAGAATAGTAATGAGCTGTGAAATGACCAAAACTCAGG
CAGCAGAAGGGAAAAAAAGAAATAGCGGGTTTGTATATTACACATTCTGGATAATCAGTT
CTTGAATGATTAAGTGTGGAAAATCTCTTATGAGTAAAAGCAGATTTTAAAATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved