Felis_catus Locus Mono:98:SNORA13
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:98:SNORA13
Felis_catus
Mono:98:SNORA13
GeneScaffold_2564
SNORA13
1001..1135
2135
ATGGAAAGAGCGAGGTGACTCATGATTTGGAATGATTGTTTTGATCTCTCCCTGTAGTT
GCTGTAGAACATTGGCAGGGCGGCCAGCATAATTAACACTGCACAGTCTAATTATAAACA
CAACTCTGTGGACAGTGGCTACGAAAGAAGAAAGCATGTCCTGGATAAACAATCAAGTTG
GCAGGATTCCTTTAGAATGATGACTAGATAATGTCAAGTTTACTATAAATCAACTTGCTT
TTCCTAGATTGTCTCAGGAGTTACCATAGGGGGAAAAAAGTATTATCTGTGAAAGTCTCG
CTGGGTTATTTTTTTAAGAGCTCATTTGAAGCATTTCTTTATTGCAGTCTTTCTAACCTT
TTCATCCTAAGAGAACAGCTAGGCATTTTAATTTTTATGGTGTACTATTTTAGGGAGAGT
AGGGGAATGGGTCACAGGAGGACATTTGTTCTAGTAATAGTTGAATTGATTTTTAAAAGG
TGAAAGAAACTAGGGATTTGGAAAGATTACATTGGAGTAGTGTAATAAAGAGCAGGAAAA
GAGAGACCCATGAGCTGAAGAGGGTGCGCTAAGAATACAAAAGGGAAGTGGCCACAACAG
CCATGCATGTTTGAGAGAAACTGAGACTCATGTTACACGTGTGTGGTCTCACATACTCGT
CTGAGACAGAGCAGGCACTGTGCATGTTTGTATGTGCTTAGGGATTTGTTGAAGCATGGC
TGAGAGCTGAGGAATGATTTAGTTGGTTTAAATATAGGTTTGGCCCTTGGGTTCCTGAGT
TTCAGAACAAAGGCTATGGAGATTGGTTTCAGGACCCTGTAGGGATGGTTGTATTTCTGC
AGAATGAACCTGAGTTGTGATTTACCCTAAATAAAGTAAGCACTTGAAAGCAAATGCTTA
AAAATGAGACCCTCCCCCCCCCCTTTTTTTTGCTTTTTCTTTTTTTTATTGAGTTAATTT
CAGTTAAATTTCAAATGGACACTTAAAAAGATTTTTCTGGTAGCCTTTGTGTTGCCAATT
CACTTTTGGAAACTAGTGAATGTGGTGTCAAAAACGGTGGAAGCTTTGCAGCCTTTTCCT
GCCCTTGAATTTTAATTTGAATATTGTTGGTGTAGGAGCTGGATAAAGTAAGAGTTTATC
CTTTTATATTAATGTGTTTACACATGTGATCTTAACTCTGCTTTTAAATGTATAGTTTCT
CTTAAAGGGTTTAGAACAGGACTGATTTTTCTTTTTAAGAAAAAATATACAAAAATCTAA
ATACAGAAATAGATGAGTTAAGCACAGTTTTTCTTGTTTGTTTTTGATTTTTTTTTTTTT
TTTTTTGTAAAAGAATACTTTCTACTTTGAAGAGATTCTAAGAAGTGTCCTTTAAATAAT
AGCTCCTGGGGCTCCTGGGTGGCTCAGTTGGTTAAGTGTCTGACTTTGAGCCCGTGTCCT
CTGTGCAGACAGTTCAGAGCCTGGAACCTGCTTGGGATTCTGTGTCTCCCTCTCTCTCTG
CCACTCTCCCATTTGCGCTCTCTTTCTCTATCAAAATAAATAAACATTAAAAAAAAAATT
AAAATATAATAGCTCTCCAATTCCTTTTAAATACTTGGATTTACAAAAAAAATCTAGCTT
TTTATTTTAAAGAAGAGGGGGAGAACATGGATTTTTCTAAATTTGGGTAGAGCTAGCATT
AACACTGGCTAAATGATTTTTTTTTTTTTTTTACCAGATACTCTTGGAGGAGGGACAGAT
ATAAGGTGGTGGGGCTTGTGAAAGAGGATCTCTGTCTGTAGTCCAGGACCCAATTCTGAT
TCCTCTGTTACATTAACCTAACCAGACTTTTGAGAAGTGAAAAATGGGTCTTGGAGATCT
ACGAGGACCTGATATAATGTTGATTTTAAGGCCAATTTCTAGGAAAATATGATTAATAGC
CAGTAATACTATTTTTCTGCCCTCCAGCATTTTTTGCTTTATTAACTTTCTTTTCTGTTT
TCTACTTTATTGGTTTCTGCTCTTTATTATTTTTTCTGCTTAGGTTTACTATACTATTCT
TTTTAGTTTCTTAGGGTGAAAACTTATATCATTGATTTTAAACGTCTTTCTAATATAGGC
ATTTAAAGCAGTAAATTTCTCTCATTAAAAAAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved