Felis_catus Locus Mono:50:SNORA7
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:50:SNORA7
Felis_catus
Mono:50:SNORA7
scaffold_194426
SNORA7
1001..1140
2140
AAGCTTCTATTCACAACTGTTATGTGCCAAAAACTGCATTAGACACTGATGAAAAATGT
CAGTCACATACAACCTCTAGCCTCAAAGAGCTCAAAATCTAGTAGAGGAGACAAGGAAGT
AGAAAATGATAATTCAGCATGGAAAGGAATAAATAAAGGTATGAGCAAAATCTCATTTAA
GGGAGCAGAGTATGCATTGTAGTGTGTTCTGGGAGGCCAAGTAGGAATGACATCCAAACT
GTTCTTGAGAAAGGATTAGGTGTTTGAGTGACAGAGAGAAAAAGGAAGTGCATTCAAGAC
AGGTATACGCCAGGCTTGAAGACTTGAGAGGAAACCGCATCCTTCTCACTTAAAATTCTA
AATCAGAGTTCTACTTACGGTTCTCTCAGATTGCACTGCAACTGTCTCAGCAAGCTAAGG
AGCCAAGGTATCCGTGGGGACTGGCCATCCTCCCCTGCTTGTGTCCCCTGTGTCGTCCTT
CTGTTTCTCCAGCTGCTCTTTCATTCTCTTCCCTCTCCTGACCAACCTCCTCCAAGTCTG
CCCTACCTGACAAATCTGTGACCATAATGATCCCACGCCCCAACGTACCCTGAACTTTCA
GGTCAGGCATCCGCCACAGCTTTTGTGTCCCCCTTCAAGTCCCTGAGAGAGAATATCTAA
TCAGCCTAGCTGATTAGTTTTTAGACATGTCTACTGAACATTGTAAAAGTGTCACATGGT
GTGCAGTTAACCCTGCATCTCACATGGCCAAAGGAAACAGTCTCCCTTGTGATTCCTCTT
TCAATGTCAGGTGCCTGGTTGAATATTCTGGTTTCATGTTTCTGAACTGAGGGGTTCCAG
AATTTAGGTATTCTGCAACCTTGGCTGCATATTACAACCACTTCTAAGACATATTTTAAA
ATTCTGATGCCAAGAACCCATCCCCAGAAATTCCAATATACTTGATTGGGTGAGGCTTCC
CAGGTGATTTTATTGTGCACACACATCAAAAACCATGAAGACTTCTCCCAGGATCGTGTC
TGGGGAGTGGTTAATATTCTGCCATCTTCGGAAATGGGAGAGAAAGCGAGCCTTGCAGAG
GTACCCATTCTACTCCCAGTTTGCTCAGCAGCTGGAGATTGGAAGACAGTCTGCAACAAT
GTTCAAGGCCTGAGCAGGAAAGCTTCCTTCTAGGACTCAATGATACCATCTCTGCTTCTT
TCTTGAAGGCATAACAGCTGCCCTCAGACCTCTGGTGAAGCCCAAGATCATTAAAAAGAG
GACAAAGAAGTTCATCTGGCACCAGTCAGACCAGTATGTCAAAATTAAGTGCAACTGGCA
GAAACACAGAGGCATTGATGATAGGATTCGCAGAAGATTCAAGGGCCAGATCCTGATGCC
CAACATGGGTTATGGGAGCAACAAGAAAACAAAACACATGCTGCCCAGTGGCTCTCAGAA
GTTTCTAGTCCACAAGTCAAAGAGCTTGAGGTGCTGCTGATGTGCAATGAATCTTACTGT
GAAGAGATTGCTTACAATGTCTCCTCCAAGAACCGTAAAGCCATAGTGGAACGAGAAGCT
CAGCTGGCTATCAGAGTCACGAATCCCAATGCCAGGCTGCACAGCAAAGAAAATGAATAG
ACAGACAGCTTATGTGCACATCACATTTGTGTTAATAAAACCATAAAACTACAAAAAAAC
AAACAAACAAAAAACCATGAAGACTTGCTCTTAGTGCACTGTTGGGAGAATTGATGAGTG
GCTTCCTGAGCCTATGACTAATGGCATCCTTCCAGCTTTTGTCATCAGCATCAGCTACTT
GCACAGATGCTCTCTGACAACACTCAGCTAATCCTCCATATTTTAGGCCTATATTGCCAA
AAACAGACGGTATTGGCTCAAAGGAAGGAAGTAGCTTATTCCCACATACCTATATCTCTC
CCTTCAGAATTGCAGAATTCCAGAATGAGAATATACATAATAGGGAATAAGCTCATGGAG
AAAGTAAGACGGTGTATAATAAGCTACATTCTCACTGGAATCCCTGGATTCTATGAACGG
GTGGTGACACTGGTATATTGTGTATGCAGTGATCCTGATGCAGCTGACTTTAACAAATAG
TACCCTTCTTCTACAACACCGCACCTCCAAGTGTATTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved