Felis_catus Locus Mono:58:SNORD24
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:58:SNORD24
Felis_catus
Mono:58:SNORD24
scaffold_201764
SNORD24
1001..1074
2074
GGATCTCGGGAGAGGCCCTCTCCGTTAAGCACACCTGTCCCACCATCCGCACACGGGCA
CACTGCGGGGACTCGTGTCCCGACCGCTCAGGGGCGAGGCCCGAGCCTTCCCCGGCCCCT
CCGCCGGAGCGTCCCTCCGACTCTACCGCCACCGCCGCGCCCAAGGCTCCCTCGCTCGGG
GTGGGGGTCTGGGGGTAGTCCCGGACCACCTCCGTCTCCGCGCCAGGAGCCTTGCGCCTG
CGCGCCGCCGACCGACGGAACTCGCGGCCTCGGAGTCGCTTAGTGGGGAGGGTCACCCCC
GAGTAAAGACGGCGACCCCGCTCCGCCGCCCCCACCTGGTCCGCAGAGCCCGGCGCGACG
GGCACTCGGTCGGGGTGGAGACGAGCGTGCGTCCCTCCCAGTAAGACCCGGCTCCCTGCC
GCCGTCGCCGCTTCGCTCCCGTACAGCTGCGACTCGCCGCGGTAGGCGCGGTAGGCACCG
CCCCTGGGCGGAAGCGGGCGAGATAGGTCCTGTGGCTTTAAGTCCGAAATCCCGCTCAGG
CGTCAATTCTCGCGATCTCCGAGGTCGCCTACATATTACCCACAATTCTCTTTTTCTTTC
TCTCTCCTCCAGCCTTCCAAGATGGTGAGTGATCCGGTGGTTCTCGGTGTCGAGCTGGGT
CCGGCTTCTATCCACTGCCATCCTCTTCGGGGCGTGGCCGTGCGGGGGTCCCTCCACCGC
GTAGCGCTAGGGGAGCCCCGCGGGGCCTGGCGGGGTGGCACTGGGCCGGGTAGAATCCCG
GCGGCTGGGTCGGGGAGTGGAGAGAGGAGGGCCCCGGCGCGGAGCGCGGCGCCGCAATGC
GGGGCTCGGAGCGACGGGGCCGAGCTCCTGGGGGCTCCCCCGGCGGCCTTGGGCGAGAGG
TTCCGAGTCCACCGCTGCTGTTTGCGGAGGCTGCCGTGTGCCGGGCGCCTAGAGACGGGG
CGCGTAGTTCTGGGACGCGGCGGGCGCGGCAGCCCGGGTGGTGCAAGTGATGTGAAGAGT
GTTTGCCGTCTGAGTGATGGTGGGGACGCTCCTAACCACCAAGATCGCTGATGCATACGG
GCCCTCGCCGCGCTCGCCTCTGGGCTGCCTTGGCCGGGGCCTGGGGGGGTCAGGCTCTGC
TCGTAGGCGGGGATCGGGGCGCCTTCAGAGCAGCGCGTGCGGGAGCGCGGGGTTGATCTG
GGTGTCGCTTCTCGCCTAGCCGAAAGGGAAGAAGGCCAAGGGGAAGAAGGTGGCCCCGGC
CCCTGCTGTTGTGAAGAAGCAGGAGGCCAAGAAGGTGGTCAACCCCCTGTTTGAGAAAAG
GCCCAAGAACTTTGGCATCGGTGAGTAAGGAGAGGGGAGCGCGGAAGTGTGCTGAGCGGA
GCGAGGGTCGTGTTCCTGCCCCGTTGATGGGTTTCAGCGGGTGTGGGGTCCCCCCCCTGG
CTGGGATGTGGGCACCGGGTGCGTGGCCTCGTTGTCCCTCCCCCCGAGTGTGTGTCAGCT
CCGCTAGGATTCGGCTGGGCTGCTTGTTGGATGGGGGAGCGTCGCCAGTCCCCCTGTGAT
CATAGGTGTTTGTGTGCAGATGATGTAAGAGAATATTTGCTATCCGAGAATTGGTGATGA
CGCTTTAAACCACCAAGATCGCTGATGCACCTACACCCTCCCAAGTGGCGCTAAGCACGA
ACTTGACCGGGAGTTTGAGCCTCACTTACATCGTTGCCCTTAACTTCTCAGGACAGGACA
TCCAGCCCAAAAGGGACCTCACGCGCTTTGTCAAGTGGCCCCGCTACATCCGACTGCAGC
GGCAAAGGGCTATTCTCTATAAACGTCTCAAAGTGCCTCCTGCAATTAACCAGTTCACCC
AGGCCTTGGACCGCCAGACAGGTGAGTTTGTGTAAACCAGCACGGAGACGTTTCCTGGGC
AGTTAGGACTGGAACTGAGGTCTTTAAGGAGTTCTGGTACTTGCAGGAAACCGGCTTACT
AAAATCTAGGTTATCTTGTCTGGTTTCTAGATCGCGAGGGTGGCATAGCTGAAGTGATCG
TGCATAGTCTGAGTTTTTTTTTTTTTTTTTAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved