Felis_catus Locus Mono:96:SNORA62
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:96:SNORA62
Felis_catus
Mono:96:SNORA62
GeneScaffold_3342
SNORA62
1001..1137
2137
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
GGGCCTCGCAGGAAACCAGACACTCCCAGGGAGGCCACACCCTCACCGGGGCCAGGTGGG
ACCCCAGGGCTGCCTGGGAGCCTGAGGTTAACAGTCAAACGTCGGTGACAAACAAATCCG
GGTTAAAGTCTCAACCCACGTCTAATATGCTAGGTAACCTTGAGGAAATTACTTGACTTG
TGACTCAAAGGGCCGTATCAAGACACACATAAAGCAGTCAGCACAACATTTGGCATACGG
TACGTGCTTGATAAACATTAGCTATTATGTTCAGTGTAGTCTCCTAGTCAGACTGCATGG
GCCACAGCAAGGTCCCCAGGCCCTGTGGCATTTGCTTCTGGCCACTGGAACCATCTGTAC
GGGAACCCATTAGTTGGGGGAGGAGAGTGAATCTTTACCCTCCTCTGAGGTGACATTACC
AAAGGAGGAGTTGAAGTAGAAACAGATACAAGAAAGGTCATGGCGGGGGAGCACCTAGGG
ATAACAGAGGAGGGAGGCAAGCAGACAGAAGATGGGCAAGGAAAGAGAGTGGGTGGGGGC
TGGCCAGGAGTCCGAGTGAGAAGCAGGATCAAAAGAGAAGACACAAGAGCCATATGGGGC
ATACCCTAGGCCTCTCCCAGTCCAGCACCTGTCCACTTCTCAATGGATATACATAAGGGT
GCTGGAGATCATCCAGTCCAAACTGGGTTGGGATATGGTTCACCAAAGTATTTATCTCAA
AAATGCACTCATGTTATTCACCACTTGTTGTTGGAGGTTGAACTCTGTCCCCCTCCCCAC
CCCACCAAAAAAAAAAAAAAAGATATGTTTAATATCCTATCCCCTGGTGCCCATGAAAGT
GATCTTATTTAAAAATAAGGTCTTTCCACAGAAGTGTATGCGGTGTGCAAGTCTTTTGTA
ATACCACAAGGGTCTCTGGCCCAATGAGTGGAGTGTGTTAGTAATTCTTGCTATAATTTA
AACAAACAAACAAAAAAATAGGGTCTTTGCAGATATAGGTTAAGATAAAGTCAGCCAGGA
GTAGAGACATGAGCAGAATCTTTCTCTGAGTCCCCAAGAAGGAACCAATCCTACTGATGA
CTTGACTTTGGACTTCTAGCCTCCCGAATTGTGAAAGAATGCATTTCCATTGTTGTGAAC
CACCCAGTTTGTGGTATTTTGTTACAGCAGCCCTAAAAATCTGATACAACAGTCACACAT
TTAACAACTACTGTTAAGAATCTATTATCCTTTCGGGGGCACTTGGGTGGCTCAGTCGGT
TGGGTGCCGACTTCAGCTCAGGTCATGATCTCAGAGTTGGTGGGTTTGAGCCCTGCATCG
GGCTCTGTGCTGACAGCTTGGAGCCTGGAGCCTGTCTCAAAAATAAACATTCAAAAAATA
AAAAATAAAAAAAGAATCTATTATCCTTCGGGTATTAGGAAATTAACAGATGTGAGTTCT
TGCCCTCATAAAGTTTACAATCTGGTAGGGAAAGTGGACATTAACCAAATAGTTCATTAT
GAAAGTCCAAGGTGCCTCCTCTCCCTTTGCCTCCATCGTGAGGGCAGAAATGCGGTCTTA
GTCACCTTTTAGCCTTAGACCCTAGCATAGTGCTTGAAATATTAAAACTTAATTAAAGGT
AGACCATATGAAGCTCAGTCTCTCTGCAGTGTCGTATTCAAAGCCACACTGCCTCCAAAA
GTCTTAAACAAAATGATGGAAGCTTTAGGCAAGAACCCTGAAGTGGGAGGAGTGGGGGGG
GGGCGCTTGTACCATAAAGCACACAGCAAGATTTCCAAAGTCCTCCTTAGGATTTCTTTC
TTCAGAGTAGCAACTCCAAATTCCTTCCGCTCTCCCCACCTCCTGGTCTTTGGTCACGCG
AAGAAATTTGACTTCTCTTGGCTTCTCAAAAAGGGTTCTGCTTAGACACTGGGAGAAGAG
AGAAGCTATTTGATATTTCGACTTCATTTCTTCTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved