Felis_catus Locus Mono:99:SNORD60
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:99:SNORD60
Felis_catus
Mono:99:SNORD60
GeneScaffold_3185
SNORD60
1001..1083
2083
TACAAAGCACAGCAGAGAAGGATCGGCGAGAAGTGTCAACAGCGGCCGGGCTGAGAAAA
GCTGCAGAAGAGCCTACGAGCACTGGGACCCCGGCGGCGCTCAACGAACGCAAGAAGAAG
GAATGAATAAAGAAGGGGAGAATGGGGCAATGGGGCAAGCGACGGACAGACGCCGAGACC
CCGGCCCGTGTCGGCCCCGCCCCCCCAGGCCCGACGCCTCCGCGGACCCCGAAGCGCCTA
CCGCGCGGCCCCGAGGCGCGAGCCCCGGGCCGGGCGCGCCGCGCGGACACTCACCCGCCC
GCGGCCGCCCGGGAGCGGCAGCGATACCCTCCCGCTTCATCGTGCCCCCGCGGCCGCTGG
CCGGGAGACAGACCGGACGCGCGAGCCGGAAGCGCTGAGGCGCTACGCCCGCCGGGACTT
GTAGTTCCCCGTCTCTCAATGCCTGGGTCCCCGCCTCACGCGCGGCTCTCCAGAAACTAC
GAATTCCGGCGGCTCCGACGTCGCGGGGCGGGATTGGCAGCTTCAGAATCACTCTATGTT
GCAGATCGGAGTCTGATTGGTTCTGTGCATCTGTCGCTCACAGTTAAGGTCCAAGGCCTC
TGCTAAAGGGAGAAGCTTCGCGAGTCTGGTTCAGGAGACCGGGGGCGGGTACTTCCGGCA
TGATTGCCCAATCGCAGAGGTGGGGCACTTTCTATAAAAGCTTCAGCCTCGGGCGCGTGC
TTTCTTTTGGGAAGCCAGTGGCGGCCGTGGGCGTTTGTCTGTGCGGTCGCTACGAGTCCA
CGTTAGGGGAGGATCTGGGCCCCGAATGGGGCTGAGGGGTCCTCCAGGGCCATCATCCGC
CGGGGCTCCGCCTCTGTCTTCAGCGTTGTACGCGTTCCTTGCTCCGCCCGCCTCCACCCC
CCCCCCCCATCGGTCCCGTTCTGTTGGGAAGGTGCGACTTCAGACCGACTTCTCTCCGCA
GGTAAGCCTGGGCCGGGCTTGGTTTCCCCTATGCAGTTTGGAGCCTGTGATGAATTGCTT
TCGTTTCTGACACCTCGTATGAAAACTGCATGTGCAGTCTGATTATTTTGCAAGTCTGAG
GCTTCAGGGTGCGCCCCCTTGACAGGAGGGGCTGGTGTGAAAACATCTCCAAAAAATCGG
AGTAGCGGGCTTCTGTCTACATTTCGGCTCTGTGTGTCTGACTTTTAGGGCGGTCGGTGA
CGTGGTTGGAGACCGTGGACGTAAATGAACGTCAGCCCGGGGCCTGGTGGTAAGGCGGGA
GTCCACGTCCGTATCTGCGGCGCTTAACAATAAAGCAGAGGTGGTGAGTTGATGGGAGCG
CAAGTGTCTTTATTTTCACACGCGTTTGCTCCCCAGAGGACTCCGCGGGAGGACTGGCTC
GTTCCGTGGCAGTCTCGGGAAAGGGTAGAGAAAGATGGATGTTCACACGGTGACCTTTCA
ACTATTGGGATGCCTTCTCGGTTTTTTTGCCTGTAAGAGCAGAAATCCCGGGGCGGAGCC
GGGGTCTTTGTCTTAAGCAGGTGAGGAACTCTTCCTCCTCACCGGCCACAGAGCACTGTT
TTCTGTTTCGTTGGGTCTTGCAGAGGGAAGTGGACATCAACCACCCAACCACCTAGGTTC
CCCGTGCTCCCTAGACAGCAGCCCTAGTTGAGGGTACTACGCTCTTAGCGTTGTCCTCAA
CCCCTACTTTGCCGAGGGCGCAAAGAAGGGGATTTCTTGTAACAGAAGAGACCGGCAGTC
CAGAAAACACAACTTTATTCACCAGGACTGAAAACAAAGACTCTTAACCTAGAGACCTAT
GAGCTGGAGCACACTGCCAGCCTCCTGGCTTGACCTCACTCTGCACAGGCCTCAGCTGGG
CTGGCAGTTCTAGTTTCCCTGACGGTTTCTGATTTCCCACATGCCGTTCGTGTATTAGAA
AGCCGCAAACTTGTCCTCCAGGCAACACGAGAGGAAGACCCTGCTGATGTTTGAACCAGA
GTCTCTGAGTGTGTGGGCTGGCAGCTTTGGTCCTTGGGGCACAGATGCATGATTGGATGT
GCAGCGAAGCCCTCTGCCCCAGGCACGGACAGGAGTCCGGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved