Felis_catus Locus Mono:130:SNORA1
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:130:SNORA1
Felis_catus
Mono:130:SNORA1
GeneScaffold_50
SNORA1
1001..1135
2135
CCCCCCCACCTGGAACTTGAGAAGTTGAACCTAAAACTTCTTGTGAAAGTTCTTTGTTA
TAGAAGAATTCCAGGTCATAATATAGGAGAAATTACAGAATTTTAAATTTGCCATTTTGG
GGTATCTGGCTGGCTCAGTTGTAGAGCATGCTACTCTTGATCTCAGAGTTGTGAGTTCAA
GCCCTACATTGGGTGTATAGATTACTTAAACATAAAATCTTAAAATAAATACATAAAAAT
TGCCATTTTGCAACTGCTATGAAATGGATGCCAGCATCATTGGATGCTAAAACCATCAGG
TGAAAGGTTGACAGGGAATTAAAATACAGACATCGAGGGGCGCCTGGGTGGCTCAGTCGG
TTGAGCGTCTGACTTCGGTTCAGGTCATGATCTTGCAGTTCATGAGTTCAAACCCTGCGT
CAGGCTCTGTGCTGATAGCTCAGAGTCTGGAGCCTGCTTCAGATTCTGTGTCTCCCTCTC
TCTCTACCCCTTCCCCACTCGTGCTCTGTCTCTCTCTGTCTCTCAAAAAGGAATAAATGT
TAAAACAAAAAAAAATTTTTTAAAAAATACAGACATCAAGCTGACAGTATCTGAATTCAC
TATATCATCTTTGTATCACCCAAAGTGAAAAAAACCCATCCATTCTATGCTTCCTGATAC
AACACAATATGAAGTATACCACACTAATTATAATGTATTCTTATCTAAAAAAGTGAACTG
ATTTTGATCAAATCTCCTGATCTGATTACCAGTTTACAAAAAATATGGATAATAGAGGAA
TAAGTTAAATGAAACTAGGAGGAAGCAATCTGCCAAATCCAGAATGGGAGAGGTTCTAGA
ACACAAGTGGCCTGGTTTCTCCAAAAAACCAAAGAAAAGAAGTGTATCAGGATGGGGTAG
GGGGAGCTGATATATAATAAAAAAAGGCAAAAGAAATGTAACAAAATGTGATGTGTTGAT
CCCGATTAGAACAAACCAACTATAAAAGGACACCTGTGAAAAGCCTCATTCTAGATGGAA
ATAAGTACTACCATTCATGGTGTCCAGAAATTGTTAACGTGGCTACAATAAGACACAGGT
TATGCTTCCATTGCAGCAAGTTGATTGCAGTGGTGACATTGAGAACTGTAACATTTTTTC
CTAGGCTCATGGAGTAGAGAGTGGAAGTAACAAGACTTTTCAATATTAGAGACAATGAAG
GAGTAACAATTTTAGATCATTTCCCAAAATAGTAATCAATGTACTTCCTACAATTTGACT
TCTAGGGCCCTACCGTAAAGAAAGTGGATCCCAAAGATTACAGGTGGGGAATTTCTGAAG
TAGGTCCACATGCCAGTGGAGATCAAAGAAGTCCAACCAAAAGAACCAGACTGACTGATA
GTGACAACTGTGGATTAAACAAAAGTTCTTTTTAAAAGGATTATTTTGGGGGCGCCTGGG
TGGTTCAGTCGGTTAAGCACCCGACTCTTGATTTCAGCTCAGCTCATGATCTCACAGTTG
GCGGGTTTGAGGCCCACGTCAGGCTCTGTGCCGATGGTGTGGAGCCTGCTTGGGATTCTG
TCTCCTCTCTCTGCCCCTCCCCCACTTGCTCTCTGTATCTTTCTCAAAATAAGTAAAAAC
ATACTTTAAAAAATAATAAATAAATAAGTAAATAAATGGGTTATTTTGAAGATTATGATT
CTGGTTTTGGAGGAACTATGGTGATCGGCTGCAGCAGTGGAAGGACACGCATGTAAAATC
CCGGAAATAAAAAATTTATTGGGGCATCTGGGTGGCTCAGCCGGTTAAGCATCTGACTCT
TGGTTTCGGCTCAGGTCATGATCTCACAGTTCGTGGGACCAAGCCCTGCATCAGACTCTG
CACTGACGGTGCGGAGCCTGCTTGGGATTCTCTCTCCCTATCTGTCCCTCCCCCACTCAC
ACTCACACTTTCTCTCTCAAAATAAATAAATATATATTTTTTTAATTTATTGACTTAAAA
AATTAAGAGGACACCTTTGAGATAATTGGGGAAATATGAATATAGACTGGAAATTAGGTG
ATACTCAAGAATTACTGTGGACTTGGTTAGGTGTGATATGGTAGTTATGTTTAAAAGCAA
CAAAATAAAATCTTTCAAGGGCTGCCCTTCTCATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved