Felis_catus Locus Mono:55:SNORA72
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:55:SNORA72
Felis_catus
Mono:55:SNORA72
scaffold_201608
SNORA72
1001..1130
2130
TTTTAAAGGGAGTAGATTCATAGCATCCACTGTCAGTGCCATTTCCCTTTCTGTGATGA
CTTGTTCACTGTTTACATGAAAGGTTTCAGGAAGTAAGAAATGTAAACATAAATAGATAT
ATGAACAAATAAATGAAAAGCTATGCTGCCTTTGTCACATAGCGAAAAGGTGTGACTATA
ATGGGAACACAGTAGCTGTCTGATTAAAACTTTAGGATTTTTCCTGGAAACTTTGAAACA
TGTCTGATTTTTTCTTTTCCTTTTTATTTTTTTATTTTTATTTTTTTTAACGTTTATTTA
TTTTTGAGACAGAGAGAGACAGAGCATGAACGGGGGAGGGTCAGAGAGAGGGAGACACAG
AATCTGAAACAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGCCTGACGTGGGGCTCGAAC
TCACGGACCGCGAAATCATGACCTGAGCCAAAGTCGGCCACTTAACCGACTAAGCCACCA
GGCGCCCTCTTTTCCTTTTTAAATAACGCTGTGTAAAGGGAGAAGTGGTACCCTAGAATG
CCATGCTTACACTGGAACTTTGAATGTATCATCATCCTACTCACTGCAGGTGCTGGTATG
AAACACTATCATTGCTGAGGCTTGCTTGCCTACTGACATGTTCGTCCTTTGGAAGCCCCA
GAAAGTGATTTGTAAATTATTTGCTTCTTGTCACCATACAGTTGTTGTTTTTTTTTTTAA
GTTGGTGTTTTTGTTTTTTGTTTTTTTGCCATCTTAACCATTTTGAAGTATATAGTCCAG
TGGTGTTAAATGCATTCATAATGTCATAGAGTAGTCCACCCTTATCCACAGGACATATGT
TCTAAGACGCCCAGTGGATACCTAAAACTGTGGATACACCTTATGTGTACAGTTTTTTTC
CTATACATACATACCTATGATAAAGTTTAATTTACAAATTAGGCACAGTAAGAGATTAAC
AATAATAAAATAGAACAACTGTATCTATATTGTAATAAAGTTTGCAAATATTCGTGCTGT
TCTGATTTTGTAATAATCAGGGCAGGCTAAACATTCACTATATTAAGACCATGCATGTCC
CCAGACCTAGTTCTTTGCCTAGGTCTGGTTTTCTCAGTTGTGGTGGGAAACCAAGTATTA
CTGATATTATGCATCTTATGTGGGAAATGTCTGTGACTCTAGGTATCTGATCATCCTTGG
GAAATGACAGCACAGTTAGCGTAGTAACTTTTGAAAATAACCATTGCTAACTTGATGATT
ACCACTTGCTTAAAATGAATTGTAAAACTAACAAAAAAACAAGACTATGTGAATGTAGTC
TCTCTTTTTCAAAGTACCTTATTGTATTGTACTCACCCTTCTTGTGTTGTGAAGTGATAA
ATACCTACATGATGAGATGAAGTGAGGTATGTGATGTAGGAATTATGATGTAGCCTGAAG
CTATTATTGACCTGACAATATGTCCGAAGGAGGATTCATCTGCTTTTGGACCATGGTTGA
CCACAGGTAACTGCAACTGTAGAAAGCGGAAACTGCAGATAAGAGAGGGACTACTGTATA
ATCATCACCTCCATCCATCTCCATAACTCTTTTCATCTTGTAAGACCGAAACTCTACATC
CATTCAACAATAACTCCCCTTTCTTTCCCCCTTCACTCCAGCCCCTGGCGGGCACAATTC
TACTTTCTGTCTCTGTGATTGTGACTACTCTAAGTATCTTGTAAAAATGCAATCATACAG
TACTTGTCCTTTTGTGACTGGTTTATTTCATTTAGCATAATCCTCAGGGTTCATCCATGT
TGTAGCAGATATCAGAATTTCCTTCCTTTTCAAGGCTGAAAAATGTTCCATTGTATATAT
ACACCACATTTTGCTTCTCCATTCATCTGTCCATGGACACTTAGGTTGTTTCCATGTTTT
ACCTATTGTGAATAATGCTGCAGTGAATATGAATGTACACATATCTCTTCCAAGACCCTG
CTTTCAGCTCTTGTGGGTATATACCCAGAAGAGGAATTTCTGGGTCATTTGGTAATTCTA
TTCTTAATTTTTTGAGGAACCTGCACACTGTTTTTGCACATAGGCTGTACCATTTTACTT
TTCTACCAATAGTGCACAAGATTTCCAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved