Felis_catus Locus Poly:26:SNORD22
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:26:SNORD22
Felis_catus
Poly:26:SNORD22
GeneScaffold_3186
SNORD25, SNORD26, SNORD27, SNORD28, SNORD22, SNORD31, SNORD22
1001..1069, 1286..1361, 1632..1704, 2027..2101, 2487..2613, 3071..3139, 3380..3504
4504
GTAGAGCACGCAGCTCTTGATCCCAGGGTCCGTGACTTTGAACCCCACGCTGGACAGTG
GAGCCTACTTTATATATAACCTGTATATGTATACGCCCTGCTACAAGCCAAGCTCCTAGC
GACATCGGACGGGAAAAACCGTCGCTCGGGAAAAATCAGACCCTGTCAGAAGATCCAAGC
GGAGCAGGAGCACTGAGGGCCTGATTCACATTCCCAAAATGGCTCCGTACAAAGGGCCTT
CCGCTCCCGGTACCCCACAGCCGCCCTCGACGCAGACACCCTGCGCACCAGGCCTGCAGA
GGCGCGCCGGGAGGCAGGCGTGTAACCGGGATGACGCCGGTCGAGACTTCAAGATGAGGT
TCAGGGGGAACCTCACGGGGAGGCGGAGCCTGCACACCAGTTTAGGGTGTGTGTGGGTAA
GGGGGGGCTCAGGGAGTGGTGTGGGAGCAGGCGGTCGTGACGGGGACGGAGCGTCTCCCG
AGATCGTTGCAAAGCCGGGACCTCTGCGTTCTCTTCCTACAGAGAGCCGGCGGTACGGCC
CCCGCTGCAATGAGCGCCAGCGCGACTCCCTGAGACGCATGCGCGTCTTTTCTCGCGCCC
CAGATGCTGAGTGTGCGCACTGCACTCCCGCCTTCCCTGGAATTCCCTACTCACAATTCC
CCAGGCTCGCGCGCTGTCTCCATATGCGCGTGCGCCCGCCATAGTCCCGCCCATAAATCC
CGTGGGCCTCTGCGGGGTGGTATTTAAGTATCTCGCTGCCGCCCGTCTGCCTCATTTTTT
GTTCACGGTGCCAGGTAAGTATGTGGGTTGTTTACGTTATCTTTTTTAAAAGGTGAAGCG
AGGGAAAAATAAAAAGTGAGCGTGGCTTGCCTGAGCACTAATACATTGCATTTATTGGTT
GGTGGGGGAGGGGTAAGAGCTCGGCCACGGCCTTGAGTCCACGAAGCAGCCGCGGAGCTT
TGTGAAGGACAAGATGGCGATGGCGGGCCGTGCCGGCGGCCCTCTCTGTGATGAGAACCT
TTTCACAGACCTGTACTGAGCTCCGTGAGGATAAGACACTCTGAAGAGACGGGCCTTGCA
CAGCCGAGATGCGACACAGTCGTAGCTCCGGCGGACAAAACGATTGTGAAAAAGCCGGTG
TTGATTTAATGTCCTCTTGTCTGCAGGGATTAGGCGCACGTCTGAACGTTAGAATGGAAA
AGAGCCGACCTGCTAGGGTAAGTGTGTGGCCCTGTTTTACCCCCTCTTCCTCTGTTGTCG
AGTGTACGGGGGCCCTGTGGGAAGTGCTACGGGGATGATACTAAGGATTGAACTCTCTCT
TTCTGATGGAGTAGTGGAGAAAGCCTAAGAGTTCTGAGTAGCACCAGCCCTCAGCGAATG
TTCGGGTGTTTCGCGCGGAGGCAAGAAGACCGACTGCAAAGTATGAAACTAAGTGAGAGG
TGCCCCCCCTTTTTTTTTCCTTCCAGATGTGGTTCAGCTCAAAAGACCTTACGGATTGGA
GGATGGGACAAGACCCATCCCTGCAAAGTAAGCATTCCAGTGATGCTCCAGGTGGGTATG
CAGTGATTTGCCGCAGTTAAGGGTGGGCACTGTGTCTAGATGGGGTTTGTTCTTGTTCAG
ATTATGCTGACCACTCTGTGATGAACATAAAAAAGACAAGCATATGGCTGATCTTAAAAG
TGATGTCATCTTCCTGCTGAGAAGTGGACCAAGAGTATTCAAGGACCTGTGAATGGCTAT
TTTTAGGTACATATAATGCCTTCCTTTTCTGTTTCCAGCATCTCCTCCCCAAGCCTGAGG
AATCCAGCTGCCTCCAAGGGTGAAGACAGGTAATTTTTTGACCAAATGAGGGGATTGGAG
TGTCCTCTCCTGTTTGGCCTACAACCAGGAGAGCAAAATGAGCAGTTTTGCCTTTTTACT
CCTTGCAGCTTATTCCTCTTAGAATGACTTTCCTGTGGAGGGAGCGAGCAACCCAACAGT
ACAGTTAATTCTTGAGATGGTGTGCTCTCCCTCACCCATATGTCACTGTCAGATGATTTG
AATAGATATGCTGATCCTCCGTGAGGTACAACAATTAATAGCATGTTAGAGTTCTGATGG
CAGTTTCCATTAATGAAGAAACTTTGTTCTAGCCTAGTATTTTTGGATAACCATCTGGTC
TCCTTTTGCAGGTCGTCCTGATGGTGGTAACATGTTGATTTACCTTATGGTGAGTAGTTT
CTCCCAATACTGTTGTTTTGTTAGCATATATGTGAACCCATCACAGGGTGATTTTTTTTT
TTTTTCATGGTGTGGTTTTTATTTGTCTTGTCGTTGTGACCAAAGACTTGATCAGCCCGT
ATCGCTTTCTGGTTCTTTTCCTTGTAGTGATATTTCTTGATCTATTTCTCTAGATGCCCA
CTGATGTGTCAGGGTCGAACTCATGGAAAGAGTTAAGGATGGTGAGTACTTGTAACCTTG
CTGATTACAGCTTGCCCCAGAGTATAATGCCAATGAAGAGAGCAAGCATCCTGTCTTACC
CCTGTTCTAGCCCCAGAGCCAGTAATGGTGAACCCACTGGGGCTAACTGGGTGAGAGGAT
GAGAATTTGTTCCATAAGGAACTGTCTGAGGTACAGTGTATCCCTGTCAATAGTATTTGC
TTGGGTTTTCTTCACTTAAACCCATTAATTATATAGCTAGAATAGCTTTGGCTGTTTTAG
ATACTTGCTTGGCTAATTACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTGCTGAAGGTAAGCATTACTGACTCCAGTGTGGTTTGTTTCAGGTTCAGCACTTCT
CTGGAGCCCAAGAATGATTTGAGGTAAATGCCTTTGTAATGCTGTCATTTATAGCCATTA
TGTAAAATTTACTAGGTGTTTTTAACGGGGAGGGGGCGACACTTTGGTCTGGGTAGCTAT
TCGAAGAAGACATTACTGACTTAATTCAGTCTTGTCTGTGGACACCCTGAACCATCTGTG
ACAAGCTCCCACTCACCAGTGATGAATGCAATACCGCCCCAGTCTGAACACTGTGACTGA
AAGGTATTCTCTGAGCTGTGAGCTTATGTTAGTAAGAAGTGGTAAGTTGGCTGGTGGTTT
CTATGTAAAATGTGCATGCAGAATACTACATAACCTTTACAGCTGTGCCTTCCCTCTAAG
CAATAGGGACCCAGGGGGATGACTGAGAGGCCTATAATTCCCAATCATTCTTTTACAGGT
ACCCTCAGCCATTTCTCTGCTCAGCTCCAGTCTGAAGTCAGGTGGGTAAACCTAGATACT
AGATGGTCCAAATTAAAACTTCCCAGTGAAGAAACAGTCACATGTCTTACTTCCTGTTCT
AGTCCCAGAGCCTGTAAAGGTGAACCCACTGGGACTGGCTGGGGGAAAAGAGGAAGCTTG
TTCCAGAAGGAACAGTCTGAGGGATTACAAGAGATTTCTAAAGATGGGAAAGGGAAGGAC
AAGTCACTTTGACGTAGAGTTTTGTTTTGTTTTGTTTTTTTTCCCAGGTCTGAAGAAGGA
ACAAGGCATAGGTAATGGGTAGGTATTTGTCCAAATATTGGTGTTTATTTAATGTTTATT
TTTGAGAGAGACCACGGAGACACAGAATCTGAAGCAGGCTAACAGAAAAACAAAAGTATA
CCTGAAAGTAGGTATTATGTTAGGGGTTTTTTTTTAGAAAGCAAGTGGGGGAAGTGGGGC
AGAGGGAAAGAAAATCTTAAGCAGGCTCCATACTGAGTGTGGAGCCCACGTGGGGCTTAC
CCACATGACCAGAGCCTAAATCAAGAATCATGTTCAACCAACTGAGCTATTGATGCTCTC
CAGGGTGAACTAGCTTAAAGGGTAGTCCCTTGTAAACTCCATGTAGTGCATACATTCTTC
TTGTCTACCAAGAAAATGCACTTTATTCTGTATAGGAATTCAGTTCTTTATCAAAAGGGA
ATTTTCGGGGCGCCTGGGTGGCGCAGTCGGTTAAGCGTCCGACTTCAGCCAGGTCACGAT
CTCGCGGTCCGGGAGTTCCAGCCCCGCGTCAGGCTCTGGGCTGATGGCTCGGAGCCTGGA
GCCTGTTTCCGATTCTGTGTCTCCCTCTCTCTCTGCCCCTCCCCCATTCATGCTCTGTCT
CTCTCTGTCCCAAAAATAAATGTTGAAAAAAAAAAGTTAAAAAAAAGGAATTTTCAAGTC
CTGTTTTTGTACAACCTAGTTATTGTAATTAACATAATTGTTTAACCCTTTCTAAATACA
GGTTTAACCTTCATTGTGACTTGTGCATGTAGCTGGATAGAAGGAAATAATCCTGGGGAA
GTTGGCAGTATCCAATTTAATGTGTGGCACTTTGCCTGATGCTGTCTAGCTCAGGGAAGC
ATTGTTCAAGGAGCCTTCTAAGATCTTCCCTCCCCCAATACATGCCTCACTGCATGAAAA
GTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved