Felis_catus Locus Mono:43:SNORA70
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:43:SNORA70
Felis_catus
Mono:43:SNORA70
scaffold_215933
SNORA70
1001..1134
2134
ATATAGAAACATTTCTCCCTACTCCTCCTGTCCCCAGTGATAATATTTATCTATCAGCT
TTCCTTGTGGAAGGAGTATGTTTATTCTACAGAGAGCTATGGATAAAATCTCTTCATTAG
GGTCTTTTAAATTGTTTTCTTCCAGTGGATTTTGTTTTGTTTGAAAAAAAAAAAACCAGA
AATAATATTTTCAACCTTTGGAAGTAAAAGATACATTTGTAGTTGCTAGCTTTTTGTTTG
AACTTGAAGTTGTTTGAACCTGGCAGGAGGAGAAAGCTTTAGATAGTGCCCACTCCTGTC
TTGTCTTAGCAGGTGTCCAACATCTGTTCAGTCACTCAGGCCCCAAACCTGGGAGCCCTC
CTGGACTCCCCTGACACCCTGTCTCCACGTCACATTCAATTACCAAGTCCTGTTGACTCT
ATTTTCTTTTTTTGGTCTTGTTCTGTTCTTAATGTACACACTGATGGGGTCCAGTAGTTG
GGAGACGTGACACCTATACTCTGTAGGTACTTGTGGAAATGACTCTACATGGGAGATGCA
CAGTTTTTACCAAGTTTGTCTACCTACCTTCTGATTTGCTATGTGGGCCCTGTTAAAGTG
ATAAACTATTATACTAGGTAGCTCTCTGTAGTAGTTTGTCATTGCTCCATAACTACCCAA
GACACAGTGCCTTAAACAATAATTTATGTATCACATACCTGAGGGTTGGCTGCAGCTGAC
TGATCTAAGCGAGACCTGGCTGGGAGGCTCAGCCGGGCGTCTCTGCTCCACGTGTCTCCC
ACCTCCTTGGGAGAGCAGCCGAGCCGAAGCAAGTTCTTCTCAGAGTGATGTTGACTCTAC
TTTGCAACTGTCACCATCCTAGGTCAAGTCACTACCATCTCTTTCCTGGATTAGTGTTCA
ATCTAACCCTTCCCCCACCCCCCAAAAAAGTTGGTCTCACTGCATCTCTCCCAGTCTAGT
CCCCTTATAACAATGTTACCTTTTAGAAATACAAACATCATCTGCAGCCAATTAAGCGGA
CTGTGCTCTTTCCCCACAGGGGCCCAGTATGCAATGGCCACACACAGTAGCCTCCTTGGT
AGTGTATGAAGCCTGTTGATTGTATGGGTTGCCCTAAGGGGCCTTGGGGACAGCCCTTTC
CAGTGGACATTGATGTCTGACCTCATGCTATCTCCAATCCAGGCTCCAGACAGGTATGCA
GGGTAACTTTGGAAAGGCCCAGGGCACAAAGGCCAGGGCCATTGTTGGCTGAGTCATCAT
GTCCATGCATAGCAGGTTGCAGAACAAGAAGCACATGATTGAGGCCCTATGTAAGGCCAG
GTTCAAGTTCCCTGGCTGCCAGAAGATCCACATTTCCAAGAAGTGGGGCTTTACTAAGTT
TAATGTGGATGAATTTGAAGAAATGGTGGCTGAAAAGTGGCTCATCCCAGATAGGGATCA
TCAAACACATCCCTAATTATGGCCCCTTGGACAAATGGTGGGCTCTGCACTCATGAGAAC
CTTGGCACCGCCCATCCCTTTCCATGCCCACCCATAAATCCTACTTCCTGTCCAAAAACA
CAAATACAAATATCATCCTGCTGAAAAACTTCAGTAGCTTCTTAGAGCCTCAGGCCAAGG
CTCCCACAGCCTTCAGCAGAGAGGTTCCTGCCTTTTGACTCATCTTTGCCTGTCAGCCAT
CCTGGGCTTCCTTTGGTTCCTTGCATAGCACTTTCCTGCCTTGATTCAGGGCTTTGCATA
TGCTGTTCCTCCCGCCTAGAGAGCTCCTCTCTACATCCTTTGTCCAGCCAACTCCTCATT
TAATCTTAAATTTAAATCCCCCCTGACCTCAGGGAGGGCTTTCCAGATACACCCCATCAG
CTCCTAGAGTACCTCTACGTCACCCTTTGTAACATTCCTCAGATTGGTCCTTTCTCATTC
AATTTGCCCCCTGGACTGCAAGCTCTGTGAGGTCAGGGGCCGTGTCTAGTTCACTGGTCT
CCCCCTGGCACCTGCACCGCCAGCTCGCAGGCAGTGCTGAATGAACGAAAAGATCAGCAA
AAGGGGTGGGTGGGAAAGGTCTGCCAATGAGCCGGGATGATCGAGATCTTGTTTTTCACA
CCTGCAGATTTGGGGGTCGGACCAGGTAGGCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved