Felis_catus Locus Poly:17:SNORD115
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:17:SNORD115
Felis_catus
Poly:17:SNORD115
scaffold_114892
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2617..2697, 4447..4527, 6253..6333, 8052..8132
9132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCACCGTAATCTCAAAGAT
GGTAAGGGATTAGGTGTCCCCACCAGAACCATGTGTGCTGTGCTGATGGAGACAGTGTTG
GATACTGGTGGGATGCCCGTCAGGGCCCTGTTCCCCCAAGGGATCTTGGCATTGCGTCTG
CGTGGTAGCATTCATGGGCCCTTCTGGGGCCCTATGCCTGCCCATTCCTGCCAAAACACA
GGGCCGGTCCCTGCCAGCCAAGGCCCAGGATTCTGCCTGCCACCGACCCACAAATGTCTG
TCCCAATAACACTGCAGGAAGACCTGTGCATGTGGCCTCATCCTGCTGTGGCAGCCTCCA
TGCCTGAGCATTCCTGGGAGGCTTGATTTCCCTTGTTTCCAGTGGAGCCACAGAGGCTGA
GGGCCTTGTGGACCAGCTGCAGTCTTCCTTCCAACCAGGCCAGGATTGCAAGATTGTGTC
ATGAATTCAGTCCCAGCCCTGCGAATTCTGAGATCCCTCCCATTGCCACAAGGTGACGTC
TGATGGGAAGGTGTTTTGTCACTGCTGAGCTGCCTCTCTCTGTGCAAATCCCATGCAGCG
ACTGAGATCCCACCTGGAGCACAGATGGGAATTTGGCCCATCTTTGGGAGCAGTCCCTGA
GCCAGGGGCCCGCCCCCAAGGCCACCCTGTGCATAACCCTCACTGGTAAGCATGTTGAGC
TGGAGGGTAGAAGGCAGAGGCGGGTGGGGACTGCCTTGGTTGGGTCAATGATGAGAACTC
ATATGGTTTCGAAGACAGATGATGACCTAAAAATTATGCTCAATAGGATTACACTGAGGC
CCAGTGGAGGGCACCGCACAGAGGCGGGATCCTGAGGACCTCTGTGGCCCTAGCTAGAGC
TGGATCCTGGTGTTCGAGGCAACTGATCCCTCGAGGCTCCCTATTGGGGCTTTCCCTGGT
CTGGGCCTCTGAGCGCCTAAGACGTGCTCTCACCCTGGGCCATTGTGTGCCCATTACTAG
TGCTTCCGGGATTCATCCCTGGGAAAACAACTAAGCTCCTTCAGTGTCCTGGTGTCTTTC
AGTGGGACGTCGTCTTGATGACCAGGGTCTCACCATTGAGCCCACCATGGGGAGGAGAAT
GGATGCCTGTGTGAGTATCCAAAGATCCAGTGCCCTTGGGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGTGCGCCGAAATTTCACACAATGGGCTTTAGAGGCAG
GGGCCAGTCCCGGGGTAACCTGAGTGGACACTAGACAGCTTTGGCATAACGGGTAGGTGG
TATCTGAAAGATGCTCGCAGCGTGGTCCAGACCCCGAGTGGCATCTGGGCTCCTGCCTCC
GGGTTCTTCACCATTGGCACTGTCTGGTGGTCATGTGTCCTTATGGGGCCGGTAGGTCGT
CCACAGATCGATGGGATTTTGTCTGACTATGGTCGTTTGGTCAGTGCCACGAGCCAGGGC
ATGCTTTGGTTCTTCACTTGTGACCCCGTGTCTGAGTGAGTTTGAAGGCACTGGGGAAGC
ATCCTGGCCCCTCACCCTTCCCTCACGGAAATCTCATAGATGGGAAGGGATGAGGTGTCC
TCACGGGAGCCATGGAGCAGTGCTGATGGAGACAGTGTTGGATGCTGGTGGGATGCCATC
AGGGCCCTCATCCCCCAAGGGATCTTGGCATTGCATCTGTGTGGTAGCGTTCGTGGGACC
TTCCAGGGCCCAATGTCTGCCCATTGCAGACCTGTTCCTGCCAACCTGGAAAAACGCAGG
ACCTGTCCCTGCCAACCAATGCCTGGGATTCTGCCTGCCACCAACCCCCCAAGGTCTGTC
CCAGTCATGCTGCAGGAAGACCTGTGCTTGTGTCCTGGTGCCTGCTGTGGCAGCCTCCAT
GCTCAGAGACCTGTTGGGCTTGAATTTCCTTGTTTCCAGTGGATCCACAGAGGCTGAGGG
CCATGTGGACACGCTGCAGCCTCCCTTCCCACAGGCCAGGATTGCGGGATTACGTCATGA
TGCAGTCCCAGCCCCACGCATTCTGAGATCCCTCCCATTGTCACAAGGTGAAGTCTGATG
GGGAAGGTGTTTTGTCATTGCTGAGCTGCCTCTATCTGTGCAGATCCCGTGCTCTGACCA
AGAACCCACCTGGGTCATGGAGGGGAGTTTGGCCCATCTTCAGGAACAAGCATCATGCCA
GTGGCCCCCATGGCCATGCCGCATATCACAAAACCTCTCTGGTAAGCATGTTGAGCTGGA
GGGTAGAAGGCAGAGGCGGGAGGGGACTGCCTTGGATGGATCAATGATGAGACCTCATAT
GGTCTCGAAGACAGATGATGACCTAAAAATTATGCTCAATAGGTTTATGCTGAGGCCCAG
TGGAGGGCACAGCCCTGAGGTGGGATCCTGGGGACTCCTGTGGCCCTGGCGTAGCGCTGG
CACCTGGGCTCGAGGCGACCGATCCCTGTAGTTTCCCCAGTGGGGCTTTCCCAGGTCTGG
GCCCCCACACGCCAAAGATATGCTCCCGCCCTTGGGCATTGTGTGCCCATTACTAATGCT
TCCCGGGACTCATCCCTGCGAACCCAGCTAAGCTCCCTTGGTGTCCTGGTGTCTTTCAGG
GGGATGTCGCCATGGTGACCAGGATCCCACTTGAGCCCACCATCGGACGATAGCGGACGC
CTGTGTGAGTACCAGGAGATCCAGTGCCCTTGGGTCGATTGGCGAGGGAGCCCTCAGAGC
AACGCCAGCCATCTTGTGGGACAGGGGCTTCATCCTCACCCCAGAGGGCTGGCATGTCCC
TGAACAACTCCCGTGTGCACTAAGCTGTCTGGAAAAAACAGGTCACCCGTGACACCTGCA
AGGGATGGAATGATCCCACGTGAGACCCTCTTATTTGATGGCCATGGGCCATGTTTCCCA
GTGTGGGAGGGTGCTCCAGTTGATGTCAGAATCACTGATGTGTTAGTAAGCAAGTGACGT
GTTGTGGTGGGCATTGTAGTTGGCCAATGTGACTTCCTGCATGGAAGCAGTGTACACAGA
TTTCGTGCAATGGGCTTTGGAGGTAGGGGCCAGACCAGGAATTACCTGGATGGACACTAG
ACAGCTTTGGCTTAATGGGTAGAAGGTATCTGAAAGATGCTGGTAGTGTGACCCTGACAC
GGATTGGCATGCAGGCTCCTGCCCCCAGGTTCTTCACCATTGGCACCGTCTGGTGGTTGC
ATGTCCTTATGGGGCCCGTGGGTCATCCCACAACTGGATGGGGTTTTGTCTGAAAATGGC
CCTTGGTCGGTGCCATGAGCCAGGGCATGCTTGGGTTCTTGACTTGTGACCCCGAGTCCC
AGTGAGTTTGAAGGCACTGGGGAACCATTCAGGTTCCTCACCCTTTCCTCACCGTAATCT
CAAATACAGGAAGGGATGAGGTGTCCCCATGGGAGCCATGGAGCAGCACTGGTGGAAACA
GTGTTGGATGCTGGTGGGATGACTTTCAGGAAACAGTGTTGGATGCTGGTTGGATGCTGT
TCCCCTAAGGGATCTTGTGTTGCGTCTGCATGGTGGCATTCGTGGGCTCATCTGGGGCCC
CTGCCCACCCATTCCTGACAAAACACAGGGCTAGTCCCTGCCAGCCAATGCCCAGGATTC
TGCCTGCTACTGCCCTGCCAGCGTCTGTTGCAATAAGGATTTGGGAGGACCTGTGCTTGT
GGCCTGGTGCCTGCTGTGACAGCCTCCATGCTCAGATTCCTGTGAAGCTTGAATTCCCTT
GTTTCCACTGGAGCCACTGAAGCTGAGGGTCTTGTGGAAACGCTGCAGCCTTCCTTCCGA
CCAGGCCAGGATTGCAGGATTGCATCGTGAATGCACTCCCAGCACCATGCATTCTGAGAT
CTATCCCATTGCTACAAGGTGAGGTCTGATGGGAAGGAGTTTTGTTATTGCTGACTTGCC
TCTCTCTGTGCAGATCCCACGCCATGACCGAGATCCCACCTGGAGCACGGTGGGGAGTTT
GGCCCATCTTTGGGAACAGGCCATGACCCAGGAACCCCCATGGCCACTCTGCCCATAACA
AAACTTCTCTGGTAAGCATGTTGAGCTGGCGCGTAGAAGGCAGAGGCGGGTGGGGACTGC
CTTGATTGGGTCAATGATGAGAACTCATAAGGTCTCGAAGACAGCTGATGACCTAAAAAT
TATGCTCAATAAGATTACACTGAGGCCCAGTGGAGGGCACCACACAGAGGCGGGATCCTG
GGGACCCCTGTGGCCCTGGCATAACGCTGGATCCTGGGGCTCGAGGTGACTGATCCCTTG
AGGCTCCCCAGTGGGGCTCTCCCCAGTCTGGGCCTGTAAGCGCCTAAGATGTGCTCCCAT
CCTGGGACGTTGTGTGGCCAATAGTAGTGCTTCCCGTGTTGATCCCAGGGAAATAACAAA
GACTCCTGCAGTGTCGTTGTTTCTATCAGTGTGACATCGTCTTGGTGATCAGGGTCTCGG
CCATTGAGCCCGCCCATGGGAGGAGAATGGATGCATGTGAGAGTACCCGAATATCTAGAG
CCATTGGGACTGATTAGTGAGAGTGCCCTCAGGGCAACCCCAGCCATCATGCGGGACTGG
GGGTTAGTCCTCACACCAGAGGGCTGGTGTGTCCCTGAACGTCTCCTCTGTACACTAGGC
TGTCTGGAAAAAATAGGTCATCTGCGACACCAGTAAGGGATGCCACGGTCCCCCATGGGA
TACTCTTACTTGACTGACCATGGGCCACATTTCCCAGTGTGAGAGGGCGCTCTGGTAGAT
GTCAGAATCACTGATGCCTTACTAGGCATGCGATGTGCTGCCATGGGCATTGCAGACAGC
CAATGTCACCTCCTGCATGTAAGAGGTGAAATTTCACGCAATGGGCTTTAGAGGCAGGGA
CCAGATCCTGGGTTACCTGAGTGGACAATAGACAGCTGTGGCATAAGGGGTAGACGGTAT
CTGAAAGATGCTTGCAGCGTGGTCCAGACCCCGAGTGGCATGCGGGCTCCTGCCCCCGGG
TTCTTCACCGTTGGCTCCATCTGGTGGTCGTGTGTCCTTATGGGGCCCGTGGGTCGTCCC
GCAGATCAATGGGGTTTTGTCTGACTATGGCCCTTTGGTTGGTGCCAAGAGCCAGGGCAC
ACTGTGGTTCTTCACTTGTGACCCCACATCTGAGTGAGTTTGAAGGCACTGGGGAACTGT
GCTGGGCCCTCACCCTTCCCTCATCGTATTCTCAAAGATGGGAAGGGATGGTGTCCCCAC
TGGAGCCATGGAGCAGCACTGGTGGAGACACTGTTGGATGCTGGTGGGATGCCTGTCAGG
ACCCTGTTCCCCCAAGGGAATTTGGCATCGCATCTGCATGGTAGCATTCATGGGTCCATC
CGAGGACCCTGCCCACCCTTTCCTGGCAAAACACAGGGCCAGTCCCTGCCAGTCAATGTC
CAGGATTCTGCCTACTACTGCCCCGCCGTCTGTCACAATAAGGATGTGGGAGGACCTGTG
CATATGGCCTGGTGCCTGCTGTGGCAGCCTCCATGCTCAGATTCCTGTGAGGCTTGAATT
CCCTTATTTCCAGTGGAACCACAGGGGCTGAGGGCCTTGTGGACACGCTGCAGCCTTCCT
TCCTGTCAGGCCAGGATTGCAGGATTGCATCATGAATGCACTCCCAGCGCTGTGCATTCT
GAGATCCTTGCCACTGCCACAAGGCGAGGTCTGATGGGGAAGGCATTTGTCATTGCTGAG
TTGCCTCTCTCCTTGCAGATCCCGTGCACCCACCGAGATCCCACCTGGCACACGGAAGGG
AGTTTGGCCCATCTTCAGGAACATGCCTCAAAGCTAGGGGCCCCCATGGCCATGCAGCAC
ATCATAAAACATCCTTGGTAAGCATGTTGAGCTAGAGGGTAGAAGGCAGAGGCGGGTGGG
GACTGCCTTGGTTGGGTCAATGATGAGAACTCATATGGTCTCGAAGACAGATGATGACCT
AAAAATTATGCTCAATAGGATTATGCTGAGGCCCAGTGGAGGTCACCGTACTGAGGCGGG
ATCCTGGGAACTCCTGTGGCCCCGGAATAGCGCTGGCACCTGGAGCTCGAGTCGCCGATC
CCTTGAGGCTCCCCAGTGGGGTTCTCCAGTAATCTGGGCCTCCACATTACTAAGATGTGC
TCCCGCCCTGGGGTGTTGTGTGCCTATTATTAGTGCTTCCCAGGACTCATCCCTGGGAAC
CCAACTAAGCTCCCTCGGTGTCCTGGTGTCTTTCAGTGGGAAGTCGTCTTAGTGACCAGG
GTCTCGCCATTGAGGCCACCATGGGAGGAGAGTGGATGCCTGTGTGAGTACCCAGAGACC
CAGTGTCCTTGGTCCAATTGGTGAGGCAGCACTCAGGGCAATGCCAGACTGGGGTTTCGT
CCTCATCCCAGAAGGCTGACGAGTCACTGATCGTCTTCCTTGTGCCTTAGGTTGTCTGGA
AACAACACATCACCCCCAACACCTGCAAGGGATGCCACCGTCCCCCGCGGGATCCTCTAC
TTGACGGCCCATGGCCCCATTTCCCAGTCTGGAGGGCACTCCAGTTTTTGTCAGAATCAC
TGAAGCTTTACTAGGCACACGAGATGCTGTGGTGGGAATTGCACACCCTCAATGTGACCT
CTTGCGTGGAAGCAGTGCAACCAAATTTCACAAAATGGGTTTTGGAGGCAGGGGCCAGGT
ATGGTGATAAACCTGAATGGACAATGCACAACTTTGGAATAACGGGTAGATGCTATCTGA
AAAATGCTGGCAACGTGGCCCAACCCCGAGTGGCATGCGGGTTCCTGCCTCTTGGTTCTT
CACCATTGGCACTGTCTGGTGGTCGTGTGTCCTTACGGGCCCCAGGGGTCATCCCACAGC
TGTATGGGGCCTTCTCTGACCATGGTCCTTTGGTCGGTGCCTCAGGCCAGGGCACGCTGG
GGTTCTCTACCTGTGACCCTGAGTCCCAGTGAGTTTGAAGGCGCCTGAAAACTGTGCTGG
CCCCTCACCATTCCCTCACCATAAACTCAAAGACGGGAAGGGATGAGGTGTCCCCATGGG
AGCCATGGAACAGCGTTGATGGAGACAGTGTTGGATGCAGGTGGGATGCCCATCAGGGCT
CTGATCCCTCAAGGGATGTTGGATTTGCGTCTGTGTGGTAGCGTTCATGGGCCCTTCTGT
GGACCCATGACAACCCATTCCTGGCAAAATGCAAGGCTGGTTCCTGCCAGCCCAGTCCGG
GGATTCTGCCTGCCACCAACCCGCCAAGGTCTGTCCCAATCGCGCTGTGGGAGGACCTGT
GCATGTGGCCTAGTGCCTGCTGTGGCAGCCTCCATGCTCAGACTCCTGTGGGGCTTGAAT
TCCCTTGTTTCCAGTGGAGCCACAGAGGCTGAGGGCCTTGTGGATATGCTGCAGCCTACC
TTCTTGCCAGGCCAGGATTACAGGATTAAGTCATGAATGCAGTCCCAGACCCATGCATTC
TGAGGTCCCTTCCATAGCAAAAGGTGAGATTTTGATGGAGAAAGGCGTTTGTCATTGCTT
ACTTGCCTCACTCTGCGCAGATCACGCACCCCGACGGAGATCCCACTTGGCACACAGAGG
GGAATTTGGCCCATCTTCGAAACAGGCCCAGAGCCAGGGCCCCCATGGCTTCCCTGCACA
TCACAACACCTCTCTGATAAGCATGTTGAGCTGGCAGGTAGAAGGCAGAGGTGGGTGGGG
ACTGCCTTGGTTGGGTCAATGATGAGAACTCATATGGTCTCAAAGACAGATGATGACCTA
AAAATTATGCTCAATAGGGTTACACTGAGGCCCAGTGGAAGGCACGGCACTGAGGTGGGA
TCCTGGGGACCCCTGTGGCACTTGCAGAGAATGGCACCTGGGGCTCGAGGCAACTGATCC
CTTGAGGCTCCCTTGTGGGTTCTCCACAGTATCTAAGCCTCCACGCGCGAAAGTCATGCT
CCCACACTGAGGTGCTGTGTGCCCATTACTAGTACTTCCTGGGACTCATCCCTGAGAACT
CAACTAAGCTCCCTTGGTGTCCTGGTGTCTTTTAGTGGACATTGTCTGGGTGACCGTGGT
CTTTCTATTGAGCCCACCATGGGACCTGAGCGAATGCCTGTCCCGGACATCCAGTGCCCT
TGGGTCGATTGGCGAGGGAGCCCTCAGAGCAACGCCAGCCATCTTGTGGGACAGGGGCTT
CATCCTCACCCCAGAGGGCTGGCATGTCCCTGAACAACTCCCGTGTGCACTAAGCTGTCT
GGAAAAAACAGGTCACCCGTGACACCTGCAAGGGATGGAATGATCCCACGTGAGACCCTC
TTATTTGATGGCCATGGGCCATGTTTCCCAGTGTGGGAGGGTGCTCCAGTTGATGTCAGA
ATCACTGATGTGTTAGTAAGCAAGTGACGTGTTGTGGTGGGCATTGTAGTTGGCCAATGT
GACTTCCTGCATGGAAGCAGTGCACCCAAATTTCACGAAATGGGCTTTGGAGGCAAGGGC
TGGGCCCGGGATCACCTGGAAGGACAGTAGACAGCTTTGGCATAACGGGTAGACGGAATC
TGAAAGATGCTCTCAGCATGGTCAAGATCCCGAGTGGCATGCGGGCTCCTGCCCCCGGGT
TCTTCACCGTTGACACCATCTGGTGGCCGTGTGTCCTTATGGGCCTTAGGGGCCGCCCCA
CCGCTGAATGGCGTTTTGTCTGACAATGGCCCTTTGGTCAGTGCCACAAGGCAGGGCATG
GTGGGGTTCTTGATGTGACCCAGAGACCCAGTGATTTTTTTTAAATTTTTTTTTTCAACG
TTTATTTATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved