Felis_catus Locus Mono:112:SNORA64
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:112:SNORA64
Felis_catus
Mono:112:SNORA64
GeneScaffold_54
SNORA64
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGATGATTGCTACACCTCAGCTAGGGGCTGCACTGCCA
CCCTGGGCAACTTCGGTAGGTGGTCCCAAGGGGGGCTGTGGCTTCTCTCAGCTCCGCTTA
ATCATACTCGGTGTGTGGTTGGCGTATTTTCAGAGAGAGAGAGGAAGGCTCTCCTAATGC
ACGGCAGACCGGCCCCAAGTGGCCTCTCTGTTCCTAGGAGCGCAACAGTGTCTGTCTGTA
CCTGTGGTGTTTGTCACAAGAATCCACCAGCTCACTCCTGTTTTCCCCTTTGCAGCCAAG
GCCACTTTTGATGCCATTTCTAAGACCTACAGCTATCTCACCCCTGATCTTTGGAAGGAG
ACTGTGTTCACCAAGTCTCCCTATCAGGTACTGCCTGCCTACCCCCCCCTTGTGAGCCTG
GACAAGTGTGGACGGTGGGGCGGCCTCTGTACAACTTAAGTCTCTCTTTTTCCCAGGAAT
TCACTGACCATCTTGTAAAGACCCACACCAGAGTCTCTGTGCAGAGGACCCAGGCTCCAG
CTGTGGCCACCACATAGTTTTGTATGAGAAAAATAAAGTGAATTGAAGCTTGTTAATAGT
GGTTTTTTTTTTTTTTCAAGGTTAGTAGCAGGTATATTTGAAGGGTGATGAAGCCAACGA
AATGAATTAAGATTCGCCAATAGGTCAAATAAGGATTGAAAAAGACTAAAAGCCAATTTG
ATACTATCACTCTTTATTTCAGCAATAGTTCCGTATGGGGGCTGAAAGAGCTGCCTCACG
CAGCGGCGGCCTCTTTAGCAGCTTTTCTCTCTGCCAGCATCCGCTGCTTCTGCTTCGCCA
GGCACTTTCTGGCTGAATAATGGGCACCCAGGTCGTGATCTGAGGAAGAGATTGGGGGAG
GGAAGTCATGGGCCAAATCTACCAAAGGCATAGACTGGAGTCTTCTCTAGAAGCAGAGAA
AGAAAAGGCAGCACAGATACCTGGCAGCAAACAGACCCCTCCCCCAACCAGTCAGCACAC
TTGGGCAGGAACGTTGGTAAAAAACCCTGACTGGAGAAAATGGAGGGTTGAAGGATGAGG
CCAGTGTGGGGGCTCACGTACAGCGGTCCTGGTAGGCCTTGGCCACCTGGGCAAACTGCT
CCATCTCCTTGGCGCAGTTCTCCCTGTAGCTCTCGCCTTCCCTCTGCTGACACGCCTTCA
GCCTTTCCTGGATAATATTGACGATTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved