Felis_catus Locus Mono:3:SNORA62
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:3:SNORA62
Felis_catus
Mono:3:SNORA62
scaffold_133224
SNORA62
1001..1140
2140
TCGACCCTGAGCGTTCTGGTTCAGAAAGAATGCAAACCTCACACCTATGAAGGTAGGCG
ACCCATCCAGCCCCGTTTCCACCATGCTGGAGGAGACACCACGCTACCCAACCATTTTCA
TCATCTTCTGCTCCTTCCAACTCACTCCCCAGGCTTAGGTCATCTTTCAGGGAGCCTTGT
GTCCTCCCTCACTCTAAGGTACGAGAGCATGAGGCACCCGGATGTACTGGCTGTTTACAC
TGCACGGAGCACGGGGCCGTGTGTGTGGCTCCCAGCTCATCCCTGGGTCCTTCCTCGCTG
CAGTCCTAGGCTCTGATGATGGCTACAAGCCAAATGGTCACGGACAAGCCTGGTCATTAC
ACTGCCTCTTCCCCTTGACTCACTGCAGACCCGACCGGATGAAATATTTGGTTTCTTCAT
CATTAAGGAGGCCTAATGTTTTCCCACCATTTGACTGACTGTTAAATGAAAGCCGGGTCC
TCTGGTGTGTGGAGTCGAGGAGGGGGAGGGGGAGGGTTGTTTGTTTGGTTTCTTCCAGCG
TGTCATCAGGGATCAATTCATCCCTGGCCTAACTCTATGGACAAGGTACAATACTTAGCA
CTTCCCTCCTCCTCTCCTTTGTCGCCCCTTCCCTTCCTTGGTGAAAAGGTTGCTCCCTCT
GATGTCCCCAAATACTCTGCCTGTATGCGAACTTGAACCAGTACTTCAGGCTGCCAGAGA
GTAGGGCTCTGAGAAATAGGAACAGAATACGTTTCAAATAGGTGGAGGTCCCTGAACCGC
CTGCCCGTGTTAAGCTGAGAAATAAGTCACAAAACATAAACCACATAAACAGAGCCACAA
CCCCTTCCATCTCGAATGAGTTACTCACAAGCGAAAGAAACGTTAGCCGACGAAGCATTG
CTGTTACTCTAGGTTGGCATTAGCAACACTCTATTGTTCTGGAAACACTTTTCCCTCCTA
CCAACTCATTTCGTTTCCCATAACCATACGCCAAGGAAGTAACTCCACGTTGTTAAAGCC
TGAGGTTGAGGCCGGTGAACTCACAAGTGTAGGTCGTGTGCTACATGAGGGACATGTCTT
TCAGTAACATCACAGGGGACTCTGGTCCAATGGGTGGAGTTTGATAGTTCTTGCTACGAG
GCCTAATAAAAAAATGTATAAAATAAATAAAAATGTAAAGATCTAAAAAATAAAAAGGAA
GTAGTAAAGGGATTGTTCTCATTTCCCCTTGGCAAGTGGAGAACTAGCAGATTCATTTCT
TGAGGTGGGCCTCTGCAGACAGCCTTTGCAATGAAATCCCTAGTGTAGTTTCTGAGAACC
CGAGAGTCAAGAAACGGAAGATGAGGTATAAAGTTGGTATCAGAGAAGACTAGAACTGAG
GGCTTGCCAGCTCACCTTTCTCTGATGAGCACGTATTCCTAGTGGGCCACACGAGATCCG
CTGAAACAAGGCAAAATTCTTTAAAACTCCTAACCGCGAAGCCGGCGAGGCAGAGGGGAT
AGCCCCATTTTACCGCTGAATAAGCTGAAACAAGAAAGGTCGCTCCGTGGCCGGCAGAAA
TCGCGCCAAGAGCTGGCCAAGATGGAACTAGGAACAATTTTGCCCAAACAGCATGTTCTT
CTTCTTTGTAGCTAGAGTGTAGGGTTATTTTCCATTTGCATGCTAGACAGGAATGTAACT
CCCACGAGAAGGAACGAGAATTGCCCTTGACCTGTCCCACTGTCTGTCTGGAAAGCTGAG
AATATAAATACACAGATTATGGTTCATATGCTGGGCTTGCGCTGAGAAATTCACGAACTC
TACTCTTTGCGCTCCGAGCTTTGCATTCTTAACTTCCTTCACATCGGCAGGGAAGTGGAT
GTGGTTCTCTCAGTGGATCCTCACAGTTACAGCTCATTCTGACGGGGCACCATGGGGAAA
AGAAAACGGGAAGAGAAGTGGCAAAAGGACCAGGATCCTTCAGAGCAGCGAAGACAGGGC
CACGTCTAGATACTAAAGAGTAACTGTAAGAGAAGTACAATGAACAGTCCCCACCCATCC
ATCTGATCGCCAACTCAGCAGCCCTCCATGACAGTTCTCAGCTGACCTCAGCTTGAGGGA
CCCGGCGTGAAGCCCATCAACACTGTGGGCCTGCAGTCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved