Felis_catus Locus Mono:106:SNORA42
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:106:SNORA42
Felis_catus
Mono:106:SNORA42
GeneScaffold_403
SNORA42
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTCTGTCTCTCT
CTGTCCCAAAAATAAATAAACGTTGAAAAAAAAAATTTTTTTTTTTTTAAATAAAAAAAA
TAAAAAAGTTTTTTTTTTTTAAAGCAACTGAGTATTGTACTCGGTGATGGACTGATGGCG
GGCCCTTCTCTGTGGGCCTCTCACAGCGTACCCATGCCAGAGAAGTGTGCAGCCCTGAAC
CACTGCCCTGCCTCCTGACTGATGGGCTGTGAACACTGACGGGGGCTCTACAGTTGATTA
TTCAAAGCAAAAATATCAACGTGTTTTGGGACACAGAAGTAAAAATCTATGACAACGATA
GCACAAAAGGGGGAAAAAGGATAGGAATATATTATTTTAAGGGTCTTACGTTATACATGC
TAGGTGATGCCCTGTCTGGGGTTAAAACAATTGGCCAGAGACAATCCAAAAGGTAATCTG
TTCTTAGAAAATCAAGCTCCAACGTCATGCTATATTCTTCAGTAACCAAAGACAGAGGAA
GGAGTTTAGTTCTTAACTAATTACTACTTTAGGGAAATGGCAGTCAGGTAAGATTTAAAA
AGATTTCCCACTATCTCCCTACAAAACACTTACTAGTTACAAAAGGAAAACGAGCACCTT
TACAGTCAACAAGCCCAGCAGACACAACCTTAACAAAACGTTCAAAACGGGATGCTTAAA
ATTAACATCACCAGCAATGAGACCAGCAAAACCGTACACCACCCAGGAGACAAATAAGAA
CACATTTCTCTAACATTCCGGCCTAAAAATACATAACCTCAATCTTACCACAGGGAAACT
TCAGACAAACTCAAATTAAGGAATATTCTACAAAATAACTGGCCTATAGGGGCACCCGGG
TGCCTCAGTGGGTTAAGCGTCAAACTCTTGATTTCAGCTCAGGACATCATGTCACAGTCG
TGAGTTTGGGCCCCACATTGGGCTCCATGCTGACAATACAGAGCCTGCTTGGGATTCTCT
CTCTCTCCCTCTCTCTCTGCCCCTCCTCTGCTCATGTGAGCGCACACATTCTCGCTCTCT
CTCTCAAAATAAATTTAAAAACTTAAGTAAATAAATAACTGGCTTGTAATCATCAAGTGT
CAAGATTGTGAAAGTCAAAGAAAGACTGAGGAACTTTTCTAGACTGAAGGAGACCAGACA
GACATGAAATTAATGCAACATATGATACCAAACAAACTCTTTTTCCTATAAAGGGCAGTT
CTGTGACAACTGGAGAAACTTAAACAGGGTGGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved