Felis_catus Locus Mono:73:SNORA62
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:73:SNORA62
Felis_catus
Mono:73:SNORA62
scaffold_108987
SNORA62
1001..1154
2103
AGTTAGTATAGCTGAATCATGAGTATTACATATAAAAGCAACAAAACAGCTGCTGAGAG
ATGAAGGCAGACTGGCTAGGGCGCTCAGGACCAAAGGAAAACATAGCAGTGAGTTCCCTG
GGTTTCCTTTCTGACTGTGCTCCAGTCTGGGTCCTGGAAGGCCATAATACAGAAATGTCA
AAGGGCACAGACAAAAATCCCAAGAAAAGTCTGCTCAAGGAACCAAGGCAGGAGCAGCTG
AGCAAGACAGGAGACTTCTAGACAATAACTGCTCTCCCAGTGAAACACCACAGAAACGAC
TGTGGTCCCAATTCCCACGCTCTCCGGCAAAGGCTGTGGAGAACCTAGACTTCCACACTT
GCCAGGCTGTAATGAGGCAGCGTGATTCTCTTTCCGCCATCTCACTATTGAAGTGGTGTC
AAAAGAGGTCAAGCAGGGAACCTGGCCTTCAACTCTCCTCTTGGCAGTGAGAAGGCAATG
CTTTCCCTTCCCCAGTTGTGGCCATGTGAGAGGAGGACTGCCAAAACATTAAGCTAGAAA
TAAACTCCAGGGTCTTCTAAGACCATAAAGGTCCAGGTCCAAACAGAAAACCGCTCGTCT
AACCAAGAGCCAAGAAAATCACAACTTGAACAGGAGATGAATGATGTCGGGTAGCATCTG
ACAAGGACGTAGAGATCATAAAAATACTTCAACAAGCAATGACAAATTCAAAAGATGAAA
AACAAATTTAAAAGATAAAAAAACCAGAAAAATCTCAGCAAAGCAATCAAAGTTATAAAA
AGATCCAAATTTAAATTACAGAAGTGAAAAACAATAACTGACCAAACATACTCACTGGAC
ATTCTCAGGAGCCCAGTGGAGATAGAATCAGTGGGGTTGAGGACAGATCAATATAATTTA
CCTAATCTCAACAACAAAGAGAAAGGAGACTTAGACTCCAGAGTGATGGCCCTGCCCACT
GTTAGAGCTTGGAGTTGAGGCCACTGGCTGGCCAATGAACTCACAAGTGTAGGTAGTGTG
CCACATGAGGGGCAAGTCTTTCGCTACCACCACAAGGGTCCGTGGCCCAGTGAATGGAGT
TTGATAGTAATTCTTGCTACAAATAAAAACAAAAAGAGTAAGGGCAGAAAAAGGACATTT
CCTGATTTGCAAAGGGTCAAAAATTGACATCTTACGTACTGTTTGTCTGCTGCAAAAGAG
ATGCTCTAACAAATCAGAAAGTAAATCAAGAAAAAAGGAAATATACGTCGCCAGGGATGA
GATGAAGGGAATTCAGACCGTGAAGGACAAAGGAAACACAAGGGATAACAGCTGGGCACC
GAGTCCAGAGAGCAACCAGTGAAGATTGGAGTAGGTAGAAGCAAGGCTTTAAGGAGGGAG
GGATGTAAACTAGAAAAAAATGGAACTGACAAAGATCTGATAGGTCTGCCTGTATTTGGA
GAATTTCTATAGGTTTCGGGGAGAGTCTGAGGATGAATTAGTACTATGTGATGTGTTTTA
AAGTTCATATTTTAAATTTATTTTAACAGCTTTTGGATTTACTTTCTAAATCTGTTTTCT
ATTTTATAACATTAAAATAATTTTTTTTAATGTTTATTCATCTTTGAGAGAAAGAGACAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved