Felis_catus Locus Mono:30:SNORA71
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:30:SNORA71
Felis_catus
Mono:30:SNORA71
scaffold_5321
SNORA71
1001..1131
1522
AGGCTCCATGAGAGGTGTCTTACAGCCAGGCGCGAGGCCACAAATGCCCCGAGGTAAGG
TTTTGGAGCCTTCTCTGGAATTGTGTCTTTTTGCATCCGTAAAGTCACACACGTGTGCCC
TGGGGTCTGGATGAGGCAGCGAGATGAGAGTGGGCATCCATGAGTTCCCAGTTGTGTCCT
GGCTGGGAGGCAATCCCCCACATAGTGAGGGGGCGGGGGGGGGAAGGCCTCTAGAAAGCT
GCGCTGGTGAAGGGCTTCCTTCCTGGTGTCAGCACCGTGCTGTGAGGGAAAGCCTGTAGA
TTTAGGCACCAGAGACCTTGGTCCAGTTTCTGAGGCATGCATGTCTGGCTTTGTGAGCCA
TCCTTCCTGGCGCTCTTTCTGTCCTTTTCTGCTCCCGTGTCTGAAAGTGACTGCAGGCTG
CCTGTGCCTTGGTCATTGGTAGGGCAGGGAGAGGAGTCACCGAGAGAAGTTCCCGTGTTT
GAAGGGTCCAGCCATCCTTTCCAAACCCTGGAGCTTTCCCACACTAGCTTTTCACCCCTG
CCCTTCCCTTCTGAGCTGGGGCCTCTGCTGGCCCCCATGTGAGGCGGTAACTGGGCTAGC
CCCCCGACCTGTGGGGGCTCATTCTGTCTTTCCACGTTACGGATTTTCTTGTCAGAAACA
AGCCTACCTTTTAATTTGGACTTCACACTGGAATAAATTCACATAGCGCCCGAGGGCACA
CGTAAGAATTGGAAATCGTGGCTTTTGCTGTTTGAATTTACAGGAGCCGAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved