Erinaceus_europaeus Locus C15orf42
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus C15orf42
Erinaceus_europaeus
C15orf42
GeneScaffold_4424
SNORA3
16520..16646
30598
TGCCGGTCCTTTGCGCTTTGCGCCACCTGCGCTGAACCTGCTGCGCTACAGCCCGACTC
GCCCAACAAGGATTTTTAAAACTATCATGATGTACAGAAGTTATTCTCGCAAGTTGTGCA
GTGTTTCTTTGGGGCTGCACCGAGCTCTGAACTCCCTCTCCAGGCCCAAGGTGAGAGCTC
ACCTGGGAGAGGGAACCTGCCTCGCCATGCGGGACACCTGGGTTCGCGCTGCGGAGCTGC
GGAGACTTTCCTTCTCTCTCCCCCTTTCTTTCTCATTCTCCTTGGTGCGATGAAGCCCCG
GGAACAACATGAAATCCTGCCCATTCCGGTTCTTTTCCATTTTTCTGCAGCTAAGGAAAT
GTCTGTGACAGACATCTATGGTTAACCTTTCATCAGAGAAACGCCTAGAAATCACTGAGG
CAGAGGGAGGGCACTTTTCACTTTGGGCACTGTTTTCTTTCAGCTACAAGAAGTTTAAGC
CTTCGCCATCAGACTCTGTGGAAATTCTAAAGTGCTTTTTCAACCAAGGTACACCACAGC
GATTCTACTTCCGGTACTTTTTACTTCCGGGAGTTCAGGAAGAGTCATTATCCCAGCACT
GGGCAGCGCGCCCCCCCCCCACCCCCCGCGCGCCTGCGCAGACCCGCCCCCAGGCGCCCC
GCTAGCCCGCTCGGAGAGACACGCCCCCTCAAGCTCCATCTCTTTAAATTTTAAACCGAA
GCTCCGAGCCAATCAAAGACGACTTTCTGCGGGACCACAGCGCCCCGCCCCCGACCACGC
CCCCACGATGACACAGTGGTTGGCCTCCGCCCGCTCTTCCAATCGGCGCCACGGAAGGGA
GGGGTTCTTGTAACCTACGAAAGGCCGCTGGCCAATAGCAGACGCTCTGAAGTGAGCTCT
CGGCCAATGGCAGCGGCCGTGGGAGAGCGCGGGAGCCATAGGAGAGAGCAGAGCCGACCA
TGGCGCCGGAAACCTGAAGTCCGCTCGGGGTCCGGCCCGGCATGGCCTGCTGCCACCGCG
TCGCGCTGCTGCTGGACACGGCGGGCGGCCGGGACGCGGGCCGGCGGACGGCGCTGCGCC
TGCTGGCCTACTTGAGCTGCCGGTTGGGCTTGGCGCGGCTGCGCTGGACCTTCGCCTTCT
TCGACTCACAGGGCGCGCGGGGCCGGCCGGCGCGCGGGGCCGACTTCGGGGAGCTGAGCA
CCCGCTCGTGGGACTCCTTCGAGGCGGCCCTAGAGGCTCGGCTCTTCGGCCCCGGGGCGC
CCCTGCCCGGCCCGGAGCCCCGCGCGGTGCACACGCACGAGGCGCTGCTCCAGGCGCTGC
TCGATCTGCAGTGGGACCGGCCCGAGATCGCGTCCCCGGCCAAGCCCGCGCGCAGGCCGG
GGCGGCCGACGGCTGCTGGACGCCGAGGCGGAAGGCTGGAAACCCCCGCCGCCCACCCCG
TCTTTCCTGCTGGAGCCCTGTCCGCACTCGCAGCGCGAGATACTGCGCATCTTGCCTGGC
AGCGAGGCCCGCGCCCCGGGCGCCCAATCGGGAGCAGCTGATGGACGCTAGCAGCCCCGA
TGGGTGCCTGAAGACCTAGGCCGTCGACAGAATACCCGCTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCAGGCAGAGCGGCCCACCGTGCCCAACACACCAACACC
TGAAATAGTCATTTTAAGAAGTGTTTACACTGAGGGAAAACCAGAGCATCGTCGTTCCAA
TATGTGCGGTGCAGGGGGTGGAACCTGGGACCTTGTGCGTGCTAGCCCTGCACGGCCATC
TCTCCTGCAGCTGCCTGTTTCTATGACAGAACAGAGCCGAGCTCAGGCATGCGATGGAAC
AAACGGGATCCTCCATGTTAAAATTTGTTAAATCGGGTGTTGTAACCCAAACACAACGGA
GTGCCGCTCAGTCTGTGATAACTGATAGAATATCACTGACTTTATGCTAACCTTGTGTTA
TATCAGATATCAGCTAGAATTAAATCTTAGCTGATGGGGATTTGATTTGGGTTTTCGTTT
GTAATTTTTCTTTTTATTATCTTTATTTGTCGGAAATCGAGAGGGAAGGGAGAGAAAGAG
AGACACCTGCATCACTGCGTCACCATTTGCAGTTTCCCCCCTGCAAGTGGGGACAGGGAC
TCAAACCTGGGTCCTTGTGCATTATAGCATACGCACTCAACCAGGTGCGCCACCAGCAGG
CCCCTGGTTAGTTGTTCTTTATGTGTCACCTGGAAAGCCTTTTTTTTTTTTCTCCCTCGC
CTGTTTTCAGAGTAGCACTAATGTCAGTTCTAAGGTTCCCCCCTCAGAGAAGAAATGTCT
TTCTTCTATGAGGCTTCTCTTCTCAGATCTGCTATTTTTGTTTCCCCTAAGGAAATACTC
AGGAGACCGTCTTAATATTCCTCTAGATTTTTTTTTTTCTTTCTGGTACAGATGGCCTTT
TCCTACTCAAAATCCAAGTGGAAGCAGAGAGGAGCCTTCTGGTCTGCCCTGGGAGTGCTC
TCACCCCACCCCAACTTTAAGATCCTAGAAGACAGGTTGTGTCTCGCTTGTTCATGGCAC
ACAAAAGTGTCTCTAAAAGCTTGTCGAAGTTGACTTGGAATGAAGAGCCAGCTATGTGAG
AAAGCAGGAATTCGACTAGGTGCCGAGGCATGCTGGTCTCCAGTGGTGAAAGGCACTGCG
AAAATGGGGAGACATCATCAGTCGTGTCTAGAAGGCAGGGATGAGTGGGGGGAGGTGGAA
GTTCCAGAGTAGCAACATGATCAGATAAGTGATTTGGAAGAATACTGCTTAGAGCAACTT
GGAGGAAAGATTAAAGGCAGGGCACAGGCTTGATGGACTACAGTAAGAATCCAGGTGAGA
GGTGACCAGGGCTTTGCTTAAAAGGGCTTTTACCCAAAAGACGGGCCAGTGAGGGAGCTC
AGCCTCAGAGCATAGCTCTTACACTCCTGAGGCCCCCGCTTCAATCCCTGGCACTTATAT
GCCAGAACTGAGTGGTCTGCCCACTCATCCACCCCAGAGATTTGCATCTCTTCTGTTTCT
TGGCAGTAATATTTTGCCAGAATAGAATGTTCTTTTCACTAAGTCGATAGTTTCTTGTGG
GCTTATCTTAGCTTATCTTCTTGGGCTGTATAGTGAACTAGATGCTACTTGTGTTTGGTT
TGACAAGGACTTATGTGACTCAGTCCTCTCAGTAGTTACCACCTCTTCTTTCCCCTTGAT
TTCCCTCCACTTTATTTGTGCAAGCCCGGTCTATACTAACCTGAGGTTCTCTGTCATTTT
TATTTCAGTTGAAGGACTCCCCAGACCACCTGGGCTATTGGTCAGTGTGTGAGCTGCTCC
GCCATGTCGGAGGCACCGTCTTGCCACCTGAAATGTTTGGCCAGGATTTTACTAAAACTG
CGGGATCCCTACTTCAAAGCGAGAACAAGCCATTCGGGGAGCCTCACCTCTCTTCCTGGA
TTCCAGCTCTACCCAGTGACTCTACTTTAACTCGCCTGCTCTATCACTCTCCGCAGTATG
AGGCCTCGTTTCCTCGGATGGAAGGAATGTTATTTCTCCCTGTGGAAGGTAGGGAAGTGA
CATTTGGTTGGTCTTTTTTTTTTTTTTTTTGGATGGATCAACAGCTTTATTTAGTTTGTT
AGAATCATAGAAGAGAGAACCAGACACTCTGGTATATGTGCTGCTGGGGATTGAACTCAG
GACTTTATGTTTGAGTCTGATGCTCTATGCTCTGTGCCACCTCCTGGAGCCCTTGACTGG
CAGGCAGCCTCATTGAAGCAAGGTGGGACCCCCCCCCACCCACACACACAGACACACCTG
CGGTTCTGACAGTCGCAACTTCCGGTTCGGGGCATCAGGGGTCCTGCGATTTTCTGGTCT
CGTTTTTTTTTTAAGGCAGGCCCAGGCCCATGTTTTGTTTTGTTGTATTTTTGTTTTTCC
TTACCAGTGTCCTGCTCAGCTCTGACTTATGGTGGCTTGGGGGACTGAACCTGGGAGTTT
AGAGCCTTAGGCATGAAAATCTTTTTGCATAACCATAGGGGCTTTTAACTTTAGAATTTC
CTGCAACAAGATTCTCAGTGCTTGAAAGACTTTGAAAGGGGTCAGGGCAGTGGTGCTGTA
GTAGTGCACAAGACTTTCATGTAAGAGGTCCTAGGTTCAATCCCTTGTACCACTCATAAC
CAGAGCTGAGAAGTACTCTGATCAAGAATAATAATAAGTAAAGTAATATATGTGTGTGTC
TTCCTCTCTATCTCCCCCTACCCTCTCAATGTCTCTGTCTGTATAAGATAAATAAAAATT
TAAAACATATATTTATTGATTAGTGAAAGAGAACAAAGCATCACTGTGGCTTGAACTCAG
GACCTGATGCTTGAAAGTTCAGCACTATCCACTGTGCCTTCTCAAAGGCCTCAGGATACT
TATTTCTAAGTCAAGATTATTGGGAAGTTGTCATAGGGAGGGATTCACGGTCATTCCCTT
TGGGTACGGTTTTCCCTGTAGAAAGCTAAGTGAAGTTGTTAGTAGACTGAGGTGTGATGA
AGTGACAGTAGCTAGTCTGTCAACTGATAATCTGTTTTCTTCCTGCTTTTCCATCTGCTT
TTAATACATCCTCTCTGGCGACTTTAATAGTCTCTTTTTCTAACAGGCAAAGAAAGCCAA
GAAGCGTGGGCAGTCATCCTCGAACCCTTAGCCATGCAGCAGAGACACTTTCCAAAACCT
GTCCGGATCTTTCTAAAAGGCACGGTGGCCCCCTGGGCACCGCCGACGAGCAGCACTCTG
GTCACTGAGAGCTGGATGCTGCACAGTCCCGACAGCAACAGGTCGGCGGACAGGCTGCTG
TTCCAGCAGCTGGTGGGCAGGCTGACGGCAGAAGAGCTGCACCTGGTAGGTGGCCTGGCC
TCCACGTGAGAGCCCACTGGCTGGGTGAACTCCGTGCTTCTTAAAGTGCCAAGTGTTGCC
CGTTGTCACAGTGAACCTGCCTCTGTGTGTGCAGATGATGTTGCCTATATTGTAGTGTCA
CAGCCAGCATGTTCAGTAGTGAAGAGACAGTCTGTAAAGTCTATGTCCCCTGAAACCTCT
TTGATTCACACAGGGAGGGGGAAAAAGGCAGTGGGCTATATGAAATTAGGATGGCAAAGT
GATTGATGGATTGACTTCTCATTCTTAAAATTGTTAATATATTTATTAGTTTTATATAAT
TTTTATTTTAGAAAAGAAACTGACTACACTGTAAAATTAGGTGAATATTTTGTCTGTTGG
TTACAGAGATTCCAAAGAGGTTCTTGGAAAGGAGCCTCTCACACCCAGATTTGAAGTAAA
GGTGGCGGCTCCTTTCAGACATGCCTGGCTCCTCCCTTGGCTTTAGTTTTGGCCTTCATA
GCTTCGGGGCTGGGTGTCTTGTGTAAAGCACTCAAGAGGGAAGCTGGTGGTTGTGTGCCC
TGATAGAAGGGCCGGGTGAGGCCTCGAGGGCCTGCATTAGGTCTCTTTTGTGTCCCTTGT
TCTACCCGAGCACATCCCTGAATAGACACGTTGCCTCAGGAGTTTCGAGATCAGCACTTC
TCCTTGCTAACTGGGTGACCTTCAACAGATTACTTATTCTTCAGCCTCATTCCTCCACTG
TCGAGTGGTTGCAGAGGCTCCCATGAGTCGTGCTTGATACTGTGTGATCCTTGATCAGTG
ATCCCGGCAGCCTTAAGTTTTTCTTACTTGTCAATCAAGGAATGACTGTATGATCATAGG
CACTGCTCTGGCTCTTCTTCTCTCTTTATCTACTTATTGGACAGAGACAGGCAGAAATCA
AGAGAGAAGCGGGCGGGAGAGAGGGAGAAACATAGACACCTGCAGCCCTGCTTCACCACT
CCTGAAGCTTTCCCCCTGCAGGTGGGGACCGGGGGCTCAAACCCAGGTCCTTGCATATTG
TAATACGTGCGCTCAACCAGATGCGCCACCACCCAACCCCTGCTCTAGCTCTTAAAGCCC
ACCTCATTTTATCATTTCTCTAGATTGCTCTTAAATGAGTAAGGGTGACACTGGCCTTCT
GTCTTCTGTTAAGCTCCATTCTTCAGGCAGGTGACAGCAATACTTGCAGCTAATTAGAAC
TTCTCCTGTAGGTTGCCAGCGTGGACCCTGGGGAGGGCTGGCCTCCGCTCAGTGGAGTGA
TCTCCCCGCTCTCCACCACGGCTACGATTCTCACTGTGTTCTGCACAGAAGAGTCTGGAT
CTCAGAGCCATCTGCACCACACAGTTGTGGCCGAGGGCTCCCAGGATGCAGCTTCTCTTT
TCTCCAGTGTTTTGGATGTTGTGCTGAGTCAGACTCACAGTCCGCTGGAAGATTCTTCTC
CCTCGGGTGAGCTTCTGAGCCAGTAACTAGCATCACCCTGACAGGCTTTACCAGCACCAG
AGCTGTTCTTTTCCTTAGGTGTTGAGCAGAACCCCAAAATCTGCTATAGGGCTGACAAAG
CCAGCTACAATACTGAAACCACTTTGTGGTCAAAAGTATGAGATTTTGGGGGGGGGGGGC
TTAAATAGCATAATGGTTATGCAAAGTGACTCTCATGCCTGAGACTCTGAAGTCCCATGT
TCAGTTCCCTACACCACCATAAGCCAGAACTACTGAGCATGCTCTGATAAAAAAAACACA
AACGTATGAGCCTGAGTTTTAACACAGTACTTAGTAAAGGTAGTAGGTGAAACTGACTGG
CTGCTTTCTAATGTTCTGACTTGTTACCAATTTGCTACCTACCCCTTTGTGGTATGTGCT
AAACAGGTCAACATACCTGTTGATGATGCAGTCATTTCTTCAGCAGATGCTTTGCTTGCC
TGCTTTGTCAAGCACTGTTCTGGGCACTGGAGATAAGTACATCAGGAAACAAAGCAGACA
GATCTGTTATCAGGGACTTGATGGCTCTTGTCAGGGAAGTGTGTTAAATCAGGAGACGGG
ACAGCATATTTGCAAACCCTAAGTGCTGTAGCACACTTCTCACTGCCTGCAGAGGCCTGT
CACAGCTGGTGATGCCAATGAAAGGAGCTGCTAGTGATGTCATGTTGGGGGTCCACCAGC
CTGGAGGGGAGCAGTGCTTGAGTTCTGATGTCTCTTACCCTTTCCCTATTTGCCCCCTTT
CCCCCTAGCGCCCCCAGTACCAGAGTGGGTTCAGCAGGAGCTGGGCCGCACAGCTCCCTG
GAGCACGGCTGTCATGGAGACCTGGTTTCCCTTCTCCAATCTCAGCGGTGCCAGCTCAGA
GTTGATGGAGTCATTCTGGTAAGATTTGAACAAGTTTCTCTGGGTCTTGATTATTGAGAC
CAGTTCTCAGTTGTCTGTACATGGGGTGTTTTATTATAGTCTATTTGTAGAGAAACTTTT
TATTTGTTGTTTTGTTTTATGACCGTGAAAGAGACTATGCCAGCCAAATTTCCTTCAGAG
CAGCGGGGGGCTGAGTTTCATCCTGGGCTGCACACATGGCACAAAGCAGCACACTATTCA
GATGAGCTATTCTGACAGCCTAGAAACTGGTTTGCAACTTTTAAAGATTGACTTATTTCA
TGAACAAAAGACTACCATAGCACCATACTGGGCTTATGCGGTGTCAGGGTTCAGACCCAG
GGCCTCACACATTCAAGGTCTTATAGTCTACCCACTGAACCACCTCCTCAGCCTCAACAA
ACAATCTTTTGAAAAAGAAAAATTAACCCAGAAGGTGGCATAGTGGCTAGATCTTTGGAC
TTAAAAAGCATAAAGCTCTGAGTTTGATCTCTGGCATCACATGAGCCAGAATGATAGTCT
GGTTCCTTTTCTCTCTTTTAATATTTTATTTATTTATTAGTGAGAGAGATAGGAGGAGAG
AGAGAGAGAACCAGACATTATTCTGGTATATGTGCTGCTGGGGACTGGATTCAGGACTTC
GTACTTGAGGGTCCAGTGCTTTATCCACTGCACTACCTCCTAGACCACCTGTCACCCTCA
TTTATTAACAAATAAACATTTTTTTAAAAAAGAAAAAGACCAGTGGTCCAGGAGGTGGCT
CAGTGGCTAAGGTACTATATTCTCAAGCATGAGGTCCTGAGTTCAGTCCCCAGCAGGACA
CGTACCAGGGTGATGTCTGGTTCTTTCTCTCTCTCCTATCTTTTTCGTTAATAAATAAAA
TCTTAAAAAAAAAAAAGACCAGTTAGGCAAAGGTTCAAAACTGGAAATAAAATAGGAGAA
TCTTTCCCTAAAAATGAAAGATAGTTCTTTGAGAAACTAAGTTAAATAAGTTAAATTTGA
CTTTTTTTTTTTTAAGAAAGACCTAGGGAGATAACCTAATTATTATGCAAAAAGACTATA
TGTGTGAGGCTCCAAGAGGTGCTAGGCATAATACCCAGCACCTCTATAATAAGCCAGAGT
TGAGCAGTTCTCTGGCTAAAAAAAAGGGGAGGGGGAGGAAGGAAGAAAGAAAGATAAAAA
TTAAAAAAAAAATAGTAGCTTACAAAGATTTTCTATTCGTATACAATCTATATCTGTACA
ATACTTTTTAAAAATAAACCCAGTAGAGAGTCGGGCAGTAGTGCAGTGGGTTAAACACAC
GTGGGTGCAAAGCCCAAGGGACCGGGAGTAAGGATCCTGGATCAAGCCCCCCGGCTCCTC
ACTTGCAGGGGGCTCACTTCACAGGTGGTGAAGCCTGTCTGCAGGGGTCTTTCTCTCTCT
GTCTTCGCCTCTCCTCTCCATTTCTTTCTGTCCTATCCAATAACAACGAGCTTTATAACT
ACCAGCAATAGAGCAACAAGGGGCAACAAAAGGGATAATTAATTAATTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAAG
AAACAACAAGGGCAACAAAAGGGAAAAATTAAATAAGTAAGATATATATAAAAAAAAATT
TAAAAGAGAAAGAAAAAGAAACCAGGCAAGTCACAAGAGTAAATTCAATAAATAAATAGT
TTGGAAACATAAACTCAGTTTAAATAAATGGCAATTAATACCAGAATAAGAAAAAATCTT
ACAGGATTCTTTTTTTTTTAATATTTATTTCTTTATGCCCTTGTTTTATTGTTGTAGTTA
TTATTGTCATCGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAAAGA
TAGACACCTACCGACCTGCTTTACCACTTGTGAAGCGACTCCCCTGCAGGTGGGAAGCTG
GGTTATTGAACCGGGATCTTACTCTGGTCCTTGCGCTTTGCACCCCCCCCTGCGCTTAAC
CCACTGCGCTACCGTCTGACTCCCAAGATTCTATTTTATACCTATTAAATAATCAGACCT
AGTCATAACACACATGGAAATGAGAATATCTGAGTTAAGTATTATTTATTAGAGAAAGAG
AGAGACCAGAGTCCCATTTTGGCATATGTGATTCCTGGGGATCGAGCTCAGGACCTTAGA
GCTTTGCCCCTGCACTGTGCCTAGGGCCACTGGACAAAGTCAATATTACTACATGTCTAA
TGGTTTTGTGAGCAGGTAGCTTCTGGTCCTGAATTTGTTCAAATCACAGATGCAAGGAAG
AACATCTCTACTGAGAAAAAATACCTGAGCTTTGCATGTGGAAACGTCTTCTGCTCATTC
CTTTGGGCGCAGGATATATCCTTACATGCTACATTAAGAAAGGAGTTCACAGGGCTGCCA
ACCTTACAGTAGAGGTTGAGTAGTAGTATATTTCTCCTACAAAAAAAGAAAAAAAATTTT
CATAAGCTATCTTATGGGTACATCTTTGGGTCCACTTTTAAAAGGACAATCTGTCTTGTG
GCTTGTTTTTAAGGCATTTTGGAAAATCAGGATTACAGTTTTCTAGCTGACCTCTCCACT
TGTTCACAGGTTACTTCAGGCTGCCCCATCTCAAAAGGAGGAGTCTTCCGGAGCTGAGAG
TGAGTTGACACAGGGCCTCTCCGAGTTCTACCAGAAAAAATCTCGCGAGGAATCCACGGT
GTCCAATCAGGATGACAGCAGAAAGAAACGTATGTGTACGAAGTCCATTTCTTTGGACAG
CTTGTTTTGAGACTAAGTTTTAAAAGGTTGATCTTCTCTAAAGCAAGGGTGAAATGGTGA
CCAATTGAAATCTTATATTTTAATATTTTTAATATAGCTCCTTTTGTACAATAATGACCT
TCTTTATTGTCACCAGGGTTATTGCTGGGGCTCAGTGTCTGCATGATGAATCCACTGTTC
TCTCTCTCTCTCTCTTTTTTTTTTCTTTTTATTTGATAGGACAGAGAGAAATTGAGAGGG
AAGTGGGAGAAAGACACCTGCAGACCTGCTTCACCGCTCGTGAAGCTTCCTCCTGCAAGA
GGGGACTGGGGGCTTGAACCTGGGTCCTTGTGCATGGTGACGTGCTCAGTCAAGTGTGTC
ACCACCTGGCCACTTGTTTTCTAGTTTTACTGCTGTCAGTAGCACATCATTCCTATGACT
TACTTTTTAAGTGATTTCCATAGCGTAGATTTCCAGGACCAAGATATTATTGTAAAAATA
TGCCAGAAAGGTGACTCTTGATGCTGGATTATTTTTCAGAAGTGCCATGACGGCCCAATG
ACTACTGGTTAGCGCCACCATGTGTCTTATTTGGCATGTGCTTGGTGTAAAACGCCTGTT
GATGCTGAAGTGGCTAGTCACCACGTTCCAGCTAAAGAAAGAGCTCTCTCCCTACCCTGC
TCTGTAGAGCTCACTCAGGCCAGAAGGCGTATACCAGGACTCTAGCTCAGAGCGTTCACG
AGAGGGAGGTGTCACTTCTCTGCCCGCCGTGCTGTTTTGGCAGGAGGCATCCCCCGCACT
CCTGTGAGGCAGAAGATGAAGACCATGTGCCGGTCCTTGAAGATGCTCAATGTGGCCAGG
CTGAATGTCAAGGCTCAGCAGCTCCATCCCGATGGCAGTCCCGACGCCTCTGGAGAGAAG
GGCATCCAAAGGCCAGTTGTGGGCAGGCCGGCAGACAGAGCAGAAGGCAGAAGGAGAACT
CTGAGAAGTTCCAGGCCTAAAGGTGTGGTCCTCGGCATCACCCCCTTTGGGTGTCTAAGT
CCATAGTCAGTCTTTAGTAGCCTCATATTTTGATGTTCTGCTACAGAGGTAGAACTAATG
AACATATATATTGGACTAGTGAAACAGATTCGAGGGCCAAGGGGAGACACTTGGTCAGTG
GTCAGGGAAATAGTAAGCCACAGGACTGGGGTGTGTTGGGCTGCCAGTTCCATCCTCAGT
GCCACATGTACCAGAATGGTGCTCTGGCTTCTCTCGCTCTCTCTCTCTCTCTCTCTCTCC
AATTCAATATTGATTTAAAAAATTATATGCCAACAGGAGTATATTCCATACTGTTCCCAC
CACGAGTTCTGAATTCCAAGTCCTTCCATTGCAAACCACTTTGGTTCTCCCAAGGTTGCA
GACATGGGATGCCTGTCCTCTCCACAACTGTCTGTTTACATTTCTACATGATTGCTCCCA
TTTTCTTCCAGGTCCATTCCTCTCTTCCCCTCCAAGCCACACATAACGCTATTACTGCAC
TCAAATATCTCTTCCCTTTTCATCCTTTCTCTCTGGGACCTGATGGAGCTCCAGTTCGGA
GCTCTTTTATCCTCTCCCTCCTATCACTTCTCCCCCACTGGGAGTATGGATCAAAGTTGT
TTTTGGGGTGCAGAAAGTAGGAGTTCTGGCGTCTGTACTTGCTTCTCTGTTGGATTTCGG
CATTGGCTGGCCAATCCATACCCCCAGCCTATCTCTATCTTTCCCTAGTGGGGTAGGGTT
CTGCCTTCTGTCTTTATCTATTTCATTGAAATGAATACAATGCATTATTGTTTGCTGTAA
TTATTATTATTTAAAGAAAATGCGTATCTATTTGGACAGTGAAGACACACTAGGGACCAA
GAAAGGGAAAATCAATTTTGGGCTTGAACAAGCTAAAAAGGTTTCATGGTCCCCATGCAG
CTCAGGTGGGACTGAAGAAGGGCGAAGAGAAACATTTACATTCAGTCACATACAGAGAGA
CAGCCACAGCATTGGACCTTCCTCTGTTGATATAATACTTCCATGTGGTGCCAGGGTCTG
AATTTAGGTTATATTCATGGCAGTTCAGGCACCTTGCTCAGTGAAGCTGTCTTAAGTCTT
AAACAGAATAAAATTAAAAATCTAATCTAACAGTTGCTACTTTTTTCTTTCTTTCTTTCT
TTCTTTTTTTTTTTTTTACCAGAGCACTGCTCAGGTCTGGCTTATGGTGGTGTTGGGGAT
TGAACCTGGGACTTGAGAGCCTCAGGCATGAAAGTCTCTTTGCATAACCATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGGGTAAGGAGGGGTTCAACCTCCCTCCAATTCCCCG
CTCTAGAACTCCCATTTTCCATCCTCTACCCCTGATAGCTATCTTTACCCTCATGGAGTA
TGGACCCAAGGTCATTGTGGGGGTGCAGAAGGTGGAAGGTCTGGTTTCTGTAATTGCTTC
CCCGCTGAACATGGGCGTCGACTGGTCTATCCATACTCCCAGCCTGCCTCTCTCTTTCCC
TATTGGGGCGGGGCTCTGGGGAATCCAGGACACATTGGTGGGGTCGTCTGTCCAGGGAAG
TCTGGTCGGCATGATTACTTAGATTTTTATCCCCCCATAGATTTCAAAACTGAGGAGGAA
CTGCTGTCCTACATACGTGAAAGTTACCAAAAGACCGTGGTGAGCAGAGAAAGCGTGTTA
CATTCATGTGCTCAGAACAGTGTGTCCACCATGAAAGCCTTCCTCAAGTCCAGAGGTGCC
ACGGACCTGGAGGTAAGAGTCTGGCTGCCGTCTGTCACTGAGAAGTGGTCAGTTGCTGGT
GGGCAGTTTTGGCTCCTGTTTCTTAGGATGTGCCTCTTATGCAGGCTGTCATTCAGAAGG
GAGAATAGGAGCAAATGGCGTGAACTTTCCTGCTTAGAACTCTGAGGTCCCTGGCTTAGT
CCCCTTAGCACCATGAGCCGGAGCTGAGTAGTACTCTGGTTAAAGAAAGAGAGCAGGAGA
AGTAATTTATAGTCAGATACAAATACACTTTCCTTTTATGACATTCTTTGTGAAGTAAAT
TAGAGATGTTAAGTAATACTCTCCTCTGTAATCATTTTATATATTTTCAGATGAGCTGCA
TCAATCAGATAAAAAATAACCTCTTGAAAACTAGTGAAAATCTTCGGCAGAATCTAGGGA
AAAAACTAGATAAAGAAGACAAAGTCAGAGAGTAAGTAACTTTTTTTTTAACCATGACTC
CAAAGCTCCATGATTTTCTTGTACCAGTTTAAGACAGATTGCCAGTGACTTGAAGATAGC
TGCGTGACTGATCTCTCAAGGTGTCCCAATATATGGTCTGAGTCACTAATTATTTTAAGA
TTTATTTTCTTATTAATTAGAGTTGGGGGAAAGAGAACACAGGAATGTCACTCTGACTCA
TGCTATGTTGGGAATCAAATGCAAAAGTCCATTCTTGAGAGTCCAATACCATATCCACTG
TGCCACCTCCTGGGCCACTATTTAGTCACTCATTAACTTAATAAACCATATTAGTACTTA
AGAAGAAGTACTTAATGAAAGCAGTGGCTTATGGTTTGGTTTTTGTTTGTTTGTTTGTTT
TTGTTTTGGTCATTGTCTCTTTTGTATTTTGATGAGAGCACTGCTCAGCTCTGGCTATTG
ATGGTGCTGGGGTGGAACCTGGGGCCCCTCATCTCACATGCAAGTTTCATGTGCCATCTC
CCTAGCCCTTGTTCTTTCTTTTTTTTACCACTTGCCTCCAAGGTAATCCTTACAACTTGG
TGCCTGCACTATGAATCCACTGCTCCTGGCAGCCATTTTTGTTGTTCTTTCGTTTTTTAT
AAGAGGGAGAGAGGGGACCAGAGAACTCTGCTCGGCTTGGTGTAAAGTGGTATCAGGGAC
CGAACCTGCAGCCTCTGGGGCTTCAGGCCTACCAGTTGGTGCTGTAACAGTCTGTACTCC
CCCTGCTCTCGTGGTTTCTTGTTTAACTAGGTCTATGCTTAGGGAAGGAGCTTTCCGTTG
AGGAACGCTCCACAGAGATGTGACCAGGTCTTTTTTTCTCTCCAGGTGCCAGCTTCAGGT
GTTCCTGCGTTTGGAGCTGTGTGTGCAGTGTCCTTCCATACAAGAAAGCGTGGACGACCT
GGAATGTGTTGTGGAGGAGGCAAGTATCCAGCTAGCGCCCTAGGATGCACTCGGCCTCCC
CACGGAGGACACCCGGTGACTTCCCCAACTCTCTCAGGTGGCAGCTCTGCTGCGCATGGT
GTGCTTGACCGAGGACTCTGCCTACGTGGCTATGTTTCTGGAGGAAATTCTGGGACTGTA
AGTTTGATGACCCCTAACTTAACTGTGATAATATATTTTGCCAAGAGTTTGTCTCACAGA
TAGGAAACTGTAAAGGCTATTTCTAGTGGTGGCAGAGGGAGAGGCGGGGCTCCTTCCCTA
CTAATCCAGATGTTCCGCAGGTACATTGACTCAGCTCCAAAGACACTCGGAAAGCTTTAC
GACAACCTTGGGTTTGTGATTCCTCAGAAGCTGGCCACTGCCCTCCCTGTAGATTTTTTC
AGTGACGACTCCTTGACACAGGAGAACAAGTCGCCCCTTCTTTCTGGACCTCTTCCATCA
AGTGCTCACCCATCGGTGCCAGGGAGCACTGAGTCAGACCAGCTGGAGGAACTGCGCACC
AGGTCAGCTAAGAAGAGAAGGTAGGAGCTCGAGGAATAGAACTACTTGCAAAAATGATTT
TTAAAATTATTATTGTTAGTGAGAGAAATCAAGCATTACTCTGGCATGTGTAATGTTAGG
ACTGAGCATGGAACCTCCTCCACGTCTGTCCACTGCTCCACCAGCAGTGCCCTTTTAAAA
AAGACTTTTAAAAATTTATTTATTTATTATTTTCCCTTTTGTTGCCCTTGTTTTTTTTCT
TTGTTGTTGTAGTTACTATTGTTGTTATTGATGTCGTCCTTGTTGGATAGGACAGAAAGA
AATTGAGAGAGATGGGGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACTGCCTGTGA
AGTGACTCCCCTGCAGGTGGGGAGCCAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAGATCCATGGATTCCCTGGTATTGTCCAT
GGTGCTCCTGTCTACTGGGACTTGAACTCAGGACCCCACACATGACAAGATGTGTGAGCC
ATCTTCTTGGTCCTACAATGCCCTCTTGGCTGCTTGCCCACCTGGGATTTCCAGGAATTA
TTGTGCTTTTGAGATAAACTTATAGTTTCTGATTACTCATGAGATATTCTGGAGGAAAAA
AAGAAAAAGATCTTGATGTTTCATTTTCATTGTTCATAACCAGATGAATTCACAATGGCT
TGTATTGGAAATTCTGGATTAACTCTACTATAAATTCAGGCCAGCCCCATGTACTAACTT
TTACTTAAATAACTTTTTCTGCTGAGGCTAGAGTCTCGCCCGGGCATGGTGTTGCCCCGG
TGTGCTGGAGTCCTCAGAGAGCAGCTGCTGGCCTTATTCGCTGGCTGTGGCCCCGTGGCC
GAGCCAGTCACCAGGCCAGGGACAGGCAGACAGGCAAAAAAAAAAAGGGGGGGGGGGAGA
TTAATTAGTTAATTGGAAAGAAAATTAAAAAAAAAAAAAAAGAAAAGAAAATCAAGACCA
TTTAGAAGCCTGCTCAGCTTGGGAAGGGATTCCAGCTCCTGGAACCTGTTCTGCTTCTGG
GAGAGGAGCGGTTTCGCTGGTGTGGACATTCGTGTCTGTGTGAAGGGCGGTGGTCACGTG
GCCCAGATTTACGCAATCCGTCAGTCCATCTCCAAAGCCCTGGTGGCCTAGTACCAGAAA
TATGTGGATGAGGCTTCCAAGAAGGAGATCAAAGACAGCCTCATCCAGTATGACCAGACC
CTGCTGGTAGCTGACCCCCACCGCTGTGAATCCAAGAAGTTTGGAGGTCCTGGAGCCCGT
GCTCGCTACCAGAAATCCTACCAATAATCCATTGTGGGGACTGGGGTTTACCTTTATAAT
AAATGAGCTTTGAAAGAAAAAAAAATAATAACTTTTTTTTTTTTTTACCAGAGCACTATT
CTAAACTCCTATTTCATCCTAACTGAAGTACTTATAGCCTTTATCAATTATATACTGATT
ATTTCTTTTTTTCCTGTTATTTTAAAAATTGTTTTATTTTTATTTATTTATTTTTAAAGG
AGACATTAACAAAACTGTAGGATAGGAGGGGTACACTCCACACAATTCCCACCACCAGAT
CTCTATATCTATACTGTTTTTTTTTTTGTTTGTTTGTTTTTTAGGAAAAATGCATTGATG
AGACATAAAAGCATTGCAGAGGTTTCACAGAATCTTCGACAAATTGAAATTCCCAAAGCA
TCTAAGAGAGCTGCTAAGAGTGTAAGTCATTTCTGGGAGGCAAAAACTGAGCTGCTGACA
TGAGCTGGTACTGTGAAAAATCAAAGACAGGGTCTTTACTTTTAGGACTTAGATTAGATG
TTTTTAGATTGTGTATAAAACAGTAATCCAGTGAATAAAGCAATGCAGATTTGTTGCAAA
TTAACCATTCTACTCAGAAGTGTGGGTATTAATCTTGATCTAGTGAAAATCAGCAAGTAA
AGGAGTGGGAGATAAACTAGTTCAAAATTCTTAATGTACTATGGAAGAGAAAGTTCATAA
AATAATCCCTAGTTTAAGTAAAGAGCCCATTAAAAAGTAATAGACAATCATAATAGGATT
CCAGGTGCATACCAGAAAGTTCTTATCAATGTGTTTGTTTTAACTGAGTGATACAGTTTG
GGTTGGGTCATTTTTATGAAGTGGTAATTATTTTTCTGTGTCCCTAATTCTCAGTCTGAA
GTTATTAATGTGAATTTTGGTCAAATCTCAAATACTTAGAAATCACAATTAGAGAGAGTA
AATCCAAAGGTGGACAGTCAAAATGTGTCCAACCTCCAATCTCACTAGATTTTTTTTTTT
TTTTTTTAACTAGAGCATAGCACAGCTGTGGGTGGTGCTAGGGATTGAAACTGGAACTTT
GGAGCCTCAGACGTGAAATTTTCTTTTCCCCCTACAGTCTGTTTGCTGTGTATTCCCAGA
CTTTTTTTTTTTTTCTTTCTGAATGTGCTAAGTAAAACACACTAAAGATTTTTGTATATC
TTGCTTACATACTACAAGTGATGAGCTATATATGCTTAATCTGCTTATCTGCTTATCCTT
CTTTTTCACTTTTTCCCTATTAGGGTTCTGTCTGCACGTGAGTGTGCATCAGTATTCACT
GTCTGTATTGGGGGGTGTCATAATATACTTGTTTTACTCTTTCTGGACACAGTGTTTTGC
ATCATTTTATTGCGGCCCTCAGTGTCCTTGGAACACTGACTTATTTTTGCGCATTTTACA
ATTATGTCTCTTAGGAATCCTACACATGGAACTGTGGGGGCCAAGGGTTTTATGTGAGTC
TTTAATTTTTTTTTTTTTTTTTTTTACCAGAGCACTACTCAGCTCTGGCTTATGCACAGG
GGAATGAGCCTGGGACTTCAGAACCTCAGGCATGAGAGTCTCTTTGCATAGCCATTATAC
TATCTACCCCTACCCTTAAATTTTTTTAAATATTTTTTTGAATTTATTTATTAGAGATAG
AGCAAGAGATAGAGGGAGACACATGCAGCCCTGCTTTACTACTTGTGAAGCTTTCCCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGACAGAGAGGGGGAGA
GAAAGATAGACACCCGCAGACCTGCTTCACTGCTTGTGAAGCAACTCCCCTGCAGGTGGG
GAGCTGGGGGCTCGAACTGGGATCCTCCCGCCAGTCCTTGCACTTTGTGCCACATGCGCT
TAACCTGCTGTGCTACCGCCCGACTCCCAGTAGTTGTCTTTCATCTTTCTACATGTTTCA
ATAAGCATAATCACCTCCAGTTCCATCCATTTTGACCCAAAGGACACAATATTGTCATTT
TTGTCTGCACCGTAGTATTCCCATGGAGTGTATATCCCATAACTTCTTTTATTTATTTAT
TCATTCATTTATTTATTTTTATCCCATAACTTCTTTAGCTATCATATGTTGCTGGGCATT
TAGGCTGCTTCCACTCTGGCTATTGTGAATAACACAGCTATGAACAAAGGGGAGTGTATG
TCCCTTTGAGCTAGTGTTTTGAATGTCCTTTGTTTCCCTTGTTTTATTGTTGTAGTCACT
ATTGTGTTGTTAGATAGGACAGAGAGAAATGGAGGAGGGGAAGACAGAGAGGAGGAAAGA
CAGACATCTGCAGACCTGCTTCACCACTTGTGAAGCGACTCACCTGCAGGTGGGGAGCCG
GGGGCTTGAACTGGGATCCTTACACCAGTCCTTGGGCTTTGCACCTGATGCGCTACCACC
AACCCCCTATTTTAATTTATTTTTATGCTTTCAGAAGTGACCAAAGTTCGGAGAAACCTC
TTCAACCAGGAAATGATTTCTCCTTCAAAAAGATCATCAAAGCGGGGGTTGCCAAGAAGC
CATTCTGTGTCAACTGTGGAAGGTTTAGACCAAAACCTTGACAACTTTAGGAAAGCCAAA
GGTACGACTGCATTTTAGGGTGATCCGGAGAAGGCGGTTCCAGGCTTGTCCCCGCACTCA
CTGTTGCAGAGTGCATTCGTCTCCTTTCCCTTGCCACCAATCCATTCTCAGTCATCTGGG
TTTGGAACCTGATGAAAATTAGCTGTTGGTTTTATTGAACTCCTTCTCTGTTACTGCTCT
TGAGCGTCTCGTTTTAGTCTTTGATTTTGCTAGCTGACCATAACGTGTCTAGTGTTAAGC
TCTGAGTTTGTTGTTCTTGGAGTTCACTGCACATGTGGATATATAGAATTCCATCTCATC
CCACTTAGGAAGCTTTCAATCATCAGAAGTTCTGTGTACCCCTTTCTCCTCCTCCTAGGA
GGTTGCCCATAGTACCCTCAGCTCTTTGTCTTTTTAATTTAGTTCAAAACCATTATATCC
ACTCCAGCTAGAAGCCACATATACACCCCAAACATTCCTTTGCCTTGGTGAGGCTAAGTG
AAGTTTGTGCTGTTCCTATCATAGGTTATCACAGACTGCTGACCAAGAGTGTGGCTGAGA
CTCCGGTCCACAAGCAGATATCCAGAAGGCTGCTTCACAGACAGATCCAGGGCAGGTGAG
CACCTTCCCTGCACTTTTCTCCCTGCTGCACAGGCTTCCTGATAATCTCGCAGGCTGCGA
TTTGTCTCCCCCACTTTATGACTCAAGGCTTCACTGCGTTGTTTAGAACCCAAGGATATT
TTATAGACTCCAGCAGGTTCAAATGTGCTCTCCTGACTGCTTCTTTTACCTGTACTATTT
CAAGATGTGACCATGTCACTTGCATGTGTCAAATAATTACTATTTATTTTGTAATTTATT
CCTTTTTTTAAAATGTAAAGTTTTTAAGTCCACTCTTCTGTTAACCCTGGGAAGGATGGG
TTCTTTATTACTGTGAGTCAAGTCTGGAAAGCTAGGAGCCCCCAACTCGGCCTTTGTTTG
GTGGGGTGTCGTGTGTCCACTGTTTTCCATTGCAGTGGGTCGGGGCACACGAGGTCTGTG
AACTTTTTGTCTTGTAGCCACCACTTTCCAGGTACTTTGGGTGGAGAGGGCTGGCTCTCC
TGCAGGTCTCAGGTGGTCTCTGTCAGCATTTGTGAACGTTCTGGGGTTTTCGACCTTATC
AGCACCCAAAGTAGGGAGCTAAGAATCATTGCCCTGTCTCCCAGGTCCCAGCCAGTCATT
GCTTCTCTCTACTTTCCAGACTTCTTAAATCTGACTTACAGTTAATGTCAGGGTGTCTGG
CTATACATGATGAAAGGAAGTGACACGCCTATCAGGATGTATTGCAGGAAGTGAAGGTGG
TGGTGCATAAAGTGTACATATTTAAAATCTTAAGACTAACAATTCTTTATTGTGCATATC
AGTAGACCTCACCTTGCTGTGTCTTGGCTTGGTGAGGGGGACAGCATATGCTAGAGGTAA
AGCGGAGTGCTGTCAGATACAGCCAACTCAATGTCTGCTTTGGCTGAACTGTCTTACTCC
TACAGAGCCCCCCAAGCATCTCAGGATTTGGGCCTTTCCTGTGTCTGTTTTGGATTTGGG
AATCTCTTCAGCTGTTTGGGGCTTGCCTTCTATAGTGATGGGTTTCTCGGAAAGGTTTCT
TGACTGAGACTTAAGTAAATGGTAACATGAGGGAGTCAGACAGTAGCGCAACAGGTTAAG
CACACATGGCACAAAGCACAAGGACCGGCGTGAGGATCCCGGTTCGAGCCCCCGGCTCCC
CACCTGCAGGGGAGTCGCTTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTC
TCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAATGACGA
CATCAATAACAATAAAAAACCACAAGGGCAGCACAAGGACCGGCATAAGGATCCTGGTTC
GAACCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCACAGGCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCAGAAGATCACTTCGGTATT
GTGACCTCGGGGAGCAAACTGGGAACCTCAGGAATGCAAGCCTGGTGCTCTGCCAGCTGA
GTTACTTCCTCAGTCGCAAGAAGTATCTGTGTGGGCTGGGGAGGCAGTGTAATGGTTATA
CTAACAACTTTTACCTGAGGCTCTGAGTTCCCAGGTTCAGTGTGCAGCACCACCTTAAAC
TGGAGCTAAACAGTGTGCTGTGTTAGAAAGGGAGGGAGAAGGGAGGATGGTTTTTATGCA
ATAAAATGGGATTTAGAATTAGTGCTGAACTAGGTAGCGCCAAGTACTGTCTCATGGCAG
ACTGTACATCTAGTATGTGTGAGTCCTCAGTGCTTTCCCAATGCTGCAAGTTGGTGGGGG
TCAGTGAGAGTTTACCTGATAGGGTATCTGCCTTCCCATGGGTGTGGTCCAGGCTGAAAG
CCCCCTGGCACCACACAGAGTGCCACAGCGCTGGGTAACGTTCACATAAAGGTTACTCAG
TGTCACATGGGGACTGTGTTGAGCTTTTATTTCTCCTGAGTTACTGGGTGTGATTCTGGT
TTTACAGAAAGAATTTTGAGGCGAAGTCCTAGAATCAAGCAGTTGTCATTCATGAGGACA
CATTCTGCTTCTTTCTATTCCACGGCTCAGCCCAAGTCTCGAAGCGTGCAAAGAGTTCAT
TCGTTCCAGCAAGACAAGTCAGGTAATGTGCTTGCTACCCATCTTCAGAAGTCTGCTGGT
TTGCTGGAAAGTATCTTAGGAAAAGAAGTATGGAATTTGGGCCTGGGGAGATGGCTTAGT
GGGCAGGACGCAGGACATGCACACATGAGCCTGCACTTAATCCCAGCACCACGTGTAACA
AAATGACACTCTGGCTCTCTTTCTCTTATAGAAAAATAAATAAAGAAGAAATTATTGGGG
TCCCAGAGGGGACCCAGTGGCTAAACTGTTCAGCTTTTAACTATGAGATCTCAAGTTGAT
CCCCAGCTTAGCATGTGCCAGAGTGATGCTCTGAGTCTCTCATCTGTCTGTTAATAATTT
GGGGAGCTGGAGCAACAGCTTAATTGTGATGCAAAAAAAAAAAAAAAAGATCTTCGTGCC
TGGGCCATGTGTATCTGAGACTCAGGGTGGTGCTATGCAGTCCGTGCCCTCCTCATCAGA
ACCTTCCCTTTGGATTCCTACATCGCTTGTCGTCTCTGGCCTTGACATCAATTCATTCAT
TCAAAAGGAAATTGCCGGGCTGGAGAGATAGCATAATGGTTATGCAGAAAAGACTCATGC
TTTGAAGTCCCAGGTTCAGTCCGCCACACCACCATAAGCCAGAGCTGAGCAGTGCTCTGG
TGAAAATAGATAATAAGAGGGAAAAAACTGCCTAGTTTCCACCTTATGGTATCCTCATGT
ATCCCAGGTGGAAGTTAATATGTGTGTACATGTCCTTCATCCTTTGCCCACATCTCAGCT
AGGAGTGTTTATATTCATACACAATATTATTCTAATTGCCCACATTCCTAACACATGACT
GGTTCATCTGCAGTCTTGCTAAGAACCAGCAGTCTTCCTGTTGCTATGATATAATTAGGT
AGCAGTCCTCCTCCACCCACCCCCAGTTACTCTAAAAATGTACTTTCTTTCTCTTGTCAA
CTAGCTACTTTATTTGCATTGGGGAGATATGGGGGGGGGGGCGGTTAGAGTCAAAATTAA
GTGTCTGTTTTTGACTTTCAGACCAAAGAGAAAATTCTCCATTGCGAAGTATTCGGTCTC
CCAAGAGGCTTCTTTTTGGGGCAGTGACTGAGATGTCCATCCCCTCAGAGAAGGCTTTAG
CCCGAATTCAAAGGCCTTCAGGAAACACACCAGGGTCTGAGATGTCTTCAGCTTATCAGG
TACAGAGTTTCTGTTGGGGTTAAAATAGTGTAGCCACGGCTGGGCAGTAGCAGCACAGTG
GATTAAGCACACCTGGCACAAAGCACAGGGAACGGTGTATGGATCCTGGTTCAAGCTGCC
AGCTCCCACCTACGGGGGGGGGGTCACTTCACAAATGGTGAAGCAGGTCTGCAGGTGTCT
GTCTTTCTCTCCCTCCTCTCTGTCTTCCCTTCCTCTCTCAATTTCTCTCTGTCCTGTCCA
ACAATAACAGCACAACAAGGGCAACAAAATGGAAAAGGTGGCCTCCAGGAGCAATGGATT
CATAGTGCAGGCATCGAGCCTGTGATAATCCTGGAGGCAAAAAAGAAAAAAGTGTAGCCT
TGGGAAACAGAGATTCGGCTAGAGAAACCTAACATTTGCCAGGGAGGAAGAAGCAGGTGG
TCTGCAGATGATTTGGAGAGGTCTGGCTGACCTGGGTGAATGACCTTTGGTAATCAGTCG
TTCCACTGGCATAGGTGAGCCCTCTCTGCTTCGCTTCCCACTTTCCAGCACCCTCAGACT
GAATTGTCCAGTGAGCACACACTGAATGCTGGGGAATGGCAGGTGTCCTACGGGTCCCTT
TAGTTGCAGACCAGAATTAATTGTCTTGCTGGAGGTGGCAGCTAGAAGACCCACATTGCA
ATTATTTGTCCTTAGAGCGATAAGATAGCTAACACATCAAGGTTGGATACAATGCTTGTT
GACACAGGAAGGACCAGACAATGTTTTGGAAGTCATGTTTTGGAAGTGGAAACGGGTCAC
TACTGGAAATCCAGTTTGAGGTCATTCCATTAATTGATTGAGCTCCTGTTTGCCTTCTTA
GTGTCTTGGTTATTACTCAGAAACTTGCCAGAGAGGGAGTCAGGCAGTGGCGCAGCGAGT
TAAGCAAAAAGCACAAGGACTGGCGTCAGGATCCTGGTTCGAGCCCCCAGCTTTCCACCT
GCAGGGGAGTCACTTCACAAGCAGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCCCCCTCT
GTGTCTTCCCCTCCTCTCTCCATTTCTGTCCTGTCCAACAACGACATCAATAACCACGTT
AAAAAAAACAAGGGCAACAAAAGGGAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA
AGGAAGAAAGAAAGAAAGAAACTTGCCAGAGAATGTAGATCATGGTATTCAAGCACTAAC
ATGAGCATTTTTCTTCTGCAGACTCCTATAAAGAGTTCCCTGAAATCTCCAAACTCCTCT
AAGGCCACATCGAGAAGGCTCCCTCCCACACCCCAGGCCCCACAGTGCACCCCCAAGAGG
CTGCAGAGGCCCCCTGCAGAAACCACACCGGCCAAACGGACCCTTTATAAGGGGGCCTTG
AGAGAGCGCTCCAGTAGCGGTGCTTCTCCAGGTCAACCAGAAGCTGCTCTGCAGAAAGGA
CACTCCCTGGTGGCAGCGGAAGGTGCCTCTCCTCAGGAAAGCAGGGTGCCAAAGGTGCCC
CCAAAGCCCTGCGCCCAGCCGCCTGGATTTTCGCACTATTCCACCTGGCCGCCGTCAGCC
ATCTCCAGCCCAGAAGGCTTCTGTCTGGCAGCTCCCATCCCAGAGCAGGAGTGTCTGACC
CCCTTGGGGGATCTAGGAGAAACTGCTTTTCCGGGGACACCTCCGAGCCAGAAACAACAG
CAGGCCTGCTCTCCTAGGGTCCATCCAGCAGAGGGGCCAGCCCTGAAGTGGGAGGATGGA
GTTGCCAAGGCCCCATCGACACCAGGAAACACCTCGTCACTGCCTGAGAGGCCTTGGCCA
GATTCTCCTCCCCCTGGGCAGCTGGGCCAGAACGAGACCTGTGCTGCCCCCTCAACTCCC
CTTCGAGTTTCACGGGGACTGAAGCCAGATTTCAGCCCTCCTCCTCCCCCTTCCAAAACT
GGGAAAAGGCAGAGAAAGACCTCTAATCCTGGAGGGGCTCCCCAGAGTGTCAGCCAGACA
TCTCTCCTGCTCTCACAGGCTCAGGGAAGCCCCAGGAGGAAGCGCACCCCTCCCCTGCGT
CCCCTGAAAGGCACAGTTTCCCCGACGCTGGCTTCTGGAGCAGATGGTGTGGGTCCTCTC
CGCTGCTTATCACCAGTTACACGGAGCCCCTCACGCTGCTGGAGGAGGCCGAGTGCCATG
ATCCTGGCACGCTGCAGAGGGACGTCTTGCTCGGGGTGGAGGGCGAGGGGTCCGAGACAG
CGCTTGCTGATGTGAAGCCTTCTGTGTCAGACACCGAGGTTCCTCCATCTCCCCCTGGCT
CCCTCCTGAGACCTTCCTTGGTCCTGCAGTGCTCTGTAGAAAACAGGCAGCAACAGGCCA
CTTCTGCCCCTCTTCTGGAAGGTTCTGCAAACCCCCAGACCTATGAGGTGGAACTGGGGA
TGCAAATCTCAGGCCTTCCAAAGCTTTGGATCAAGAAGAGAAAGCCCAGCTCAGACTCAC
AGTCGGAAGGCGAGGCCCCAAGCAGGGAGGAGGGCTCCATGGATGAGGGCGGCTCTCTCT
CCAGCCTGGGGGTCCCCAAGGGCAGTAAGTCCTGCAGACCCGAGGCCACTTACCTGTCAC
CTCCCTGCCTTCTCCCTGCGCACAGTACCCCAGGCAAGAGTGGGGGACAGACCTACATCT
GCCAGTCCTGCACCCCCACCCACTGCCCCTCCGGCACCTCCTCTCCATTCCAGACAGATG
TGGGGGTTCCATGGACACCCTCACCCAAGCACAACGGAAAGAGCACTCCTGAGTCCATCA
GGGACTGGCCCCGCAGGAAGCGGGCAGTGGACTGTGGCCCTGCTGCTGGGAGAGGAGACC
CAGGCGCAGAGCCCCCTGAGGGTGACCCTGAGTCCGGCATCCATAGGACTTCCATCCTGG
GGGACTTAGAGCTGGAGGGGGTGTGCCAGCTGCCCGAGCAGTCACCCCCCTGGGAGAGTG
TGCCACAGGCTGAGGAAGCCACCTCCTGGGGGCAGTTTGGGTTGGGCTGCAGGAAGAGAC
AGTCCTCTGCTGTGGAGGAAGCAGAGTCACAGGCCAAACGAATCTGTCACCCACCGGGCG
AAGACGTCGACATGAGAGAGAATGAGGAGCAGTCTCCCCGGGGCCGCGGGTGGCCGCTCC
TCGCGGGGGACGATGACGTGTTTGCACCAGGTGGGCTTACATCGGTGTGGTGTCTGGGCA
GGTGGGTGGCAGGCACTGTGGGGCTGGGCTCACTGTGTCTTCATCCCAGGTACCACCCCA
CCCTCCAGTGGCACGGTGCGAAGCTGCCTCTCTGCCAGCGGCCTCCAGGCCCTCACCCAG
TCCCCGCTGTTGTTCCAGGGCAGAACACCCTCCTCACGGGCTGCGGACACCAGAGGTAAC
CGCTGCAGGTCTCAGGTGCCTGGGCCAAATTGTCCTTCAAGGTGGGGGTGAGGGGAGCTC
CCCAGGTAGCTTGGGATGCTCAGTAGTGGGGAATGCCCAAGGGTAGACTGATTGTTTTGT
CCCTAGCGTGCCATTCCTCAGAGCTGCCATGTTAAATGTCTGTGCACTTGGTGGCCAGGG
GACAACGGCTCCCCTGGTAGAACACGTCTTCCCTGTGTGGCCCTGGGCTTAGTCCCAGTA
CCCCCTGGGCACATCATGGATGGTGGAGCAGTGCTATAGTCTCTGCCTCTCAAAAAATGA
AATGATAGAAAATTGGGACAGGGAGCTGGCTCTGTCAGTCGTGCCCTGAGTTCATTCTCT
GCCACCAGCTTTTTCAAAGTGGGTGTGCATTTGGACAGAAACCGGGATAGGGCGCTTCCC
AGCGGCGTGCCAACCATGGGTAGGCAGCAACAGCTCTTTGAAACTGCCAAGTCCTCTGAG
CTAAAGTACACACTGCTAGGGCAGGGCCCCGGGCCTCACCCCAACTCACAGGCCAGGGCT
GCCATGCCTGTCATCCCACAGGAGAGCACTGAGTGTTCACTACACCTCCACACTCTTCCC
TTGGCTCTCCGCTCCCTCAAGTCCTCCCCGCAGGCTGAGTCTTTTCTGCTTTTCCTAGAT
GAGGATGTGGATGCCTTTCCCCCCTCAGCAGAAGAGTCTCCGTTCAGCCGGGCCTTCTCC
AGGAAACACCCGATCAACAGGACTTACACACGCAAGAAGCTGATTAGCTAAGGAGGTGGG
AGCCCAGCTGGACGGTTTAAGCCACAAACACTACCAGATGCGTTCAGAGCCACATCGCAG
GATGGATGGCAAAGGTGTGCTGAGTGGTCCACACACAGTCCACCAGGGAGCCCGACAGGA
GTCCCCGGAACCTCATCTGAGCCGGGTTCACTGTCTGCAGGGAGTCTGGGCTTAATGGAA
CTGAGAAAGCACTGATGGAGAATGTGAAGTCAGCCAGGCTCCCCCATGGACATAAAAGGG
GGCCTAGCAGCAAGCCCATGTACCTTGTCAGCTTTCAGATTCCTGCTAGACTGCCCTGGG
GTTTTCAGATCTGGCCCCCAGACCCTGTGCCGCATACCATACCTGCCCCTGGTCGGGGAG
GTGGAGTAGCAGGTGTGTGACTTGGGCAGCATGGGCGACAGGAATTAGGAGATAGTGACA
CCTCATAGACCCCCGCCCCCAGATGCTGCAGTGCTGGGATCCCAGGGCAAAGAAGTGCCA
TGTAAACTGAAGCTGTGTAAGACTGCATCAGTGACAGGATGAGTTTTTATGTTGTCTGTG
TAACAATAAAGTCCTCTGCCAACTGGCATCCAGTGCAATTCTGCCAAAGTGACCCTGTCT
GTGACTGACCCTGTCTGGCTTTAGTGGCTTCTGAAGTCCCCTTGGACCTGCTTGCTGTCA
CGTCTTCCCAGGAGCCTGCGGAGTGGGCTGTCCCGGAACCCTCACAGGAACCATGCTTGG
CTCCTACTCTTAGAAAGCCAGCCTGAGTGAATAACACGCTTACCTCCCTCCAGAGATGAG
TGTCCTTTATTACAAAATGGTTTTACAAAGTTTTACAAAGTTCTGAAACCCTGCTACTTC
CAAGTTTTCCCCCACGAGGCCACTTCAAATACTGTTGTTGCCACTGGGCTCACTGTCACT
AGCCTGGGTGGACACCCAGATCTGTAGACACGGCAGGGTGGTGTGAGACCCAGACTTTCT
CAAGCAGTGGCCGCCAAGTGCCATAGTGGCAGAGGTTTGCTGTGGGTTTTAAGCTGACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1048, 1051..1056, 1058..1373, 1378..1415, 1418..1441, 1443..1514, 1516..1542, 3368..3647, 4723..4964, 6191..6425, 7208..7337, 10149..10288, 11083..11301, 13540..13691, 14030..14130, 14985..15078, 15157..15236, 15380..15619, 17384..17480, 19220..19277, 20434..20580, 21084..21174, 23020..23078, 24127..24261, 25281..25438, 26661..27035, 27040..27048, 27051..27395, 27398..28437, 28440..28446, 28448..28589, 28669..28794, 29458..29562, 29576..29598
1001..1048, 1051..1056, 1058..1373, 1378..1415, 1418..1441, 1443..1514, 1516..1542, 3368..3647, 4723..4964, 6191..6425, 7208..7337, 10149..10288, 11083..11301, 13540..13691, 14030..14130, 14985..15078, 15157..15236, 15380..15619, 17384..17480, 19220..19277, 20434..20580, 21084..21174, 23020..23078, 24127..24261, 25281..25438, 26661..27035, 27040..27048, 27051..27395, 27398..28437, 28440..28446, 28448..28589, 28669..28794, 29458..29562, 29576..29598
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved