Erinaceus_europaeus Locus USPL1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus USPL1
Erinaceus_europaeus
USPL1
GeneScaffold_3668
SNORA19
2345..2473
28371
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGCTGTTACTTTTATAAATTAGCTTTGTTGGCAGCGGACTCCTGGTGG
CTGAAAACCACGAATGTATATAGTGTTCTTTTTCCCTGTTAAATAATAGCATTGTGAATC
CGGGGATTTGTCGTGAATCCGGGGATTTGTAAGTAGTTTCTTGGTGTAGTGCTGATATAT
TTGAAATTGTGCATAGACCTAAAAACAAGTCTTCAAACTCAAGTTAATGTAATTTGCTTT
AAATAATAGCTACCTCTGTTTTGATAAGTTTGTTTGCAAATTAGTCTACCATGAAAACTG
TACCTGTTTTCAGCCTCTGCGCTCTCCAGCTTAATAACTTAGAGTAGATTGAGGTATTTT
GTTTCCACTTCAAGATTACAGTTTCAGAATGTCTATCCTAGGACATTGGGCCCTCAAAAT
AATACTTAATGTGTGTCATCTTATAAAGAAACATAGTTCTTTTTTGCAGTGAATGGGATT
TTTATTTATTATCCATTGACCTTTGTTTTTTCAGGTTTCATTGAGACATCCTTAGTGATG
TTGACATGTTTCAAGTGACATAAATTAGCCAATGACTCGGAATGATGGATTTCCCGAAGA
TTGGAAATGGTTTGCCTCTGATGGGACCAGGGACTGATATAGGGATATCTTCACTCCACA
TGGTGGGGTATTTGGGAAAAGTTAGTTATCTTATTTTTTGCCTCAGTGCAAAGTTGGATT
TTAATCCTCCTATTTTCGAAACTTAAATTCGATTTTAACTTTTATCAATTAACTTGTAAA
AAAAAAAACTGTCTTCTACGGAAATCTTAAGGCAATGGCGAAAGATTATTTTAATGTGTT
TACCTCTCTGTGTTGATACCTGGCCATATACCTGTGGTTTACTATTGGAAAACATGTATT
TTCCCTGGCAGTTGTCATTACTTTTTCTTGAAAATAACACTATTAAAAAGCCTTAAAATT
TATAGCTTAAAACAATAATATATTTTGAACTGATAGTTGTATTGAAAATATGTATGTACT
TCTTTTATTTGTCATATCTAAAATACCTTGCCAGGACACTTCTCAATTGAAAGTTTTGTT
TTCTTGCTGGTTTTTATCTGTTACAATTTTGTTGTTGTTTTTTAATTTGCCTTGTTTCTC
TTTTAGAATTATGACTCAGCTAAAGTTCCATCAGACGGATATTGTCCTGCTTGTAGAGAG
AAGGGAAAGTTAAAAGCTTTAAAGACTTACCGAATCAGTTTTCAAGAATCTATCTTCTTA
TGTGAGGATCTGCAGGTAAAGTATTCTTAATAGTATCAACTTATTTGCTTTATGTTTAAT
TCTGTACTCGTTTTGGAATTTCTAGGCTAAGTTTTTAGTAATAGTTTACTAACATTATTA
GATCTTATTAGGTCTTAGATCTGTCTTGTTTACAGAATAAATACTGAGTTGTCAGAAAAC
TCATGACATATTTTTGCATAGAAGTATTCCACCCAATATTTTGTTATTTGCTTGTTTGGT
TTCTTAAGTTAACACAATCTTTTAATCTCACAATCTTTTTTTGTTGTTGTTGTTGTTGCC
CTTGTCTTTTTTTTTATTATTGGGAAATTAATGTTTTACATTCGAACAGTAAATATAATA
ATTTGTACATGCATAACATTTCCCAGTTTTTCATATAACAATACAACCCCCACTAGGTCA
CATGTTTATTTATTTGTTTATTTGTTAAATGAACAAACTACATGCAGAGCATTCACATTT
GCTCTTTTACTTATTTTTAATTATGGTAAAGGCAGAAATAGGGTGTGAGGGGTGAGACAC
ACGCACACCTGCAGCCAGTTGGGTTCTAAGATGGGTCCTTGCACGAGGCAGCTTATACAC
CATATTGCCACTTTACCCCATAATTAACTTTTTTAGTCCTTAGGTTTGTAATAAAATATA
TTTCAGTGCACCTTTTATTGACATGCTATTTTCTGTTTGTTGAGCAGTGATATTGCTTAT
GTGCTGTACAAATAGATGAAGGTTAATTAGCAGTATAACTAGATAGACATGCTGCCAGTC
TCCTTCACACGGGTGTTAGCTGACTTACATTATTAGACAGCAGAGTCCCAGAACTTTTTC
ATCTCGCAGAACTGAAATTCTGTGCCTACTGAACAGCCTCCTATCCCCAACCCCCACCCC
ACTCCTGGCAACAAACATTTCCTATTTATTTATTTATTTATTTATTTTCCCTTTTTTATT
ACCCTTGTTGTTTAACATTGTTGTGGTTATTGATGATGTCGTTGGATAGGACAGAGCAAT
GGAGAGAGGAGGGGAAGACGGAGAGAGAAAGAGAGACACCTGCAGACCTGCTTCACCTCT
TGTGAAGCGACTCCCCTGCAGGTGGGAGTCAATGCAGATTGTAGTGCTTATTTGTATAGA
AGAAGCTGTATTTGAAATGAAAGGATTCAGTTTATTTACCTGTTGCTGTAAATGAACCAC
CTTGAAACTTACTATTCTGTGGATTGACTAGACAGTTCTTACACATCAGCAGCTTTTTTT
TTTTTTTGATGGACAGCAATTGGTGTTCATTGCTGACTCAGAAATCAGTTCAGGTGATCA
GCCAGAATATCTTTTCTTTTTATTGTGAGCTTTTTCTATAAGCCAGCTCAATATTTTATT
GTATGGTGGCTGAAACTATAAAGGAGAATTCTTGAAGGATAGGAGGACTCCAAAGAGAAG
AAGCCTAATGAGTTAGTGCTTATCAAACCTTCCTCTAGGTGCCTCATACTTGTTAATGTT
TCATCAAAGATATTGCCAAACTTAAGACAGAGGACTGGCTGCATAAGGGTATGAATTACA
AGAGATTAGTTCTTTGGTTTCTGGGGGGGGGGGGGTCATTATGCAGCATCTAACAGTCTC
CCATACTTGTGTTGAAGAAGGCATATGCTGAGAATATATATCATAATAATAATTTGGAAA
CCAAAATTACTCCATCATTTTTAAAATCAGAAATTGCTTCTCTATGTTTTAACATTATAC
AATATATCTGTCCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAG
GAGAGAGAGAGAGAAAAAACTATACATCACTCTGGTACATGTGCTGCCAGGGATTGAACT
CAGGACCTTGTGCTTGAGAGTCCAGTGCTTTATCCACTGTGCCACCTCCCGGATCACTGA
ACATTACATATCTTATTAAAGCAAGCTCTTGGCTGTTTTCCTTCTTAGATTACACATGTA
TAAGTAGTTCAGATTAAGCACTTTCTCTCGGGCTGGAGAGGCACCACTACTATGCTTGAG
GTCCCAAGTTCAATCCTGGCACCATCATATGCCAGAGCAGAGTATTGCTCTGGTATTATC
TCTCCCTCTCTTTCCCTCACCCTTTTTCATCAGATAGGCCTTTTTAAGAACATTGGTTGC
TAAAATTAAATAGGAAATTGTATTATTTTGAGGACCAAGTTTTTGTCTATTGCGAATTCA
TTCACATTTAGATATTGTTGTGCAGTCTCTATCAGCTTAGTGCTGAATTTTAGGTATATT
TTTCATAACACAGAAACTGTAATGTAAAACTTGAGCTTATTAAAATTTCTGTGATGTTTT
TCTTTTTTTTTTTCCCCCCCTTTCTAGTGTATCTATCCTTTGGGCTATAAGTCACCTAAT
AATTTAATTTCTCCTGATGTGGAAGGTTGTCATACTCTAAGTAAACCCCAGAAAAGAAAA
ATCTCAGAAGCTAACTGTAAAGATTCACTTCTTTTGGCAAAATCCCAAAAAACTAAAAGT
CATGCTGTTCTTGATGGTGAAAAGTCTTTGCACAGCAAGCATAATGAAGAAGCATCTGAT
GAAATGTCATCATTTTCACTCGACTTACTACATGATAGTCACAGAATTCAGTTAGGACAG
CTGATTCCCTGGAGCCGAATGAGATTTTGGAAGATGATGTTAATGACATGGCTACTGAGC
AAAACCCTTACTTCAGCTGATGTTGCTAAAACTGGAGGGATTTCCTCTCCATGTGAAGGC
TGCACATCGGGAACTGGGGGTGCCACTGGAGAGCACATCATTCTGCCGGACTCCGCATGT
TCAGTGGAGAAATGCATATGCTCTCTGTTGGCTAGACTGTATCCTGTCAGTATTGGTGCA
CTTGGAAGGGCTGAAAAGCATTGTGACTGACTTGTGCTCTGAAGATTCTGTGTTCTGGAG
GCTGTTTACAAAATATAATCAGACCAATAAACTTCTGCACACCAGTCAAGTGAATGGAGT
TAAAGGTTGGTAATTTCCTGTTTTTCTTTAGTTTTTTTTTTTTTTAATATTTGTTCCCTT
TTGTTGCCCTTGTTGTTTTATTTTTGTAGTTATTGTTATTGACGTCGTCGTTGTTGGATA
GAACAGAGAGAAATGGGGAGAGATGGGGAAGACGGGGAGAGAAAGATAGACACCTTCAGA
CCTGCTTCACTGCTTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCAGGGGCTTGAACCGG
GATCCTTATGCTGGTCCTTGTACTTTGCACCACATGCACTTAACCCGCTGTGCTACCTCC
CGACTCCCCTTTTCTTTAGTTTTTAAAGGAATTAATGTCAGATTTATGTCTCACTGCATG
TGGAAAATATGTTATCAGTGGCTTGTTATATATAGGAAACCTGGGAGTACGGAACCCAGG
GATAGTGGTCAGGAAGCTCAAGTTGCACTTGGCCAAGGATCTAGCTCAGTGGTAGAGACA
TGTATTAGACCCTGGGTTTGATCCTGGGCAATAGCAACAAATAACCCCAAAACTAAAAAA
AAAAAAAAAAAAAAAATCAGTACCGGTTACATTACTTAACTGTCCAAGGTAGTCTTTTTG
AAACACTCTGGGGGCAGATGGTCAGTGGTGCACGCAGTTGAGTGTACACATTACCATGCG
TTAGGACCCAGGTTCAAGTCTCGATCCTCTCCTGCAGTGGGTAAACTGGATGAACAGTGA
AACAGGTCTTCAGGTCTCTGTTCTCTCTCCGTCTATCTCTCCTTCCCCCTCAATTTCTAT
CTTCTCTAATAATAATGATAATAAATATAGGAAAAATAGCCACTAGGAGTAATGGATTCC
TCATGCAGACACCGAGCCCCAGTGTTAACTCAGGTGGACAATGAGTAGAGAGGTCAAAGT
AGCTAGCTCACTTGGACTGTGCATGACCCATATTCAAGCTTGGCTTCCCTGTCACATTGC
AGGATGCTTTGGTGTTGTCTGTCTCTGCTTCCTCTGTATCTGTCTGAAAACAAAATAGAA
AAACTTGTGCTTGAAGATTATAATGCTGTGGTTATATCTTAACTGTCCAGGTAGTGGTAG
TGATCATAGAGTCCATCAAACCAAAATTTGAATTTCTTAATTGCTGTAGAGCAAAGGTGG
AGTACCTGTTTTCTGTCAAGGCCCATTGGGATATTTGTACCTTCATTTGCGGCCACACAA
TTAAATCAAGCACTTAATGTTGCTATGAAAAAAAAAAAAAAGCTGTCTGGCATGGCTAGA
CCAAATGATTTTATGACCTGCTGACTGACAAAGAAGTAGACATAGGTCAAAATAGAAAAA
TCCCCATTCATTTCTCTTCACAATGAGGGATATGTTTTTCCCTTTTTCCTCTAGTTTGAA
TACCTGCGGACGTTGTACACTATGTCTTCTGTGATTCTTTTTTCTTTTCATAAGATTTAT
TTGTGAAGCTGCTTGTATTTGTGGTTCATTGATATTCATTGCTATATTATAACACTAGTT
CAATTATGTAAATATAATATATTAACTTTTTTTTTTTTTTTGCCATCTTATGTTTTGCTT
AGACTGTTCTTGGGCAAATTTCCCAGAGCACAAGAACTTCCCATAGGGATGAAATTGTCA
GATCTAGACTCTAAATCAAGATTTATGAGATCAGTGTGATTTTGTTTTTCAAAGTAGTTG
TACCTGTCTGTATTACCATTAGCAAAGAGATTTTTCTCACCTGTATACTCTGCCTTGATT
ATTTTCACTCTTGGGGATTTTTATTTGAATGGTTTCCCAGATTTTAAAGAGGTATGGACT
TTATTCATGTAGCAGCACTATATATGCTCCTTCTTGTGGCTTATTCCTATTTCCTCTGTT
CATTTGTTTATATTCTTAAAGAGTTGTCTGATACTACAAATCTTAGAGATTTTATATGTC
CTTGTTACTTTTTTAAAATTTTTTTATTATCTTTATTTACTGGATAGAGACAGCTAGAAG
TCAAGAAGAGGGGGGAGACAGAAAGGGAGAGAGACTGAGAGACACCTGCAGCACTGCTTC
ACCACTTGTAAAGATTACCCCGTCAGGTGGGGGTCGGGAGCTTGAACCCTGGTCCTTGAG
CATTGTAATATGTGTGCTTAACCAGCTGCGCCACCTGGCCCCATCCTTGTTATTTTTATG
TAAGGTATGTGTTGCTGAATTTCTCAGTTTGTAAGCTGTGTTTTTATTATGTATACAGAA
ACTGGTATTATAACTACTAAATAGTGTTGTTTCTGACTTTTAAAAGAAAGCGGGGAAGCA
ATTCCAGAAGCCAGACCTTCCACCTTCTGCAACCCTCAATGACCCTGGGTCCATGCTCCC
AGAGGGATAGAGAATGGGAAAGCTACTGGGGAGGGGGTGGGATATGGAGATTGGGCGGTG
GGAATTGTGTGGAGTTGTACCCCTCCTACCCTATGGTTTTGTTAATTAATCCTTTCTTAA
ATAAAAAAAAAATTAAAAATAAAAAAATAAAAAAATGTACATACAAAAGAAATCTTTCCT
TTGCTCTGGGAGATGGTGCAGTGGATAAAGCACTTCTCAAGCCTGAGGTCCTGAGTTAAA
TCCCCAGCAGCACATATAACAGAGTGATGTTGGTTCTTTCTCTCCTCCTATCTTTCTCAT
TAATAAATAAAATCTAAATATATACACATTTATATATATCCTTCCCAGTATCAGAAAGTT
ATTTCTATATATTGTCATTGAAAAGTAGTTTTGATTTTGAAATTCCTAGTTCAACTGGGA
TTAAATTTTGCAGGTAGTGTGAGGTAAGGTTGCATATTTTTCCTATTGTATTGCCAGCTT
TCCTAGTTCCATTTTTTTTCCTCAGTTGATCTGTTGTGTCCCCCTTTGTCAAACAATATT
CAATATATGTGTGCTGTTCTGGTCACGCCTATCCTTGCATCAGTACCAAACCAATTATTA
GGTATTTGATGTGTTGCTGTTGGATAGTAAAAGAATCCTTACCTTTATTCAACTTGACTT
TGGTTATGCTTTCTTTTATGAAGTGTCATACATTATTCCCAGGTGACTTAACATTTTTCT
ATTTTATGGTAAACCACATGTTTTATTAGAACTTCTCAAATCTTGTGTGGTAGGGTAAGA
GTAAGTACCTTCATTCATATAACTTTGGATGTGGGATGGTTTATATCAGTTCTTCCCCAA
TTTTGTTGACTATTTCAGGCTGCTTACTATTTTGCTTTGATGAATAAATACCATGACAAA
TACCCCATATATCCTTTGAATCCATTGCTGAGTGTATCTAGAAGGGATAAGTAGGTGTTC
GGGAGATTCTACCAGCACGCTAAATAACAATTAATGTATTTTTATGTATAAAATGGGAAC
AACTGACAAGACCCATGGATAAAGAGCGTCAAAATTCACACAANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
CAAATGTGACTATGCATGAACCTTAAGGTTAGAATATGGGGATGAAGATTCGAGTCTCTG
TTTTGGAAAAAGCTAATAAATCTATTTTAGGTCTGTTCCAAGGGGCCCATGATAGTTTTG
CCTGCACCTGACATCTTTTTTTTTGTGCCTGACATCTAATATGCAGATAACCTAAGTTAT
GGTCATCTAAGGATGGTGTCATAGTTGGATAAAGGACCAGAAACCTGGATCAGAGAAGAG
AGTAGCTCCCAAATATGGGAAAAGTATATAAATATTGTTGATTGTAAACCCCATCAATTT
GATCTGTGGCCCATAGTCAGCACAGGAGCCTGTGTAACCTCTGCATTCCTGTCTGAGCTC
ACATTCCATGATCATGGCTAGGAACATTCCAGTCTGTGCCAATTTCAGGACCCATCATCC
TCAGGTGATAGGCAGAGTGTGCTATCCAACCTCTCTTTGGAGAATGGGCCACTCCCCACC
CTGTTGATCCACATTGAGGGCCAGGTCCTATCCTATAGGGGCCAACAGAGGGCCACCCTA
TATATTTTATTACATATATCTTCATATATGTAATAAAACATTCCAGAACTCTTAACCATC
TTTGAGTATGCTTTTTATAAAGTTACAGATATATTCAATATAATACCTTGTTTTAGTTTC
TTTGAAATTATATATTGAAAAATGTTTTAAAATTAGTTTTTCATAAGCATTTTTTACTTT
TTTCCTTTCTCTTTCTAATTTCTATAATTATGGGAACTCCAGTATTGTGGGTTTATCTAG
TTGATTGCTATTGAGGAAGATGTCTCAACATATTAACTAGAATGTCAGAATTTTTGTTCT
AAGTTTTTACAGAATAACTGCAGTCTTTATAATCTTGTTTTAATTTAATTTGAGTTTTGA
ATTGTAAGTTTTTTTTTTATCTGATGAAATAACAAAACTTCTTAATTCTGACCTCATTGT
GAATCCATTTTTCAGTTGTGCATATTTTTATACAGTTATGTATGTTCTAAGTGGAATGGT
CTAGTTGTAGCTTAAGGTCAACTGGGATGAAATGCACGTAGAGGGTTTTAAAAACAACTG
TTTTATTAATCTTGGGTAGTTTTCTGTCAGAATAATTTCATCTTGAGAATTTATACCCTG
AAGAAATGATGAAAAGTGTGCACATATGCAGTCAAAGATGTAGTGTTCTAATAGGGAAAA
GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TGGTATACCACATGGAAGGAATAATTAAGAATATTTTATTTTATTTTATTGGGGGGGACA
CAAAAAAAAACAAATTTATTTGGTGAGTGCTGATGGCAAATATCATCCAAGAGAGACAAG
TCTGGGACCTGCTGTGACAAGAGAACCTTAGGAAGCCTTTGGAGCTACCTACATAGTCTC
ACGGGGGAGGCCAGGGACTCTGCGGTAGTGGGGGTGTCCTCAGCCATTCAGCACCATACG
GACGAGCTCTTCATAGTTGATGCAACCATTGCGGTCTTCGTGCCCTGCCACCAGCATCTC
TACTTCTTCCTCTGTCATTTTCTCACCCAGTGTGACAAGAACATGCCAGATTTCAGCTCC
CATGATGGTGCCATTCCCCTCCTTGTCAAATACCCAGAGGCCTTCAACATAGTCCTCGTA
GGTACCCTGGTCCTTGTTCTTAGCCACAGTCTGCAGCATGGGCAGGAAGTGCTCAAAGTC
CAGGACCTTCACATTCGGCTCTGCCAGAAAGGAGGTGGAGGGATATCATAATGTTCTAAG
GTGTGAGAGGGATTGTAGGGATCACAGCTGGGCAGTCATTTCCCATCAGAATGGCACATT
CATGGGACCTGCTACTTGAGACTAGACCGGCTTAAGTTCAGGGCCTATGAAGATGGAAGG
AAAAGTTCAGAACTGTAGGCTCATTCATACACTGAAGAGATGTTCTTAAGGCCCTCACCA
TCACTTTTGGGGTTACCCAGGACCTTGAGTACTTCGGCGTTGGTGGGGTTCTGGCCCCAC
GCCCTCATCACGTCCCCACACTGGCTATACAGGCTCTTGCCATCCCCTGTCTGGTCAAAC
AGCTGGAAGGCCTCCTTGAACTCTGTGGTCTGGTCTTCGGTGAAGTCACACATCTTGATG
GTTCAGCTTTGCGGGACCTTCTGCTAATTAGGAATATTTTGTGTTCCTTATTTTGTCTGC
AGAATTTATTGACTCATTACTTAGGATGTAGAAAAATACAGATTGTGAAATTGATAATGT
CCTATATTTTCTTTTTAGGTGAATATTGTAAAAAACTCAATAAAGAAATAATGGCAAAAA
TAGATACCTCGTTAAATGAAGTCAGAGATGAGATTTTTCTTAGACTTCAACCTCAACTTA
GATGCACGTTAGGTAAGTAATTCAAGTAGTTTAAATGTTACTTGTCTACCAGAAATACAT
CAGGATTTAATAATCCACCACTGCTTGAATCACATTGGTGGGTGGGTCTGTTCTGCATAA
AAATTCAGGCTTTAGATTTATCACTTGAAAGTGGATACAATACTCAGAATGAAGCAAATA
CTTAGTGCATTATCGCTTACTTTCCTAATACTTTTCTCAAATTTAGTTATCCTGCATTTT
CATCCCTGATTGTATATTAAAAAGCATCTAGAGGGTAGATAGTATAATAGTTATGCAAAG
AGACTCTCATGCCTGAGGCTCCAAAGTCCCATGTTCAATCCCCTGTACCACCATAAGCCA
GAGACTGGGCAGTACTGGGGGGAGGAGAGCATCTAGAGTATTTAAGAAAACTAGTTGGGG
GGGTCATTAAATAGGACTTAAGGTCTTAGGTACCAGTGAATTTATTCCCCACAGAGTCTG
TAAAGGTAGACAGGGTTAAGAATCTAAGCTAAACCACAGTAATTGTGCTGTTTTTTTGCC
ATTGACTGGTTTAGGAGTGACCATATGAACAGTTCTCACCAATGAGATATGAGAAGTATC
TATGAAGGTATTATAGGAAAATGTTCTTATCTTTACAAAGGGCACCGGAATGAGACCTGC
ATTCTTTTTTTTTTTTTTTTTTTTTTTTTAATTCCCATATCCCACCCCCTCCCCCGATAG
CTTTCCCATTCTCTATCCCTCTGGGAGCATGGACCCAGGGTCATTGAGGGTTGCAGAAGG
TAGAAGGTCTGGCTTCTGTAATTGCTTCCTCGCTGAACATGGGCGTTGACTGGTCGGTCC
ATACTCCCAGTCTGCCTCTCTCTTTCCCTAGTAGGATGGGTCTCTGGGGAAGCTGAGCTC
CAGGACACATTGGTGGTGTCTTCAATCCAGGGAAGTCTGGCCGGCATCCTGATGACACCT
GGAACCTGAGACCTGCATTCTATTCTAAGAATTGACTTAAAGTATCTTTTTTTTCTGAGA
AAAACTAAAATCTGAAAAGACATTGTGGTTCCTTTTCTCTTTTAAGTTTTTGTGTCTATG
AAGAAAAATAAGAGACTGAGACTTAAAATTTTTATGGGGGCTAGGTGGTGATGCACCTGG
TTGAGAGCAAGTTACAGTGTGCAAAGACCCAGGTTTGAACTCCTGGTCTCCACCTGCAGT
GGGAAAGCTTCGAAAGTGGTGAAGCAGGGCTGCAGGTGTCTCTCTGTCTCTCTTCCTCTC
TATCACCCCCTTCCCTCTTGATTCCTGACTGTCTCTATCCAATAAATAAATAAAGATAAT
AAAAAATTGAAGAGAGTTAAAAAAAATTTTATTATGGGTATTTTTTGAAAAATGTTTTAA
AAATGCCTCCTCATCCAATTGTGAATGACTTACTATGTCATGTGTAGAAATTTACATATA
TCCATACTCTGAATATAGTAAAAAATGATATCAGTTTATAATTTTAGTTTAATTTTTTTC
AGTTATAAGCAAATTAATCTTTTTAATTTATCTTTTCTTTTGATAGGTGATATGGAAAGT
CCTGTATTTGCATTCCCCCTGCTTTTAAAAACAGAACCCCACATTGAAAAGTTCTTCATG
TATTCTTATTCCTGGAACTTTGAATGTTCTCAGTGTGGACACAAGTATCAAAACAGGTGA
GTATTTTAAAATAAGCTCAATATATTGAAAATGATTTTGAGTAATAGAGTTTGGATAAGA
CATGCTTCTACTGGTAGCACTGTTCTCTCTCTGACTCTTTTTTTCCCCCTTGGTAAAATT
TCCCACTGTATCTTAGTGTTTTTCTCCTGTTAAGGTTCAAAGAAAAGTATCTTGAGTGCC
AGAGACTACAATTTGCTTCTTAAGCTGGAGATACAATTTGATAGAGAGCTAGTAGAGGTG
TAGAGGTGTTAGCTAGTAGAGCTAGTAGAGGTGTTCATAAGTTGTTTAATGACACATAGA
GACAATCCACTCACCCTCTGAGCTCTGACTAGGGTTTTTGTTTATATTGTAATATTATGG
AGGCTGATTTTAGGTTCTTAGAGTCTCAGAGATAATTTATACTTTTCCATTCCTTCCCTT
AGTCTTATGAAAAATCAGCCACCAGCAGAATCCTACATGTGAGCTGTCAGCCATGCTTTC
TACTTCTCTTTGCCTCTAGGTGAGATTAGTGGGATTATGATGGATGCACATGGCTGTGAG
ATTGGGGCTTGGGAGGAACTCGAGTTGCTGCACATATCTACCGAGGTGCAAGGAGAGGTG
TTAGGTTTTAAAAGAGGACTGTGGAAGAGAGTTTCCATCAGTCATGCTATCCCCTTTGTC
CACAGCTGAGGAAGTTGCTGGTTGGCACTTAAAAAGATTACTAGATCTGCTCATTTGTCA
AGTTATTATTAGAGATAAGTCCTGTCCTCTTTTCTCTAACTCACCAACTAATAAACTAGA
AAATTGGGTGATCTTAAAGCTATTAAATGAAAATATGAGAGAAAAATCATACTTTAGTAC
ACTAATTTCCTAAATAAGATTATTTTTAGGTATTTAGGAACTAGTCAAGGAGAATAAGTC
TGAGAGGGAGCTCTAGGGAATTCAGGCAGTGGAACCAGAAAACATTTGGTCTTTTTGACC
AATTAGATAAGAAATACTAGGACAGTATGAGTTGTGTTTCAGATCTAGGAATTAAAACAG
TTTTGTGTTAAGTAGATAAGCATGAGGACAAATAACTGTTTCCAGATCTTCTGTTACTGA
TTTACAAAAATGATTTCTCATCTGGCAAATATGGAGGCTAAAGCTTGAAAGGAGTTCAAT
ACCCAAGGTGACACACTAGTAAATGACAGAGTCAAGATTGCCTTAAGATTTTTTTTGCCT
TCAGAGGCTTTCTTGTCACTGGTGTATTTCTACTTACCACCTGGGTTTAAAGTAATATAA
ACAAACCTGATGAGTAAAATCCATTTAATTACAGCTTTCTCAAATCCGCATCTCAGTTTG
ACAGCTTTTTATTGAGTGTATTTTATATGCCAGGAACTCAACGGAAATAATCTTTGTCCT
GGCTGAATTCAGGTTTAGCCATGCACTAATACGAGGACCGGTCACTTAGTAATTAAGTTA
ATTTAATTTACTTGAGTATAAAGTGATAAGTATGAATTTGGCAGTATATAGAAACAGGAT
TCAAGGGTAAGAAAGCATTAGCTACTTAATATTAAATTTTTTTCTTGTTTTAAGAATAAG
AGTATTTGTGGAAGAAAAGTTAATATGAAGTGGCTAGTACGTTTTAATATAGCCTAAAAC
TGAATTCCACTAAATTTGATGAAAGACCATCCAGCAAAAAAGTCCTTTGTGTTCATGTTG
CTGTTTTTAGTATCAACCTTTACTTGACTTTAAGGATATATCCTGAAGGCATTTAAAACA
TGGTCTTTGGAGTTCAGCTTTCTGGATTTAATCTCAGCTTCAGTGGATTTTTATTCCACG
GTCTTCACTTGTACATTGTAGATAGTAGATGAGAATAGTACAGTTGCAGATACAACTCCC
CCACCCCATGTCCATCCATCTATCCTACCTACCTACCTACCTACCTACCTATTTGATAAG
ACAGAAAGAAATTAAGAGAGGTGGGAAAGAGGGAGAGGGAGATAGACACCTGCAGTACTT
GCTTCATCACTCTTGAAGCTCTTTTCACATTGCAGGTAGGGAGCAGGGGCTTGAACCTGG
GTCCATGTGCATGGTAATATGTGTGCTCAACTTGTTGCACTGCTGCCTGCTCCCCAGTAA
TTTAATTTAAAAAGATGTATTGTGAATGTAGTTGAGCTGCAGTATACTGTAAATATAATT
TTTAAAATATTTTATTTTTGCCTCCAGGGTTATCGCTGGGGCTCAGTGCCTGCACTATGA
ATCCACTGCTCCTGGAGGCCATTTTTCCATTTTGTTGCCCTTGTTATTATTGTTATTTGC
TGCTGTTGGATAGGACAGAGAAATCGAGAGAGGAGGGGAGATGGGAGAAAGACACCTGCA
GACCTGCTTCACCGCTTGTGAAGTGCCCCCCCGCAGGTGGGGAGCTGGGGACTAGAACTG
GTATCCTTGCACTTTGTGCCGTGTGTGTTTAACCCGCTGTCCGGCCCCCCGTAAATATAA
TTTTTAAAACATTTTATTTAGTTTTTTAAGACAAAGGAGACAGGTCCACAGCTCAATTTT
GGTATATGGAAGTGCCAGGAATTAAGCTAGTGCCTCTGGGGCCTCAGACATGCACTTGTA
CTATACTGCTGAGCAATCTCTTCCACCCCGCAGAAATCACCTGCCTCCCTTCCTGCTTTC
CTTCTATAAAAACAGAGAGGCAAATAGAGTGGAAGAGACCACAGTACTGACACTTCCTTA
AGTGTGGTGGGGCTAGCTTGAACCTTACCAGTACACTAACCAGGTGAGCTATTTCACTGT
CCCAGATCACCTTTTAGATGCTTTAGATCAGATATTCAGACTAAAGTGCAAGTTTAGAAC
TTACATAACTGGTGAAAACAAAATTCTTTTGCAGTTGATATTCTAATTGTTTAAGGATCA
TGAAAATTATGTTGTATGTAATATTGACAATACATATATATGTGTATATGAATGCCCCCT
TTGGATTTGGTTAATAACCAGATGTAAATAATTTTGAGTGAATCGTACGCTTTTAATAAA
TTTCTCATCCTGAGGACAGTAGCTCTGAGTGAGGGACTGCTTTGTACTATATGAACAATT
AGCAGTATCTGGAGATGTAGGGAGCTGTGATTTAAAGCTACTGGTATGCAGTGCATAGAG
GCCAGAAATTATGCTAAATGTCATGAGATGCTTAATACAGTGCGCTGAAACAAAACCTTA
TCATTGCATAATGTAACCAATATTGCTCTTGAGAAATCCTTCATTTGCCACTTCTTCACC
TCATAACTGAAAAATTATAGATAATTAATGTGGAGAGTTTTCACAGAAAGTGCTATATAA
TTAGAGAAGACTATTGGCAAACTTAGGTGATTTGGAGAAATAGGAAAGTATGGATAAATA
ATTTTAATTTTTAAACATTGATTCAAATGAATACAGATGAATTTTATTTGTGTCTTTCCC
TTTTTTCATAGATGCATGAAGAATCTGGTCACTTTTACAAACGTCACCCCTGAGTGGCAT
CCACTTAATGCTGCCCACTTTGGCCCATGTAACAAATGCAACAATAAGCGGCAAATAAGA
AAAATGATACTGGAAAAGTGAGTTAAAATACCCAACTATTTTTCCATTTTACTTTTTTTT
TTTAATTTACTTTGGATAGAGACAATTTTGGGCTGGGGGTGGAGGGAGTGAGGCATCTAC
AAGTACTGCTTTCCTGCTTATGAAGCTTTTCCTGTGCTGGTCAGGGCCAGGGACTTGAAC
CTGGGTCCATGTGTTACTGTAACATGCGCGTTCTACTATGCTTCACCTCCCAGGCTCCCC
CTGCCCCATTATTTTTTATAACAAAAATGAAAGTAGGTTTACATATTCTTGTAATGTGCA
GAATTGAAATTGACAGATAGAACCTACTTTGCAAAAGTTAATATATGAGTTTTGAAAATG
CCTCTCATCAGGAACTCTGACTAATAAGCAGCCTGTGCCAGATGAGAGACCAATGATGGC
GTGACTTAGGATTATTGTCTTCACTCTGTCATGTCTTTCTTTGGACATTTTTTTTTTCCT
TGAACCTCCAGTTTTTTCTCTTCGTCAGAACTCCAGAGTCACCAGAATTCTGGGATTTCC
TTTAATATTTTATTATTTCTCAATGAAAGAGACCATAGTACTGCATAGCTGTGCTTTATA
GTGGTGCTGGGGTTTGAACCTGAACTTCAGAGCCTCGGTCATGAAAGCCTTTTTGTCTGA
CCCAATATTATGCTATCTCCCCAGCCATCTTTAATCTGATTTTAAGGACTGAAATGAGTC
AAAGGTTCTCAGGTTCATTTCTGAATTTGTCTTCTCCCAGACTTTGGGCTACTAACTTTC
TGCTGCCCTTGAACAGATGTCATTTTATTATGTATTGCCAACTTTGCCTCAATAGGAGAA
CTGCTCAAAGTTACCTTTATTGATATTAATTGAATACTTCCATATTTTTTGTCAGATTTC
TTTCTTTTCTTTTTTTTGCCTCCAGGGTTATTGCCAGGGCTCGGTGCCCTGCACCATGAA
ATCCACTGCTCCTGGAGACCGTTTTTTTCCTTTTGTCACCCTGGTTATTTTACCATTGTT
GTGGTTATTATCGTTATTACTGATGTCGTTGTTGTTGGACAGGACAGAGAGAAATGGAGA
GAGATGGGGAAGACAGAGAGGAGAGAAAGACACCTGCAGACCTGCTTCACCACCTGTGAA
GCGACCCCCGCAGGTGGGGAGCCAGGGGCTCGAATTGGGATCCTTCTGGTTCTTGTGATT
TGCGCCACTTGCGCTTAACCCACTGTGCTACCACCCGACTCCCCAGATTTATTTTCTTTG
TGTGAGAAAACACATAGATTTAATTGTATTACAACTGTAGTATTTTGGTATCATTGGTGT
GCCTATTGTATGGATTAAATGCTGATAGATATGTATATGCAGGGAAAACCAGTTTATGTG
GCGTTCAAATGGTCTCTGAATGTATCCTCTCTAGTTTAGCAGAGACTACTGTAATCTTAC
AGTGCCAAGATGCTTACCAGGGTAAAAGAGCTGGCAGTGCCTTTCCACCTTTCTACTTTA
AACCTTCAAGGTAATATTTAAACATTTCAGAGCAGTGTGCATTAGACAGTTCTCTTCTTA
CTCTTTATTTTACCATTATATGGTTCATACAGAGTGTAGGCGCTCTTACAATAATAACTG
AGCCTCATCTATTTAGTCTCTCCTTATTCTAACAATATTGCATTACTTACGAAATCAACA
CCTTTAGTTTGCATTATTGCAAATATGCTGTATCTTCATCCAAGCAGTATACATAATTAT
GCTTGATTACGTTTATAACTTTATTTTTCCTGGAATTAGTAATTGCCTTGTGTTTTCATG
TGGTTTATTTATGTACACATTGTGAGTTCCTATTTTTAAGTTCTTAATAGATTTTTCAGA
CAGACTTTATGTGTGGGAGTGCTCTTTCTATATATTTTTCATCACTACTTCAATTTTCAA
CATAGGGTCTTCTCCCACATTCTTTGACATTTATTGCTTATAAGTATCAGGTCTTTAATG
GGTTCTATGTGGCAGATAAGCCATTAACAGTGTACTGATAAGAAGCATATGGTAAGATTC
TTTAATACCAGAAAAGATCATTTTGAGTTGTCCTTCTACTTATTACCCTGATTATTTCCA
TTTAGTGTTTTGGGAGACAGGTCTGTCCCACAGAAGAAAGCTCAAGGCACACTCCAGCCC
TTCCATTACTATAGAATAGAGCACACTTAAAAAAAAATAAGCTTGCAGAAGTGGTGTCTC
ATTGTTGTCTTTATTAGCATTTCTCTGATAATCAGTGACATTGAAAATTTTTTCATATGT
CTATTGACCCTTTGGATCTTATTTGCTGAATATTCTGTACACATCCCTAATTTTGGATGG
GATTGTTTGCTTTTTTTGTTGCTAAGTTTGGTGCGCTGTTAATATTTTTTGGTTATTAAC
CTTTTGTCTGGTGTATGGTATAAAAAGATTTGTTTACATGTAAGGAGTCTGTTTGGGTGA
TGGTTTCTTTTGCTGTGCTGAAGCTTTTCAATTTGATGTAGTGTTCACTGGTTTGTTTTT
GTTGCTGTTTTTTATATGCAAATGGATTTGAGTATTTGAAGACACTTTTAAAACTTAAAT
TGACTAGGTGTTGAATAACAGATAAGTGGCTAAAAATAAGTTATGATGTATATATAATAT
GTATATGTGATGGAATACTACTCAGCTATTAAAAATTGTGAAGTCAACTTCACCTTATCT
CTGGATGGAGCTTGAGTTAGGAAGGACAGAGGGAGTCGGGCGGTAGAGGGTTTAAGGTCA
CGTGGCGCAAAAGTGCAAGGACCCGGTGTAAGGATCCCGGTTTCGAGCCCCCGGCTCCCC
ACCTGCAGGGGAGTCGCCTTCACAAGGCGGTGAAGCAGGTCTGCAGGTGTTTGTCTTTCT
CTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAGCAACGACA
AGAAGGGATAACTATAACAAATAAAAACAACAGGCGCAACAAAAAGGGAATGAATAAATA
CATAAATATTTAAAAAAAAAAAAAAGAAAGAAGAACTGAAAGGGGAAACAGAGTAAAACT
TGAACTGGTTTGGGGTATTGCACCAAAACAAAGGGCTCTGGTGAAGGATCACGTGGGGGA
TAAGGATGGGGGTGTTTTTAGTCATGGTGCACAATGATGGAAGAGGATCTAAATTGGGGG
TAGGGGTGGTTTGCAGACACCTATCTTGGTGAGAAATTGTATCGGTGTGCCAATGACTGT
GCTGTAAACATTAGTCAATAAAATAATAATAACAACAACATTGCTCAGACTGGGAGAGTT
TAGACACCACCAGTGAACCTAAAGTGTACATTGTTGGGGTTTGGAAGGAAACCCCAGTAA
CTATAAACTATCCATGTAGACATGGGAAGACCATACCAACTCTATGAATATACTGCCTTG
GGCTGGGAATTGATTTATTTTTCTTTATCACAGTTACAGTAAAGCAATGTTGTTCAAGAA
CTGGCTATATTTGTAATGAGTGTACATCTGAAATGGTGGGAGAATAGTGTAATTGGCAGC
ATTTGTTCATGCCAACTCATCTTAATAACCAGTGACATTACACATTGAAGTGGTAAAGCA
TCAGACTGCATGCCTGAGGTTCAGTCCCTGTTGCCACGTTGCCAGAATGATACTCTGACT
TGTCTCTTTCACTGTCTCACTCTCTTTGTGGAAACTCTCTTTGTGATGGCTATCTATCTA
GAAAAAAAAAAAAGATTATTCTCTAACAGTGATTGATAAAGAACAATTGCAAATTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCAGGGAAGACGGAGCCCTGAT
TCACTGCTCTTGCAGCTTGGTGCTGGCACTATGAATCCACCACTCCCATCTTACTTTTCT
TTCATTCTTTCTTTTTGATTTTTATTTGACAGGACAGAGAAATTGAGAGGCGAGGGGAGA
TAGAGAGGGGGTGAGAAAGTCAGACATGGGAGTCGGGCGGTAGCGCAGCAGGTTAAGAGC
ACCTGGTGCAAAGCGCAAGGACCTGCGTAAGGATCCTGGTTCAAGCCCCCGGCTCCCCAC
CTGCAGGGGAGTCACTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTTTGTCTTTCTCTCC
CCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTTTGTCCTATCCAGCAACGACAAGAA
GGATAACTATAACAATTAAAACAACAGGCGCAACAAAAGGGAATGAATAAATACATAAAT
ATTTAAAAAAAAAAAAAAGAAGAAGAACTGAAAGGGGAAACAGAGTAAAACTTGAACTGG
TTTGGGGTATTGCACCAAAACAAAGGGCTCTGGTGAAGGATCACGTGGGGGATAAGGATG
GGGGTGTTTTTAGTCATGGTGCACAATGATGGAAGAGGATCTAAATTGGGGGTAGGGGTG
GTTTGCAGACACCTATCTTGGTGAGAAATTGTATCGGTGTGCCAATGACTGTGCTGTAAA
CATTAGTCAATAAAATAATAATAACAACAACATTGCTCAGACTGGGAGAGTTTAGACACC
ACCAGTGAACCTAAAGTGTACATTGTTGGGGTTTGGAAGGAAACCCCAGTAACTATAAAC
TATCCATGTAGACATGGGAAGACCATACCAACTCTATGAATATACTGCCTTGGGCTGGGA
ATTGATTTATTTTTCTTTATCACAGTTACAGTAAAGCAATGTTGTTCAAGAACTGGCTAT
ATTTGTAATGAGTGTACATCTGAAATGGTGGGAGAATAGTGTAATTGGCAGCATTTGTTC
ATGCCAACTCATCTTAATAACCAGTGACATTACACATTGAAGTGGTAAAGCATCAGACTG
CATGCCTGAGGTTCAGTCCCTGTTGCCACGTTGCCAGAATGATACTCTGACTTGTCTCTT
TCACTGTCTCACTCTCTTTGTGGAAACTCTCTTTGTGATGGCTATCTATCTAGAAAAAAA
AAAAAGATTATTCTCTAACAGTGATTGATAAAGAACAATTTGCAAATTTTTCTCTGCCAA
TCTAAAGAGTCTGAAGTTTGGACATTGATTTAAGTGCAATTTAGTAAAATTTGACAAGCT
AAGTAAATTTTGACAGCTGTTTAAATATTGGAAAAGAGATATTCAACATTTTTCTTAAAT
TCTTAGAGCTTTGATAAATTTAGTTACTTGAGGCCTATCTTTGTGTTCTGTTTTCTTCTT
AAACCAAGCTTTCCCTAAGTAGAAGTTTCTCTTTCCTGCTCGTTCTCAGCAGAGAGTGTA
AGAGACTGCAACACTGCAGCTTCGCTCAGTGTGCTGGGGGCTCTCCCCTGTGTAGTGCAC
ATGGCAAAGCAGCATGCTGTCCAAGTGAGCTAGTCCCACCAGCCCCTAAGTAGAAAATGT
GATTTGAAGCACCTCACTGGATCCTGAGATAACTGAGGGAAATAGGCCAGCTTATTAACT
CCTTATTTTTTCTAATTTTTATTTGAATATTTGGGGATTATTACTTTGTTTTACATCAGT
ATATGGAACATATTACCCTGCCTAACAAGAGCAATCAATTTAGACATCTGGTACCAAAGA
AAAAATATATATAAAGGTCTGGAGTTTTTCTTTGACTTTACAAAGTACTTAAGAGGAACT
CCTTAATCTACAGCAGTATTGAGGCCTACAGAGCAATTTTGTTCAATGGTCTGTCTAAGA
ATCTTGGTTGCATGATAGCTTCTGTCAATTGTAGCATTCTAAGAAGGGTTTACAAACTTC
TTATAATGAGTTTTCCATTTTATTTAAGCATACATGTGTTGTAAGTTCTCAGAAAAATTA
GGTTAGTTATACTAGAAAGTGCTGTGTGACTTCTGATATATAATCAGTTGCATTGCATTA
AAGTTATTTAATTTCTATTACCTCTCTCCCACAGAGTATCTTCCATGTTTATGTTGCACT
TTGTAGATGGCTTACCACATAATGACCTGCAGTGCTATTCATTTGAATTTGAAGACTGTC
ATTACCAAGTAACTTCTGTAATTCAATACCAAGCAAATAATCATTTTATAACATGGGTTT
TAGATACTGATGGTAAGTGTTTAAACATTTTTATTTTATAGTAATAGGAATAGAGACTAT
AGTTTGCTTTTTAAGATGAAATTCGCCATCACTCTTCTCTGTTCTTGCCTATTGTGCTTT
TAATTCTTCTGCCCATTGCCCCTTCCTCATCGCTTTAATGTATCAGTCACCCTTACTTCT
TTTCTTGGCTTATAATACTTCCTTTTTAAACTAAATAACAAGGTCATATATACTATTGAC
TTAGAGTTTGCATTTTTATACTTAATATCTTTGCTCTTGCTGTTTGTTTTTATTGCATGA
GTAGTAGTATTAAAAAATGAATGGTAGCAATTTAAATTTTTTGACATATAGATAGCTATG
TACTCCTTATCAAGAGAAAGCACATCACAGAAGTTTTGCAAGCCAGGAGGTGATGCAGTG
GATACTGTTCAACCCTGAAGCATGAGGTGCTGATCCCGGGCGTCCCATGTGCCAGAGTGA
TACTCTGGTTCTCGCTCACTTGAGTAAACAAATAAATAAAATTTTAAAAAAACAAATGAA
GTTTTGCTTAGTTTGCAGTTGTTAGGATTGCAATAAATAGAAAATAGAAATACATATCTG
GGGCTGGGCGGTAGTATACCTGACTGAGTATACACGTTTGTTTTTTGTGTTTATTGTAGG
ATAAAGTAAAAAAAAAAAACTGAGGTTTTCAAATTTCTATAACAGTTCATAGCTCTAAAA
TGTGCTAAAAATGGCCTTAAAATTCAACAGAGAAAAATGATGTTGTATGGAGTTGACTGT
ATTTTCTAGTGTTCTTTGGTCAATAATTATTAATAGCAGTTCAGGAGATCAGAAGCAAGT
TAATATAGGATGAGTGGTCTTTTGAGTGTCTAATTTTTTCCACTTTATTTTTCTGTCTCC
CAGGAAGTTGGCTAGAATGTGATGACTTAAAAGGCCCATGTTCTGAAAGGCATGAGAAAT
TCGAGGTCCCTGCTTCAGAGGTACATATTGTTATTTGGGAAAGGAAAATACCTCAAATGA
TAGATAAGGCTACTGTTGACCTTCCACTTAAAAAGACTAATAATGATCATCATGCTTTTG
AGAATGAAAAACAACGATCATCACCATCGTGTCCCGTTGGTGATGCTGCTTCAGCTGAAA
CATCCCCAGGGCCTCACCCCACAAATGTGTCAGTTGCTCCTAATACTCTTTGCCAAGATG
ACGCGACAGCTTGCGGAGATCATATGCCTTCAGGTCCAAAAGGTTTAGTTCATGATAATA
TTTTACTCTTGACATTTGAAGACATAGCCAATAATTCCAAAGGCCTCCCATTAGAAAACA
AACCTGTAGCAGTAAATGTAGAAGCTGTCAGAACAAGTACTTTGAAATCACAAGAGTCAC
AAGTGACTTCTGCAGTATCGCCTCCATGCAAGTTAAAGTGTACCCAAGATCAATTTGTGA
ATTTAATCTTTCCATCTCAAATTGTAAACACAAATATGAACGTGGTACAGTTGAATAAAG
AAGATACTGTAATTACTCAGCCTGTGAATAGTAGTCCAGCAACTGTTTCTATGCAGCTTG
TGATCAGTCATCCTGCTACCGTTCCTGTACAACCTATGAATAGTAGTCCTGCTACTGTTC
CTATGCAGCCTGTGATCAGTCATCATGCTACTGTTCCTATGCAGCCTGTGATCAGTCAGC
CTGCTACCGATCCTGTACAACCTGTGAATAGTGGTCCTGCTACTGTTCCTGTGCAGCCTG
TGAATAGTAGTCCTGCTACTGTTCCTATGCAGCCTGTGATCAGTCATCCTGCTACTGTTC
CTGTGCAGCCTGTGAATAGTAGTCCTGCTACTGTTCCTATACAGCCTGTGAATAGTAGTC
CTGGTACTGTTCCTGTGCAGCCTGTGAATAGTAGTCCTGGTACTGTTCCTGTGCAGCCTG
TGAATAGTAGTCCTGCCACTGTTCCTGTGCAGCCTGTGAATAGTAGTCCTGCTATTGTTC
CTGTGCAGCCTGTGATCAGTCATCCTGCTACTGTTCCTGTGCAGCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGTGAATAGTATTCCCTGTTACTGTTCCTGTGCAGCCTGTGA
ATAGTATTCCTGCTACTGTTCCTGTGCAGCCTGTGAATAGTAGTCCTGCTACTGTTCCTA
TACAGCCTGTGATCAGTCATCCTGCTACTGTTCCTGTGCAGCCTGTGAATAGTAGTCCTG
CTACTGTTTCTGTGCAGCCTGTGAATAGTAGTCCTGCTACTGTTTCTATGCAGCCTGTGA
ATAGTAGTCCTGCTACTGTTCCTATACAGCCTGTGAATAGTAGTCCTGCTACTGTTCCTG
TGCAGCCTGTGAATAGTAGTCCTGTTAATGTTCTTACACAGGGAGTAAAAGTATCTGAAG
CTATGAGTACAGTTGTGTTTGACAAGAATGCTCCATTAAAACAATTCCTTTCTCCAAAAA
CTGAGAAATTAAAACCAGAACCTGTGACATCTCTGCTGTTGAATATGAAGAAAAAAGAAA
CAGCAGCATCTTCTCACATCACAGCAGCTAAGCCATTACAGAATCCATCTCTTACGGAAA
ATCAGAAGAAACCATTTGTGGGTAGTTGGGTTAAAGGCTTATTAAGCAGGGGTGCTTCTT
TTATGCCACCTTGTGTTTCAGCTCTTAATAGAAATACTGTGACTGATTGGCAACCTTCAG
TGAAGGGAGCAAGTAATTTTGGTGGCTTTAAAAGTAAAAGAATAAACCAAAAAGGCAACA
GATCGACTAAGAAGGCTCATAAATGTGCAGATAAACCTCCAGTAACTAACTCTTTACCAG
ATAACGTGACTCATCCATATACTGATAATGTTGAGCTGCAAGTTTTGAAGAAAAGTGAAA
ATGTCTCCCATGGATCTCAACTCACTCACATTTCTTATGAAAATGGTGGCTTTTCAGCAA
ACCATGAAGACACTGGTGAGAGTCACATACATAAACTTCGTCTGAAACTTCTTAAAAAAC
TAAAGGCAAAGAAGAAAAAACTAGCTGCTCTTCCATCTTCCTCCCAAAATGGAATGCTTC
CCAGTGAAAATTTAGAAAGTGTGTCTCATTGTGGTTCTCCAAATGATTGTGAATCAATAG
ACGACTTGTTAAAGGAACTACAATATCAAATTGACAATGCTGGTAATAAATCTGGGTGTA
CCACAGTTCCTGGTGTTTCTCCAGACAGTAGTGAAACTCATGAACAAATTTTAGCAGAAT
TACTGTCTCCTGCCACTGTTACTTCAACGGAGCTCTCAGAAAATGGGGAGGCTGATGTTA
GGTATTTGGAAGTGGGAGATAACCACATCCCAGTACCAGTACCCAGCGAATTAAGTGTCA
TTCCCCAAAGCACATATCTGAGACAGGACCATAATTACTGTAGCCCTACCAAGAAAAGAT
CAATGTGAAGTTCAGCCAGACTCACTAGCAGATAATGCTCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGGCCTAGGAGCCCTGAGTTGGGATCTCTGCCCGAGTCCG
GCTGCCCGTGGTGGTGGGGAAGGGAGTGTGACAGGCTGAAATGGAGGGGACCATGTCATG
GCGGGGGTGGGGACGCCCCATCCCCAAGATTATGGGCCCTAAAACGTGGAAGATTGGGCG
CGCACACCCTTCAGGAGTTTCCAGTCCGAGGTCATAGGGCCAAGGAGACAGCAGCCGTTC
TGCAGAAAACTATCATGCCTGAGGCTCTGAGGTCACGCGCTCAATCCCCGCGCCATTGGA
GACCAGAGCTGAGCTGTGATGTGATTTTAAATATTATTATTATTGTTCTATAATAATAAT
AGCAACCCAGAAGGCGGCTCACTGGCTGAAGTGTTGGACTCTTAGGCGCGAGGTCCTGAG
TTTAACGCAAGTGCCACCGCAGTGCTCCGACTCTCTCTCGTGTGAGCAAACACATGGAAG
TAAGTGGGGAGGCTGATGCTAGATATTTGGAAGTGGCAGAGCACCACATCCCAGTACCAG
GACCCAGTGAATTACGCTCTCCCCCCCTATCACATATCTGAGACAGGACCATAATTACTT
TAGCCCTACCAAGAAAAATCAATGTGAAGTTCATCCAGACTCACCAGCAGAAATGCTTCT
GTTAAAACATTCAACTTGAAAAGTTCTATTACATAGTTTATTTGCGATGAGTTTTTTTCC
ACTTCGGCACTAAATTATTTAGCAGATGGCACCTTAGACTTACCTCATTTTGATGAGTAT
CTGTTTGACAGTTGAGTGTTTGATAACTTTTTTAGTTTAATATTTATTATCACTCTTGGG
CAAATGTACTATTTTTTTAAGGTAGTGTTTATAGTATTGTCATGAACAAAATGTAAACTA
CTAAAGGTTTTGCTTCTGACTGCTTGCAAAGTAATCTTTCATAAATTAAATGATTAGGAA
TTTGTTCTTGTTGGCTTCATTTTTTACACACAAGACCAGTGAAGATAGCAAAATGTAAAA
GAAGGAAGGTGCTTTCTTTCTGGTAATCTATACCATTGGGTACATTAAATTTTTACACCA
TAACTTTTGGTTATGCTCAGAAGAAAACATTACTTTGAATAAACTCAAACCACTGTGTAT
GGTGTATTGGTGCATGACTGTTGCTCATTGTTGAGTGATCTTAAGAACCAAGGCCTGTTT
CTTATACTGGTAGAAAGTTGTGGAATTTTAGCATCCCTCACACAATTTGTGTCTTTATTA
TGAAGGATTGCAGGAAGCTTGTTACTAGAATTTTAAGTAATGTTAACTGATCAATAAATG
ATCTGACGAGGGGAAATAATATTTTTTATGTTGATACTGCTTTATGTTGGATTCTGTTAA
TTATAAAACATTGATTCCCTTAAACCACAACATTATTATGAGCAAGATACTTTTTATCTC
ATTTAACAGATAAGGAAATAGCATATTTCTAGGGAGGTTTGGAACTGGGTTGAATAAAGT
CATCACAGCAATTAGAAGTATTGAGCGTATCAATATATGTCCTACCTCTCAAGCTTTATT
TAAAGTTTGGATGTTCAAGCAGTTCCCCTGCTGAGGTGATTTCAATTAGCAGTAGTTATC
AAGGACTTAAGAGTGGCAGACTTGAGATAACATACTTTGCCAGGAACCTCACTACTTTGT
AAAAAGTTTTGTCAGATTTAACTCCCAACTCCTCCATCCCCCCCCCATCGGCTAGAGACA
GAAATTAATAGGGAAGGGGGAGATAGAGAGTGAGAGAGACGCCAGTAGCACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 1566..1694, 4107..4358, 4361..4446, 4448..4507, 4509..4744, 11418..11531, 13066..13195, 16631..16756, 22714..22871, 23763..24139, 24147..24149, 24152..24396, 25402..25430, 25449..25837, 25840..25842, 25847..26456, 26458..26497, 27236..27272, 27276..27371
1001..1099, 1566..1694, 4107..4358, 4361..4446, 4448..4507, 4509..4744, 11418..11531, 13066..13195, 16631..16756, 22714..22871, 23763..24139, 24147..24149, 24152..24396, 25402..25430, 25449..25837, 25840..25842, 25847..26456, 26458..26497, 27236..27272, 27276..27371
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved