Erinaceus_europaeus Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RABGGTB
Erinaceus_europaeus
RABGGTB
GeneScaffold_2685
SNORD45, SNORD45, SNORD45
1203..1285, 2175..2248, 4813..4894
7565
AGCCAGAGCTGAGCCACGCACTGGTCTTGGAAAAAACTGAGTAAATAGATGCAGCGCTT
AACTCTTTGCTCTGGGGAGATTCCGGGGCCACTGAACGGTAACCGGTGAAGGCTTGAAAC
AAAAGCTGTAGGAATGGCGGGAGCTAGAGCCGCCTCCAAACTTGCCGGGTAGTTGGTACT
GAAGGAAGTTAGAGAAAAGGCTTGGGGGGGGTGTCGTGGAAGGGGAATTTTGGCGCTTGA
CTATTTATGGGTTGAGTTATTAATATTTGAAGAACTATTTTTTAAATTATTTTCCCATTT
GTTGCCCATGTCTTTTTATTGTTGTTATTGATGTCGTTGTTAGATAGGACAAGAAAGAAA
AGGAGAAAGAAGGGGAAGACAGAAAGGGAGAGAGACCTGCTTCACTGCCTGTGAAGGGAC
TCCCCTGCAGATCGGGAGCCGGGCCTCGAACCGGGATCCTTACACCTGTCCTTGAGCTTT
GCGCCACGTGTGCTTAGCCCGCCTGCGCTACCGCCCGACTCCCGGTGTTTTTTTGTTTTT
TTTTTTAATTTGCATGTTTGATTTTGCGTTCTGGCCGCATAAGAATTGAATTCGAATTGG
TAAGCTGGTTTGAAAAGTACACGAGGGTAGGTCGCTGGTGTAGTGCGGCTGCTTTGCCAT
GTGCACACGACCCGGGTTCTAGCCCAGCCTGCGGTGCATCGTAGGAACTTTCTCCTGCCC
TGTCTATCAGGGGGGAAAAAAAAAGACGAAGGTGGTAAATTTTGGGTCAATGATGACACG
GCATGTATTCTGAATCTAAAGTTGATTAATTTACTTCAGCTCTAGAATTACTCTGAGACC
TATAACACCTGACTCTTACTGGGAGCGCTCTAGTTCCCCCTTCCCCCCAGCAATCGTAAG
TCTAGATAAAATCACAATATGAACTTTTTGATGTGCATTGAGCCCATGGGGTGGAACATT
CAAGGACATAATTGAACGATTGCCTTTTTTCCCCCCCAAAGGGCACACCTCAGAAGGATG
TTACTATCAAGTCAGATGCACCTGACACCTTACTGCTGGAGAAGCATGCAGACTATATTG
CTTCTTATGGCTCCAAGAAGGATGACTATGTATGTGTATACTGATTTTCCCAGAAGTCAG
ATCATAATTTGGATTCTAAAGTATTCTGTATCAATTGTGTGTCACTTGACTAGGTATTTT
CAAGGTCAATGATGTTTTGGCATGTATTATCTGACGTTAAAGCTGATGTGTATAGCACTT
TAGCTCTAGAATTACGCTGAGACCTTGGAAATACTTTGCCTGGCTATGTAAACATAATAG
ATGGCTGTTGAGAGCAGCTGACTGTACCTTGGAAAATACTTAGTGCTGGGGGTGGGGGGT
TGAACCTGGGCTGAACGATGCATGTGCCCCACCACTAAGCACTTCAGTCACCTGCCGGGT
AGATTGCAGTACTCACCGTGGATTGGAGCTCCAACATCACAGGGGAGCATACTCCCATCA
AAAATTTGGGGCTAGGGAGATAGCACAACAGCTATACAGGAAGTTATACATAGTTGTCCC
AAGTTAAATCCCCAGCACTACTGTGAAACCATGACTGAGCAGTGTTCTAGTCCTAGCATT
TGTTTTTTAAAAAATTAAAAGTAGCACAAAAGTTAGGTTCTGAGTCTACCAATTTTTCTA
ATGTTTAGCCAGCATTAGATCTGTTAAACATTTGCATGCTTTAGTCATTTTTGTATTCAG
GTAACATTTAGGGGATGATAGGCTTCATATAGTCAGTATTAAGTCTATACATAATTCAAA
GGGCTGTTTATCTTTTAATCTAAACACTGGTAAGGAAGACGAGATTTAAAAACCAAGTAT
CAGTTTAAACTAACACTGGGTAATTGTGTTTTTTTTTTTTTTTTTTAAGGAATATTGCAT
GTCAGAATATTTGAGAATGAGTGGTGTCTATTGGGGTCTGACAGTAATGGATCTCATGGG
ACACCTCCATCGCATGAATAGAGAAGAAATTCTGTCGTTTATTAAGTCCTGTCAACATGA
ATGTGGTGGAATAAGTGCTAGTATTGGGCATGACCCTCATCTTTTGTACACTCTCAGTGC
TATTCAGGTAAAAACTGATTCAAGTTCTGTGGTGTGTAGTGTATTTTAATTTGATGTGAA
GTCTGCTTACTGAAAGGTCTGTGATGTTTTATGGCATGTATTAGCTGAATCCAGAGTTGA
TGTAAATTCTGAAATAACACTGAGACCTTGGATAAGAAAGTTTATCTTCAGTGTATAAAT
ACTTGAAAATTAGGACTTGTTGAAGGACAGCAAGTACCTAAGGGTATACACACATTGCTG
CATCAAAAAGGAACACATTTTGATTCTGCCAGGCCCCTGTGTGCCTGGGGGAAGGAGACT
GCCCAGCAAATGGGAGGTGGTTTGGAAAGGTGGAGGCCGGGCTTGGGCCCTAGAAGCTAG
ACCTGTAGGTGACCCTTCTCTGCAAGTATTCTCAATTTTATTGCACTTTAGTCTGCATGG
TTGAGGAAAGTCCTCAAATGGTATAGACAAGGGGACATCAGACTAAACCTAGTATTTAAG
AGGCTATTTTAATGTAATTTGTCTTTCGTTACAGATTCTTACTCTGTATGATAGTGTTAA
TGCCATTGATGTAGACAAAGTTGTGGAATATGTTCAGAGTCTACAGAAAGAAGATGGCTC
TTTTGCTGGAGATACTTGGGGTAATGTCAGCTTTATTTAATTATTTTTTTTATCTTGTCT
ATTTGGCTTCTCAAATAGAGGGGAAAGGGGAAAAGGCTCAAACTATAAGAGGCTCTAGGG
TATCCAGTTATATTCTTGCTGCCCAAAATGTAAATATTAAAGTGTCCTATTTTATTGTTT
CTATAACCTATTACGAAAATGAGCTAGACATTTTACTAGTGGTGTATAAGGAGGATTTAA
GTTTCTTACTTTTTCAGGTCCCACTAAGCAGCTGGTCTAACTGGAGTTATGGTCTGCTAG
AAGTTCTAGCATGCACTGTGCTAGTTATAACAGCTTATAGGAGCACTGGAACAGAGGGGG
CCAGTCTAAAAGATAAGGTAGGTAAATTTTTTATGCAATATTTGGTGGCTTTGTAAAGTT
TTTATAAAGATACTTAACTGTTTCAAGGGAAACTTTAAAAACTTTACAAACTTACTGAAT
ATTTGAGTGGAGGGAGGGAATAGTATTTTACTTGATAAATGTAGATAATCTCTACTTTAG
GGATGAATAACAGTGCAGGCCGGAGAGACCAGCTGCTTCATGGGATGTGAAAACCTACTT
TTAATTAGAGGGTAAGTCTGTTGTCAATAGTGAAATTCATTATCCTTTTGGTTCTAGTAC
CTCACCTTTCTGGGTACTTATTTAACATTTATTTATGGTTTGATAATTTGATTTGGTTAG
TTTGTTTCTTTAGAAATTCAGGCTTAGCTTTTTGGAATTAACATATGCATATTAGACTTG
AACTCATAAAAATGATTGTATGACCTGGTAACATTTTGGTTTCTCTCTTTCTCCTGAGAA
ATATGAGACAACAAACGATTGATGTGCGAGACAAATAGGAAGCGACAGAGACATGATAAG
ATCATGAATCAGTAGTAGATAAATTCTTATCAAAATCAAAGTGCTAGAGATAACAACTAT
AGGCTATTCGTGCATATACAAAACAACCAGCAACAATCACTCTGACAAGTTCATCTGACA
TGCTATATAAGGGCTCACATGCGTGGTGAGTATGATATACAATTAGTGGTTGAATACTAA
GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCTCATTTCAGATAGACACATGTATTCATCCATCCATAGAGCCCCACCTGCTTTGTA
AGGTGACATGTTACAGTGCCAGGGCTTGATCTAGGGCATAGAAGTCATACAGTCTATTGC
TGAGTCATTTCAAGGTCGATGATGTTTTGGCATGTATTATCTGACTTACAGCTGATGTGT
ATAACACTTTAGCTCTAGAATTACGCTGAGACCTTGGGAGCAATTGACATAGTATTGAAA
CATTCATTTAAGCCTAATATTCAAATATTTGGATTATCTGCACCTTAAGCATTCAGTTGG
TGCTGGGTTGAACTCAAGCTATGTAAGTGCAAGGCATGTGCTCCCCCACTAAGCAGTACA
CTTTGAGCACATTCTGCTCCTCTGACTTTCAACACATTCTGCTCCTCTGACTTTCAACAA
TAAAGTTGTTTTGCAACCAACATTAATGAAGTGAACTGTTCACATAGTATGATTAATACA
TCTGGATGTTTGTCAAAAATAAGTTTAAACTATCGAATAACTGGTAGTTTCAGTTTTATC
AAAATTATACACATCTACTTTATGTCTGTAATTTTAGATCTATTGTTGCACAGGATTCCT
GGCTATTACTAATCAGTTGCATCAAGTAAATTCGGATTTACTTGGTTGGTGGCTTTGTGA
AAGACAGTTACCATCTGGAGGACTCAATGGAAGGCCAGAGAAGGTAGGGATGGCATCGTA
AGATACAGGGTTCTCATAGTTTGGTTTTTCAGTTACTTAACTGTATCCTGTTTCTGTAGT
TGATAATCTATTTAAATAACCTTTTTTTTTTATCTTATTGGATAGGGACAGCCAGAAGTC
AAGAGGGAAGGGGGTGATAGAGAGGAGAGAGAGAAAAGCACCTGCAACACTTTCACTGGC
AAGGCTTTCCCTTTGCAGGTGGGGACTGGGGCTCTCAAACATCCTCGCACATGTGCACTG
AAACATGTGTGCCACCACCCGCCCCCATTTACTTTTTTACCGCAAAGTATAGTTCAGTGT
TACAAGCTCTGTATTCCTCAGAATCTTCCCCCAACCACCATCATCCAGTAGTTTCCCCAT
GTTAAACTGGAGTAAGAGTGCTGACATTGTGCATTTCTTCCCCTCCTAGTTACCAGATGT
GTGCTACTCGTGGTGGGTGTTGGCATCCCTAAAGATAATTGGAAGGCTTCACTGGATTGA
CAGAGAAAAACTGCGTGCTTTCATTTTAGCTTGTCAAGATGAAGAGACAGGAGGATTTGC
AGACAGACCAGGAGATATGGCAAGTATTTTTCTGATAGATTTTGTTACCAGTAGGAGTGC
CATTTCCAGTAAATTTCCAGATAGGGTCCACAGAGAAGCCCTTAGGCACACGAGGTCTCA
AGCTTTATTGCTGCCCTGCACCACCTAGGCCAGAACTGAGTGGTCCTATGGTAAAAGTGA
GCATGATACCACAGCACCTTGGGGACATTCAGTTCTGTGGGGCCAGGCTTTATCCTGGGT
TACCTGCACTGCTAAACAGGCACCCTTGCCAAGTGAAGTATCTTTATGACCCAATTCTTT
GTATTGAGAATATAATGACTAGTAAGCAGTTATTAACAGATACTTAATCACAAAATGTCA
AGGTGTAATAAAATAACTGACAACCACAAGTTAACAGCTTTATTTCAAAAGACAAATCAT
TCACATAGTTTGATAAGCTTCAGTGTTTATTTTGTATTGTAATACCCTATACATTGCTTT
AATAGGTGGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAG
AACAAATCAAGCCTGTTAGTCCTGTTTTTTGCATGCCAGAAGAAGTACTTCAGAGAATGA
ATGTTCTGCCTGAACTAGTGAGTTAGATTTATTCAGGAATATGTCTCAGTGTAGTTTCAT
TGTCTTTCTTGTATTTGAACAGTACTCAGATTTTAAAAACTGTGCTTATAATTTGTATAA
AATTGTGTTAATTTAAAAATTGTGTTAGTTTCAATAAATTATAATAACTCAATTGTAAAA
ATAAACACATTGTACCTTCAGCTTTAGATCTTGCATCTTAGTATGGTTTGTTTATGCTTC
AATGTGTTCTTTACACATGTCATAAAGATTGTTAACTGGTAACAGATTATCCCCACATGT
AAATATCCCCTTATGTATGTTTTTCTCTTTGAATAAAGGATAACAGTTGACTCTGTACTT
AAGTCTTTTGGGTGGAAGTACAAGTTCTCAGCTTTGGATGTCAGGGATGGCAACAAGTAC
AAGGTTCTAAATACAGTTCTACCACCACATGAGACCGTGCAGAAGGTGGAAGGTCTGTCT
TTTGTAATTGCTTCTCCATTGGACATGGTGGCTCCATACTTACATCCTGTTTGCTTAGTG
GGGCAGGGCTCTGGAGAGATGGGCTTCGAGGACATACTGTGAGGTTATCTGGTATTATAG
TTAGCATGTGCAACTTGGCTGAAAAAGCATCAAGATACAAAGCAGGACAAATTGTATAGT
AATCAAGAACCTAAAGGTAGGAATATAATAACATGAGATGGGGGGGGGTCTATTTTGGAA
AAGGCTAGGTTTATCCCAAGGGGCCCATGACTTCATAATTTTTTACCTGAGCCCAACAGA
TAACATGCAGGTGGACCAAAGGAATTATCTGGGGAGATGGTGTCAGAGTTGGAAATAGGA
CTAGAAATATCTATCAGGGAAGAGTAACTCCCAAATGTGCAAAAAGTATATAAACATTGA
TAACTATAAACTCTGGGGCCCATATTTGGCACAGGAACCTGTAACCTGCAGCCCTGTAGG
TAAGTATGAGCTCTTATGCTGTAGTCAGCTGGGAACAACTGACTATGGGCCGAACTCATT
ACAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1909..2106, 2614..2719, 4101..4153, 4254..4364, 5257..5382, 5809..5962, 6380..6381, 6425..6565
1001..1108, 1909..2106, 2614..2719, 4101..4153, 4254..4364, 5257..5382, 5809..5962, 6380..6381, 6425..6562
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved