Erinaceus_europaeus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus TOMM20
Erinaceus_europaeus
TOMM20
GeneScaffold_5016
SNORA14
1389..1525
13291
AGTTTCCTGACACAAGCCGTGATGCCCAGGGAAGACAGAGTGGGCCGGGAGGCCCAACT
ATTTCCTCAAGATCATCCAATTTCTGGATGATAACCAAAATGAATCATTGTGGAGTAGAC
AACATGGGCTCCAGTAGTAGAGTATAGTTGATCTGCATACCCTGCATTTCAAGGCCTGAG
ACTGAGGTCCCAGGTTCAATCTCCAGCACCACTATAAGCCAGAGCTAAGCAGTGCTCTGA
TGTATCTCTCTCCTTTCATCTTTTTCACTAAAACAAATTTTAATAATAGTTCTAAAAATG
ACTGAAACTATGCCTCACATATGGGTCGGCAAAAATAGCTCACTTGAAAAGTGCACCACA
ATGTGGTCCGAGAGGTGGCACAGTGATAAGGCTTTGGACTCTCAAGCATGAGGTCCTGAG
TTCGATCCCCAGCAGCACATGTGCCAGAGTGATGTCTGGTTCTTTCTCTCTCCTCCTATC
TTTCTCATAAGTAAATAAAATATTTTTAAAAAATAGTGTACCACTTTGCTATGTGTCAGA
CCCAGATTTCAGCCAGGCCAAGTTGATGTAAACTTCTGAAAAGTATCAGCCTAAGATAAA
GTATTTGCACTCAGCAACCTCTCATCTCTGACAGAAACAAGATCTTTGCCAAATATAAAG
TCTTTTGAGCTGTGCAGAAGCCACCTCACCCCCTCTATACATCACACTCTGACTTTTAAG
GAAGCAAATCACCGCCACCAACGCCGCCAGCCGCCCCCTAAGCTTTCAGCCCGCAGCGAC
GAGTGCCCCAGCGCAGGCGCAGAAGCTGTGCAGGCGCTTCCACTCAGGCAGCGCCGCGGA
CGTCTCCGAGGACCTTGGTCGATTAGGGCCGGAAGTGGCGCGCGCTCGGCCTTTCCGCCT
CGCTTGTGGCGGGCGTCAGGTCAGAGCGGCTTGGTCCGCTCTGGGTTCGCGGCCAACGTC
TTCTTGTCGGACCTCTCCGACCCCACTCCGAGGGCGGGAAGATGGTGGGCCGGAACAGCG
CCATCGCCGCGGGTGTCTGTGGGGCTCTCTTCATCGGGTACTGCATTTACTTCGACCGCA
AGAGACGGAGTGACCCCAACTTCAAGAACAGGCTGCGAGAACGTGAGTGGCTCCCGCGCC
CTTGTGCTGGCTGCTTCCTGGCGCGCGCCGGGCGCTCGTGTGGTGTCGCCGGCCCGGTGC
TACTGCCCCGTGGTCCTGCACGGCTGCCTCCATTTTGGAGGAACACATCTTCCCATTTTG
TCTTTCTCATTTCTACTTTCGGCCGTGTAGGTGCATTGTAATCGTTTCTTAAGCTAGTGA
GTCTTTAAAACTTAATTACTATTATTAGCAGATCTGCGCTCGAGACCCAAATACCAACCC
CCTCGTGTTGTGCATTCTTAAACCCTCTTGGCAGTTTCGTTCTCAACGCTTCCAAGATAT
GAGTGAATGCTATAGAAATTGGCAGGGGAGTCCAAAGGGCTGTGCTTCCTCCTGTGGCTC
AGTCTTATTTCAGACCTGCGACACCTTCAGATGTTCCTGCACGGAGACTGTCGTACCTGC
GGCACCTGAGGTCCCGGGTCCACTTTAAGTCCGAGCTGAGCAGTGCTCTGGTTTTAAAAA
AAAAGGGGGGGGGACACGTATGAAACTTACTGGATTGCTCAGTCAAGTACAGTTTCTGAA
GCTAACACTGGTATGTTACTAAGGTTCGGGACGTACAAAGCCGTGGCTGTTCTGCTTTAG
CCTGGCTGTTGGCGGTGGACGCTCGGCCCACGTGGCTTCTGGCTGCCATGTTCGGGCACC
CGCTCATCTGGACCGCGTGCAAGCGGGGAGCGAGCTCACCCGTCGGCTTTTAGGGGCGAG
GGGCTGTAGTGATTGAGAATGGCTAGGGGCTGGGGAGGCAGCATAATAGTTCTGCAAAAG
ACTTGCATGCCTGAAGCTCCAAGGCTCCAGGTTCAATCCCCAGGACCTCCATAAGCCAGA
GCTGGTGTTTCTCCTTCTCCCCCCTCCCCATACATGTTTCATTAATATAAATTAAAACAT
TTAAGAAAACACTTAGAGGGTTTCAGATGCTCGAGTATCCAGGCATAGGTTGGTCCAAAT
AAATAATGGACACACTCTACGAGTTTTCTTAGCTTGTAAAATGAATTTAGGCTGTATGTC
TGACTGCTTTTTTTTTTAATGTATTTATTTATGAGAAAGATAGGAAAGAACCAGCCATCA
CTCTGATACATGTGCTGCCGGGGATCTAATCTAACTCCAGACCTCATGCTTGAAAGTCTA
GTGCCTTAGCCACTGTGCCACCTCCCGGACCACACTGCCTGATTTTGTGTGAATTACTTA
TCTACAACTCCTGACATAAATCTGACCTTATTGGAGCTGGGGAATAACCTGCCTGTACTT
TCAAAGATTGTGAGAATAACAGAAATACGAAGTTATATTTAAAAGGTGGATTAGTGTGGT
CCAGGAGGTGGCACAGTAGATAAGCGTTAGACTCTCAAGCGTGAGGTTCCCAAGTTCAGT
TCCCGGCAGCACATGTACCAGAGTGATAGCTGGTTCTTTCCTCTTCCTGCTATCCTTCTC
GTGATAAATAAAATGTATTTTTTAAGTGGATTAGTGCTTTCTTTGGATAATGCAGTCCCA
TTGTTGAATGAAAACTATATGGATATATATTTTTAATATTTATTCTCCTTTGTTGCCCTT
GTTTTATTGTAGTTATTCTTGTCGTTGTTGGATAGGACAGAAAGAGAGGAAGGGAAGACG
GGGAGAGAAAGACACCTGCAGACCTGCTTCACTGCTTGTGAAGTGACTCCCTTGCAGGTG
GGGACCCCGGGGGCTCGAACCGGGATCCTTACGCTGGTTCTTCCGCTTTGCGCCACGTGC
GCTTAACCCACTGCTCTACCTGCCAGACTCCCAAAGACTTTTTTTTTTTTTTAACCAGAG
CACTGTTCAGTTCTGGCAAAGATTAATTTATAAGAATCAAAGCACGATGCTACTTCCCAG
GCTGCAAAAACTGATTTTTGATTGAAATCATTTGATGGTCTCTTGAGTAAATACAATTTA
AATTCACTAAATTGTTGAGTTGTATGGTTAAGGTTAGATATGGGTTTTTGATGGAGTCTC
TCTTTTTTTCTTCCATTGCTGAAATTATCAGGACTCTTAAAGCATGATGTTTTTGTTAGT
AAAGTATTGAGAAGTGAACTGAGTGGCCTCCTGGTCCCAGCTGCATAGCTCTCCAGTTCT
CACATCTTATTGCTTGTTTTAGTGGGTGAGCTAGCTGTCTCTCAGCCCTTTAAGCATATG
TATATATTTTTTATCAATGTAAATAGTCATCAGGAGGAGTCAGGGATATCTGTGCAGTAG
TATGAAGAAAACATGATGCAAGAGGTCTCAGGCTCAATTCTAGGCACCAATAGCCCAGGG
TGGTACTGTTCTCCCCACTCCCCCCATGGGGGGACAACTTCAGGAGCTGCTGTAGATGTC
TCTTTCCTATCTCCAACCCACCAACCCCCCCCCATGTCTATCGAAAAAGGAAGGGAAAAA
GAAATGGCCACTGGGAGTGGTGGATTCCTCCTACAGACACCCAGTTCCAGCCTTAGCCCT
ACTGGCAATAAAAAAAAACAAAGTAATATGTAATCAGTATCAAACTGTTATAAGGTTTAT
TTTAGCTATGAGACCTCTTTTCTTGCCTCTAGGACTTGGCTGTTTATCTTCCCCAAGATC
AGCCGGCTAGTAAGTGGAAAGGACACAGAACCTTTGCTTTCACTGTGCCAGTATCCTTTA
CTTGAGTTTACAATGAAACAGCAATTTAGTGTCTACTATTGATTAATTGTTGGTTAAGAT
TTTAAGCAGTGCTTACTAAGGTTTGTGGTGTTGCTAGTTTATATCAGATACAAAACAAAC
CAAAAAGGAATTTACATTAAATTAAGAATATGGGGGGGGGGTATTTTTACCAGAGCACTA
ATCAGCTCTAGCTTGTGGTGGGGGTTGGGAGGGTTAAACCTGGGACTTGAGAGCCTCAGG
CATGAGAGTCTGTTTGCATAACCATTATGCTGTCTACCCCCACCCATTAATTAGCAGTAT
ATCTTTTAAGCATTATATTCTTTTTTTTTTTTTTAGCCAAGTGTAAGACCTCTTAACGTT
GGTGGTTTAGTTATTACATCAGTTTTGTGTCCTTTAAAGGCTGGAGGGGGGGTGAGAGGA
ACTTGATTTGCTTGTGATAATTTCTGGGGAGATTCTGCTGTTGTAATTGCTGTCTATTCT
GTATTGTTGATCCTGGATGCTCTAGAGGGAGGGAAGGTTCCTGTGCAGAAATGTCACATT
GCTCATGACACATTGACCACAGATACTGGTGACCTTGACACATGACTACCAGAGAAGCAG
AGAGAGCCCAAGAGTCCAGAATGCTTGCTTGCTGTCTTGCCACTAGGGTTGTCTCTTGGG
CTCAGTGCTGCTACTACAGTCTGCCCTCCCCCCCCCTTTTTTTCTTTGATAGGACAGAAA
ATAGTTGAGATTGGGGGTGATAGGCCCATGCACTTGTGAAGGCCTGTCCCCTCCTTTTTT
ATTGCCTCTAGTCACTATGAATCCTCTATGAGTCCTCTGCTTCTGGCAATCACCCTCTCC
CCTTCCCCCCTTTTATTGGATAGACAGAAATTGGGAAAGAGGGAGAAAGACAACTTGCAG
GATTGAAGTGGCTCCCCTGAAGGTGGGGGACTAGGGGTGTGAACCTGGATCCTTGCATGG
GCCTTAACACTTAGTGCTTATGGCCAATTAACCAGGTATGTCCTGTCTGTCCCCTTTTCA
AAAAATATTTTATTTATAAATTGGATAGAGCCTGAAGAGAGAAGGGGGAGAGAAAGATAC
TGCATTTGGCAGAGCCAGCCAGAAATGGAGAGGGAAAGAGGTGTTAGAGATACCTGTAGA
ATTGCTTCGCCAATCACAAAGCTTTCCTCCTGCAGGTAGGGACTGGGGGTTCAAACCCCA
TCCTTGCACATTGTAACATGTGCAATCGATCAATCAAGTGCGCCACCACCCGGCCCCCCA
AGAATGTTTTCTGAATAGAATAAATGTCATTGCGTAGCTTTTAATTCTTGTTTCAAGAAT
AAATTGAAAATATTTTCTTGCAGGAAGAAAGAAGCAAAAGCTTGCTAAGGAGAGAGCGGG
ACTTTCTAAGGTAATGATCAAATCTATTTTTTATTTTTTTCCAGAGCAGTGTCCAGCTCT
GGTTTATGGTTAGTGTTAGGGACCTCAGCCTCAAGCATGAATATCTTTTTGCATATCCTT
TGTTCTATTTGTTTAGCCCATTTCATAGATACAATTATTTTAAGCTACTTCAATGTAATT
AGCTAACCTAGATAGCCAATAGCAGGGAACTATCCACAGTTGCCTGTAAGAGATCCTAGG
TTTTCTCAAAAATCATTGTGAAAAGGCTGACCTCCATGTGCTGTGTATTTTTCCTTTCTG
CTGCTGCTATTTTAAAATAATTGTGTGTGTATGTAGATTTAACAGCTGAGAACAAGAGTA
TATGCAGTGCCTGGGATCAAACTTGGGGCATTGTTCAAAAGTCCCATATTCTGCTCTGCT
CTTCAGTTGCTATATTATTTGTAGGAATAGTTAATTCACCTCATCTCAGGCTATTGGGTC
ATTCATTAGTTGTTATATTTCAGGGACAATAAGATGATGGTATCCAAAAGACACATCAAG
AAATTAGGGCTTTCTCTTTTTTATTATATTTTATTTTCCCTTTTGTTGCCCCCTTTTTTT
TATTGTTGTAGTTATTATTATTGATGTCATCATTGTTAGATAGGACAGAGAGAAATGGAA
AGAGGAGGGGGAGAAAGACACCTGCAGACTTGCTTCACTGTCTGTGAAGAAACTCCCCTG
TAGGTGGGGAGCGGGGGGGATCCTGATGTCAGCCACTGCGCCTCACTTTGCACCGCATGC
ACTTACGCCCTGTGCAACCACCCAACTTCCAGGACTTTCTCTTTTTCCTGGGGCCTCACA
TGTGTACTGTACAGCAGGCTCAAAACCTCTGAACAAAAGCCACCAGGCTAATTTTTTCTT
TATTTTTTTATATTTATTCCCTTTTGTTGCCCTTGTTTTTTATTGTTGTAGCTATTGTTG
CTGTTATTGATGTGTTCTTATTTTTTTTAACTATCTTCATTTATTGGATAGATAGCCAGA
AATCGAGAGGGAAGGGGGAGATAGAGAGGGAGAGAGCTGCCTGCAGCACTGCTCCACCAC
TCGAAGCTTTCCCCCTGCAGGTGGGGACGCTTTCCCTGTTTCCCCCTTCTCAATCTCTAT
CCAGTAATAAATACTTAAAAAAGAAAGAAAGAAAGAACCAGATATTGCTCTGGCACATGT
GCTGCCCAGCTTTGTACTTAGGACTCATGCTTATCTTTATTGATAGAGACAGCCAGAATC
AAAAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATGCTTAGCTGTTAGTAATTAAGAAAGTAGTTCAGCAGA
GAACGGTCGGGCATTGTGATTCAGAAGTGTATAAGAAATCAGGCATTTTCCAACAGTGCT
ATTCCCATATGGTACCAAACCTTGAACTTGGTAAGTCATATACTCTAGCAGGAGACCCAT
CTCAAGCTTCTCAGCCAGTTGTTTTGAAGTAGTAAAGCACAAGCTATCAGAGGAGGGGAT
GGGATACGGAGTTCTGGTGGTGGGAATTGTGTGGAGTTGTACCCCTCTTATCCTATGGTT
TTGTCAGTGTTTCCTTTTTATAAATAAATTTAAAAAAAGATTATTCATACCCGCTGGTTC
AGAATTCTACCAGCTGACTTTATTTTTAGTTGTATATGTGGATGTTGATAAAAGGTTTTT
CTGCCCATTTTTTATTTTCATAGATCCTGCATCATGATTATTTTTATTTTTTAATTATTA
TTTTAAAAAAATATTTATTTTATTTATTCATTCGCTTTTGTTGCCCTTGTTGTTTTATTG
TTGTAGTTATTATTGTTGTTGTCGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGG
GGAAGACAGAGAGGAGGGGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTTTGAA
GCGACTCCCCTGCAGGTGGGGAGCCGGGGTTCGAACCGGGATCCTTATGTCGGTCCTTGT
GCTTTGCGCCACCTGTGCTTAACCCGCTGCGCTACAGCCCGACTCCCCATGATTATTTTT
AATGATTATATAGGGTTATCTACTTGATAAAAGTATTATATGGCTTGTGTAAGTAAATTA
AGTAAATATTACTAAGTACTTTTTTTTTTGCCAGGACATTGCTCAGCTCTCGTTTATGGT
GGTGCAGGGATTGAACCTGGGGCTCTGCAGTCTCAGGCATGAGAGTCTCTTTACTAACGA
TCATGCTATCTACCCCTGCCTGTGTGTTTTTTCTTTCCTCCCTTTATGGAGCATCAGGGA
GTGAGTTTAATTTTTTTATACTTAGAGATAGAAGCTTGGGGGCGGTGGTAACACATCTGG
TCGAGCACACTTATTAGTGTGCTAGGGTCCGGGTTCAAACACCCAGGTGGTCCCCAACTG
CAGGGACGGACTAAATTTCATGAGTGGTAAAGCATTGCTATGCTGCAGGTTTCTCTCTTT
CCCAGTCAATTTCTGTCTATATCGAAGTAAATAAAAAGAGCTATAGACTTTTAAAAAATT
TATTTATAAAAAGGAAACATTGACTAAACCATAGGATAAGAGGGGTACAACTCAATTCCT
ACCACCAGAGCTCTGTATCTCATGGTACAGACTTTTTTTTTAAGAATTTTAAAAAAAAAT
ATTTATTGTTGTAGTTATTGTTGTTATTGACGTCATCATTGTTGAATAGGACAGAAATGG
AGAAGACAGAAAGGGGGAGAGAAAGATAGACAACTGCAGACCTGCTTCACCGCTTGTGAA
GCAACTCCCTTGCAGGTGAGGAGCCGGGGGCTCTAACCGGGATCCTTATGCAGGTCCTTG
CACTTTGCACCACGTGTGCTTAACTCGCTGCGCTATTGCCGGACTCCTAGTACATACTTT
TATCAGAACACTGGCGTATGATAAAGTTCAACTTTGGCTTGTAGGGGGATTGAACCTGGA
AGCCTCATTATGTGGGAGTCTTGCATAATCATTATGCTGTCTCCTTTGCCAACTTGGAAA
TAAGAGGGAAGAGGAGGCACTGTGGAATTCCCTGGTGTTTCCATTTGGAAATACCATTTT
GTCCAGTGAGTTAAGCTGAGTATAAGCAAAGCCCATGGGTCTGGAGAGCAGGCCTGGATC
AACAGTTGCTGACCTTGCACCTGCATAACCACTCAGGACCCCAGAGCAAACCTACAAGGA
CTGATTTTTCTTGGCATTTATTTATTTCTAGACACTAAATCGTGCTGGTGCTGTGGACAG
GGTGTTGTACTTTTAAACATTAGTTCCCAAGTTTGATCCACAGCATTGCATGTACTAGAC
TGGTGTCTGTATTATTCTTTTTCTCTTTTAATTAAAAAAAAAGGCCTTTTTACTTAAATC
ATTTTAAATTAATTAAACAATTAGAAGACACCAGTGAATTTAAATGTTCTATTTCCGAAC
AGTTACCTGACCTTAAAGATGCTGAGGCTGTTCAGAAGTTCTTCCTTGAAGAAATACAAC
TTGGTGAAGAGCTACTAGCCCAAGGTAGGTCATTTTAGTTAATGTGCAGATTTTATTGAG
AATAAATATTGTGTCTTGGGAAATTATTAAGTAGATTGAGCATTGCACTTAGAAACTTGA
GGTCCTCACCAAGGGCAACAAAAGGGAAAATAAATAAATATTTAAAAAATTTAAAAAGAA
AGAAACTTGAGGTCTTGAGTTCACTTCCCAGCCTTGCACATATCAGAATGTTCATTTTCA
ATTTTCTCTCTCCAAAGGTGGGTTTGGTGTGGCTTTTTTTGTTTGTTTTTTTAATTACTG
GAACTCTGTCTTATGGCGGTAGAGGGGTAATTTCGAACTTCACAGATTCAGGCATGAGTC
TCTGCATAACTACTGTGCTGTTCCCCTATTCTCCCATAGGCCTTTTTAAAAGAAATAGAA
ATATGAGATTTGTCATAGTTCAAAATACTTGGTTTCAGATATGCATGATAAGGAGAACTA
AGTACTTAAGCTTAACAAATGAGGTAACATGTAATTTAGAGAATATAGGCCCAGGTGGTG
GCACAACTGGTCAACCACACACTACAGTACAAAGACCTGGGTTCAAGCCCCTGGTTCCTA
CCTGCAGGGGGAAAGCTACACAAGCGGTGAAGCATGGCTGCAGGTGTCTCTTGTCTCTTT
TCCTTTTTATCTCTCCCCTCCCCTCTCAATTTCTATCTATCCAGTGATAAATAAAATAAA
AGAGAATATAGTCTTAGTATTTTGTATAACTGAATGAAGGGGAGAAGAGACTAATAATAT
CATTTGCTTGGTCAGACTTTCACAGTCCATATAAAAATAGTTGCAACTGGGAGGCGGGCT
GTAGCGCAGCGGGTTACATGCAGGTGATGCAAAACTAAAGGATCGGTGTAAGGTCGCTTC
ACAAGCTGTGAAGCAGGTCTGCAGGTCTCTTTCTCTTCCCCTCTCTGTTTTTCCTCATCC
CTCTCCATTTCTTTCTGTCCTATCCAACAATGATGACAACAGTAATAACTACAACAAAAC
AACAAGGTCAGGGGCCAGGTAGGTGGTGGCGCACCTGGTTAAGCGCACACATTACAGTGC
CAAGGACCCAGGTTCAAGCCCCTGGTCCCCACCTGCAGGGGGAAAGCTTTCACAAGTGGT
GAAGCGGGGCTGTAGATGTCTGTTTCTCTCCCTCTCTATCTCATCCTCCCCTCCACCAAA
GTGAGTGAAACCATCTGGTTGTTGTCTTTCACCAAAAAGACACAATATCATCTTTCTTGA
TTGCAGCGTATTATTCCATGGACTATATATCCCATTATTTTAGCCAGTCATCTGTTGATG
GGTATTTAGGTTGCTTCCACTTTGAGCTCTTAACAAATAATGCAGCTATGAACGTAGGGG
TTCATATGCCCCCCCCCCTGCATCCAGAGTTATCACTGGGGCTTGATGTTTGCACTACGA
ATCCACTGCTCCTGGAGACTTATTTTTTTCCTTTTGCTGCCCTTGTTTATTGTTGTTGTT
ATTGCTGTCATTGTTGGGGAAAGAAAGGTGCAGACCTTCACCACCTGTGAGTTGAAACGA
CACACTCCCCCACCCCCTGCATGTGGGGAGTTGGGGCCTCAAACTGGGATCTTTGAGTCG
CTTAATCCATTATGCTGGCGCCTGGCTGTGGCCCCCCCATGTCACTTCTAATTAGTATTT
GAGTGATCACTAGGTAAGTGGCGAAGGTATTTTAATTACATGTTGTTTTATGCAAATTTG
ACAGGTGAATATGAGAAAGGTGTGGACCATCTGACAAATGCGATTGCTGTGTGTGGACAG
CCACAGCGGTTACTGCAGGTGTTACAGCGGACTCTTCCACCACCAGTGTTCCAGATGCTT
CTGACTAAGCTTTCCACGATTAGTCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTATTGTAGTTATTATTGTTGTCGTTGTTGGATAGGACTTGAGAGAGATGG
AGAAAGGAGGAGAGAAAGATAGACACCTGTAGACCTGCTTCACCACCTGTGAAGCAACTC
CCCTGCAGGTGGGGAGTTGGGGGCTTGAACTGGGATCCTTACACTGGTACTTGTGTTTCG
CACCACGTGCGCTTAACCCGCTGACCCCTTCTTTCTTAACTCCGCCTCTCCCCCATGAAT
GGATAAATACTTCTTTCAGTAATTTCCTGATTACTTTTATGAGACCATGATAAGGTTAAT
GATAAACCTAGCTGGCATACCCTGGAAATTAGGTGTTTGGGATGATGGCCTACCACTGAT
CTCACTTGTCAAAAGGTCCCATTGCATCTCCTTTGGCAAAGGTACACTTTGAGTTTGGAA
CTATATCTGTTCCATGTTTTAATTTTCTCAGTTGATGTAATTAAAGTTAAAATGATAAGT
TTGAAAGTGACTATCAAGAAGAGTTCCCAACCTTTTAATGATAAAGAGTTGAAAAACAAA
AAGAGTTACTTGGTCTGGCTCCTTTTTATTTAGTTGCTTAACTATATTGGAATCCTCTGT
TTAGTAATACCAGCTCTTTGAAAAAAGCTCTTAGAAATTTGACCTGAGTGCAGGGATAGA
TAGTATAATGGTTATGCAAAGACACTCATGCCCAAGGCTCCCAGGGTCAATCCCACCACC
ACCACAAGCCAAAGCTCTTTATATGGTTGTCACGTTTTATCTGAAAGTGTTTTTAACACG
CTTATTTCTTGTATAATGAAGACGAGCATTTTCATACCAAAAGGGAAATGTTTGGGGTAT
GGAATGATTGATAACTAACCAGTATTATAAGTTAAAGATGTATTTGAAATAATGAAATTT
TGCTTGTATGAAAAATTTTTGTTGGCAAAAAATAGGATGTTGTCTGGTTGTCTTTTAAGT
TTGGGTTATTTCTGTTTGGGACCCTCTGGGCTTCTTGAACCTTTGTGCCTTTGATATTGT
CTAGACTAGAGAAGTTCTGAGCTATTAAGTCCTGAAGAATGCTTTCTTCCCCTCCCTCTC
TTTCTTCCTCTGGTAATAATAATCATGTATGGTATAATGTTATTGACTTTATTAACTTGA
TCTTTGAAATGGTGTATAAAATGTTTAAGTATTAAAATTTTCCAGAGTAAGTAAATTTTT
GCAGGATTTATACCTACAATACTTTTTTTTTTGATGGATTTTTCTCTCTTTCTTTCCCCC
CCCCCAGAAAATTGTGAGTGCTCAAAGTTTGGCTGAAGATGACGTGGAATGAGAAACAAA
TGTTAACATAATCCAGTTTAAAGTTTTCGAACCCTTAACTTAGAAGATGAACAGCTTGAG
GGGGGAAAGGGCAAATACACTTCATTATGAACTGTCCTACACGGAAATCTACCAAAGTTA
ATTTTTACTTTGTGTAGAATCACTTGTCTCTTATTTATTTTTCCCAGTGAAAAGGTGTAT
TTTGATAGCTTTTCATTTTATAAATACACTATGAGTTACTGAAATATCATGGACTTGTTT
ATTCTGAAATCTGTGATTGTATATAAATTGGCACATTACTTACATTAAAATACTTAGTAC
TCAGTTTTAATAGGCAAGGAAAGTATAACAGAAAGCTGAAGAGTGCACTTTTTAAAAACA
GAACATTTTGCTAATAGATAAGAAGACTTGAACTTGACTGGGTTTATTAAACTGAGCTTT
AAAAAAAAACTTGAGGTCATTTGATCTCTTATGTATGTGAGATGCCCTTCTGTGCTTATA
TATTAACTCCACCCTGTCCTGTGTTGTCAGTCTTGACCCCCCACCCCATTTTTAAATCAG
TGAGCCTAGTATATTCAGGATGATCATCTTGTACTGTATATATGGAAATCACACTGGTGA
TGAGTATACATATGTATAGCCCTAATCTGACCATATGAACTTTGCCGGCTAACACCTATC
CCTCTTTCCTCACTTATAAAATGAGGAAATTGGACAACTAACTCAGAAGTGTTCCTTTCA
GCTTCTATTTTTTTTAGTTCTGTTTAGCACCTTCAAATCCAGCCTTCTGAGGGATGTATT
TGTTCAATGACCAGGCCCATGCATTATATACACACACATGTCCATCCTGACTTTTGCATG
CTTGCCTAACAGTACTTCTGACCTGATTTTCTTAAGGTATGTTGTATTGATATTTGACTG
AAATCGTATAATCTATCATTACCCTTGTAAATTAATCTGAAAATCCTTTAAGTTAACTGT
ATCTCCCTAAGTCTTCACTGTGGTTCATTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 5123..5169, 8942..9023, 10744..10886, 12247..12291
1001..1121, 5123..5169, 8942..9023, 10744..10886, 12247..12288
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved