Erinaceus_europaeus Locus PLAA
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus PLAA
Erinaceus_europaeus
PLAA
GeneScaffold_4086
SNORA62
4729..4865
73099
TGTGGGACTTGTAGTTCGAGAGCAGCAGTCCGGTAGAAAAAATAAATATCCGCTAGAAG
CTCCCGTTCGGAAAAGACCCCGGATTGAGCTCCTCCAGCAGCCAGCAGCCGTTATCCTTT
CTTCTTTTTTTTTTTTTCAGGGGGGGCCGCAGTTTTCAGTGCTTTGGTGGGGAGCCATCC
CTCAGCTCCGGGTCGGCCTCAGCCGTCGGGACGCGCAAGCAGTGCGTCATGGCGGGCCGG
GGCAGATGATAAATTCCCGGTGTGCTTGTCAGTGTTGCTGTGTCACTCGGGCCCGCTTGG
CGCGCCCCTTCCTCGGCCGCCCTTCCGCACCGGCTCTTTGGCTCTTCCGGTCTCCGACCG
CTGCTCACCTGCAGACCCCGATCCCCGCCGCAGCCCGGCGCACTCCCGGCCTGCGCAGAG
TACTGACTTCGTGCGGTGCCCGATTCCGGGTGCCGGACGCGGAAGGGCCATGGCGAGCGG
CGCCGCCCGGTACCGGCTGAGCTGCTCGCTCCAGGGCCACGACTTGGACGTGCGGGGCCT
GGTGTGCTGCCTCTACCCTCCGGGGGCCTTTGTGTCTGTGTCCCGAGATCGCACCAGCCG
CCTCTGGGTTCCAGACAGGTGAGTTCTGCGAGCCCGCTGGCCGCACCCCGGGCTCCCAGC
CCCCAGCTCTGTTGTTCTGCTTCCCCGCCGGCGTGGGAAGAGCGACTGACCCTTCCGGAC
TCCATCCTGCCGGCTCCCTCCCCCTCGGCCTCTCCCCTCCGCTTGGCTTCCTCTCCTTCT
CCCTCCCAGCTCTGCAGAGTTCTGCCAACTCTGGGCGCGCGGTGTAGGAAATCAGTGAGA
TTTACCGAGAAACAGCATCAGATTGGGGAGACCTACTTTCTTTCTTGCCCAACTTGAGCA
CTTGGCGAGTGGGTGACCTTGGACAATTCTGGGGCATCGATTATTATTATCGATTTATTA
ATTGTTTTGGACGAGGGTGTATGCTTCTTTCAGATTTAAATATTTGTTGATTCCTCCTAA
ATGAGGTGACGGGAGAGAAGTCTGGCATGTCATTGAAGTAAGTGATTCCCTGCTCCACTA
GGTTTATTCTGTAGTCTCTCCTCGGTTCTTAAAAGTATTGCCAAAAAAAAAAAAGTGCAT
TGATGGCCAGTATTTTGTTTTGCTTTGTTTTGTTTTGTTTTTAAATCTGTGGTCTGTAAT
AGCCTGGGATGAAAAGGATAAGGCAACTTATATACGGGTATGCTTTGTTTTCCTGAGCAA
GAACATTGCCTTCAAAAGATTATCAAACAGAAAAAAGGAAATAAAATGATTAGGAAATAA
AGTTTAGTCCAGTGGTCCGTGAGGAGGTGCGGTGGATAAAGTGGGACTCCAAAGCATGAG
GTCCTGAGTTTGATCCCCAGCAACACATGTGCCAGAGGGGTGTTTGGTTCTCTGACACGT
ATCCTTCTCATTCATAAATAAGATATTTAAAAAAAAATAAAGTTTAATCCAGTATATAGA
TCAAGTTCAGAGATTCAGCTCTAATTTGGGAAGATTGCAATAAGGAATTTATGATCTGGA
AGACAGAAAACAAGAGAAAAGCAGAGTCACAAGGACTCAGCCAGTGGGATAGGAGTGCAT
AGTGGTTATGCAAAAATGTTCTCATACCTAAGACTCAGGGCTTTCAGGTTCTGTAGTGCA
ATTGTAAGCCAGAGCTAAGTAGTGGTCTTGGGATTTCTTTTTGTCAGCTGATTTTTTAAA
ATTTCTTTTTTAAAATATTCGTGTAAATTATTAATTAGTGAGAAGTGAGAACCACAGCGT
CACTCTGGCACATGCAGTGTGCTAGGGATCAAAATCAGGACCTGATGTTGAGTCCGACAG
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATGG
GAAGAGGAGGGGAAGACGGGGAGAGAAAGATTGACACCTGCAGACCCGGGATCCTTACTC
CAGTCCTTGGGCTTTGCACCACGTGTGCTTAACCCACTGCGCTACCTCCCCACTCCCCTA
TAATGAAAGTTTTTAATGAAAAAGACATTCCTTTACCTGTTCATTGGTATTGTTGTAAAG
AAAATTAATGTTCTCATTGAACATATTAAGCACTCAAAGAGCAGAGACAGCTTCTTGAAA
GGTGTAAAGGAAAATTATCAGGAAACAAAAGGAAGCCAAAGAGAAGGGGACTTGGGCTCA
ACTGAAAGTGCCAGCCTTTTCCACCCAGAGCACACTTTGTGAGAACCAATGAAAAGGAAC
CAGAGCTGCTGGAACCCATTCCCTATGAATTCATGGCATGATCAATATAAAAATTTAATA
GAACATCTGAACTATGAAAAAAACAGACATTCAGCTGTGGCTCAGGAGATGTCGCCGTGG
CTAGCAAGCTTAACTTAGGAGCATGAGACCCTGAGTTTGATCCATAGCATTGCATATACC
AGAGTGATACTCTTGCTTCTCCCCTTCATTAATAAATAAATAGATCTTAATATATAAACT
AGTAACTTAAAAAAAGGTTTTTCCCCTGGTTCTGACCTGCAGGGGGAAAACTTTGCAAGT
GGTGAAGCAGTGTTGCAGGGGTCTCTCTGTCTCTCTCCCTCTACCACCCCCTTCCCTCTT
GATTTCCGGCTGTCTCTATCCAGTAAATAAACAAAGATAAATAAATAGTGCTGCATGAGG
GGCAAGTTTTTCACCAACACCACGATGGTCTCTGGCCCAATGAGTGGAGTTGGATAGTAA
TTCTTGCTACAATATTAAATAAGTAAATAAATGAAGATAGTATAGGGCACACCATCTAAG
CTCATATATTAATAAGTGTAAGGATCCAAGGGAGGATCTGGGTTGGAGCCACTGGCTCCC
CACCTACATAGGGGTACGCTTCACAAGTGGTGAAGGAGGTCTGCAGGTGTCTATATTGCT
CTCCCCCTCCTCTCTCAATTTCACTCTGTCCTGTCCAATAAAATGGGAAGAAAAAAAACG
GCCAACAGGAGCGGTGGATTCGTAGTGCTGGCACTGAGCCCCAGCAATAACCCTGGTGGC
TATGTACTACCCGGACCTTCAGACATGACAGTGTTTGCATAACTGTTAAGCTATCCTCTG
CCATAAATAAATATTTAAAAGAAAGAGGCACTCACCCTGAAATACTCTTTACTTTGTGTT
ATTTTCAATCAGGATTGAAGGCATGGTGAAGAGCTTTGCAAACAGACAAAGCAATTATCA
ATAACCCAGGCCCACAAGAACCACTAACTGGAGTTAACATAAAATGAAAATTTAGAATGA
TTTCACCCATTGAGGGTAAACAAAGCCAGAGAAAACCAGCAAAAATCCAATAAAGACAAA
CCTTTGAACTTGAATTGCAGAACAGATTACCAAAAGAGATGGGGGGGGAGTGTGGGATTG
TAAAGTGGGAAGGATATTGGTATTCTGGTGGTAGGTGTGTAGTAACATTTTGAAGAGGTG
TGAAATTATACTTTTGAAACTTGTGTAGTCTTGTAAATCGAGGTTATCTTAAAAAAAAAA
AAGTAAGAATTCAGTACAAGTGTTTCCCCAGTAGGATGCTGCAGTAAGAAGCAGGTAAAG
GATGCATTTTGTAGTGGTTGAATTTTTTAAAAAATATTTATTTGTTTATTTATTCCTCTT
TGTTGCCCTTGTTTTGTTGTTGTTGTTATTGATGTCGTTGTTGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA
TGCTATCTATCCCCCCTAACATTTATAGATGAGTAGAAAATGAAGATAAAAGATGAGAAA
AAGCCATTTCACATTCTTGTTAACGGTCCTTTTTTATTGATTCATATTAATTAACATATA
CATTATCATTAAAACACTAGCTGAATATCTAATCAGAAATGACCCTCTATAATTACTAAA
AACAGTGTTTTTTTTTTTTTTTTTCTTTTACCAGAACACTGCTCAGTTCTGGCTTGTGGT
GTGTGTAAGTGGTGGGGTATTGACTTTAGAGCCTTAGACATGAGTCTCTTTGTAGACCAT
TGTACTCCCAAGACAGTGTATTCTATATAGGCCTCAATGGTATTAAGATGGATAAAACAT
TGGATTTTCAAGCATGTTGTCTCAAGTTAAATCCTCGTTATCACATGTCAGAGTGTTACC
TGTTTTTTTTTTCTCTCTGACACATTTTTTTTATCATAAATGAAATACTTTTTTATTTTT
ATTTATTTATTTATTGGATAGACACAACCAGAAATTGAGAGGGAAGTGGGATATAGAGAG
GAAGAGAGACAGAGAGACAGCTGCTGCCCTGCTTCACCATTCCTGAAGCTTTCTCCCTGC
AGGTGGGGACCAGGAACTCGAACCTGGATCCTTGCTCACTGTAACATGTGTGCTCAACCA
GGTGCGCCACCACCCAGCCCCATGAAAAACTTGTTTAATATTTTATTTGTCTGTTAGGTA
GAGACAGAAAAACAAAGACGGAATGGGGGGATAGGGCAGGAAAGAGAGACATCTGCAGCA
CTACTTCACAGCTCATGAAGGTCCACCCCCCCACATGTGGGAAATGGGGACTTGAACCCT
GGTTTTTGAGCATCAATCATGTGTGTCACTTCCTAGCCCAAACTGTGTTCTTAAAATAGT
GCATACTCTAAAGTTCAGCTGTAACACTAAAAGTAAATGAGTACTCTGGCAGTCTATGTC
CTAGGCTAAATGAGGGGATAAATGTATATTATATTCATTATCCTCTCTCTTCAGTCCTAA
CAGGGGCTTTACAGAAATGCACTGTATGAGTGGCCACTCCAATTTTGTATCTTGTGTCTG
TATCATACCTTCAAGTGAGGTATATCCTCATGGACTAATCGCCACTGGAGGAAATGACCA
CAATATTTGCATTTACTCACTGGACAGTCCAATACCACTCTATACACTAAAAGGTCACAA
AAATACTGGTAAGTTTATAACATTTTGATGTTTTTCTATATGAAATTTCATCCTTTGAAT
GTATAATTCACATATCTATTTCACCTCAAAAATTGATGATAAATATACATCTATTATTAT
TTGTTTATTTACTTATTTTACCAGAACACTGCTCAGTTCTGCTTTATGGGTAATTTTGGA
GATGGAACCTGGAACCTTTGGTACTTCATGTGATGAAAAGTTTTTGCTTAAGTGTAGGCC
ATCTCTCCAGCCTTACATTTGTTTCCACATAGTCTCTTAAAATCAAAGGAAATGTGCAAC
CTACTTAATCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGAA
ACGGTAGGATTTTCTGCCTTTATCAGGCCAGCCAATAAGGGGTCCTAGCAGCGACACCAA
GGCTGTGACTATAACTTAATTTGGGTTAAGAATTAGAGTAGGAAAAAAAGGGGGAAAAAA
AAAAGGAAAAAACAATTTTTTTTCCTTTTAATTTTCAAGCATACCTCCTTCCCAGCCCCC
GCCCATAACCAGTCCTTTTCTTTACCAAATTCCTGTCCCACCAGGGAGTATCATTAATTC
TAAGTCTATACCCTTCTGAAACCTCTGGCCTTTTTTCTTTCTAAGTAGCCAACACCCCCA
CCTCACCCTGCATAGCTAATTAAGTAATTAAAAATAAATACATTTAAAAAAAACCTTTCC
TTTCATTGCCCTTTTATGACTGTTCTTTTTATCTTTTTCTTTTTTTCTCTCTCTCTTTTT
TTTTCTTCTTCTCATTATGTCATCCTTTCTTCCTTAATCCTACAGCTTCCAAAGTCACAG
CCCCCAGCCCCCACACCAACAAAAGTGTGCTTTTTTGAATTCACTGATACACATTTGGGA
ATTTCCTTTCACTGCTCTTTAATTACAGCTCTTTTTCTTATCTTTTCCCTTTTCTCTCTC
TTGTCTCCCCCCCCCTCTTTTTTTTAAATCTTGTCATACACTTCTTCCTTCTTCTTTGCC
TGTCTGAATTTGTGAATTATTTGGGGGAAGAAATCTGACTCAGAGTGTACTCTCTATGTG
TGTATCTCAGCTCTTCTTCCCTTTCTCTTCTTGTTACTCCCTAGAATATACAGTGGATAG
TAGATTTGCATAACTGTCTATTCTTGCGATCTCTTCTTTCTTCTCTCTTTCTTCATCACT
TGGACTTGGTTGCTATTTTTTCACAGACTGGAGACATTGTTTGGCTAACTGGTACTAATT
AAACATCATGACCAAGTGGGATTCATCCCAGGAATGGGAGGCTGGTTCAACATCCGTAAG
TCAATCAATGTTATTCACCACATCAATAAAAACAAAGCCAAAAACCACATGATTATCTCA
ATAGATACAGAGAAACCCTTTGACAAAATCCAACACCCATTCATACTCAAAATCCTACAA
AAAATGGGAATAGATGGGAAATTCCTCAAGATAGTGGAGGCAATATATAGCAAACCTACA
GCCAACATCATAATCAATGGACAGAAGCTGAAAGCATCCCCCCTCAGATCAGGGACTAGA
CAGGGCTGTCCACTGTCACCATAACTCTTCAACATAGGATTGGAAGTTCTTGCCATAGCA
ATCAGGCAAGAGAAAGAAATCAAAGGAATACAGATTGAAAGGGAAGAAGTCAAGCTCTCA
CTATTTGCAGATGATATGATAGTATACATAGACAAACCTAAAGAATCCAGCAGAAAATTA
CTAGAAGTTATTAGGCAATATAGCAAGGTATCAGGCTACAAAATCAATGTACAAAAATCA
GTGGCATTTCTTTATGCAAACACTAAATCTGAAGAAGAAGACATCCAGAAAGCACTCCCA
TTTACTGTTTCAGAAAAATCAATCAAATACCTAGGAATAAAGTTGACCAAAGAAGTGGCC
AAACAAAAAGAGGAGACTTGTATACTGAAAACTATGAGTCGCTACTCAAGGAGATAGAAA
CTGATACCAAGAAATGGAAATATATCCCATGCTCATGGATTGGAAGAATAAATATCATCT
AAATGAATATTCTCCCCAGAGCCATATACAAATTTAATGCAATACCCATCAAATTTCCAC
CAGGCTTCTTTAAGAGAATAGAACAAACACTACAATCATTTATCTGGAACATGAAAACAC
CTAGAATTGCCAAAAGCATCTTAAGGAAAAGAAACAGAAATGGAGGCATCACACTCTCAG
ACCTTAAACAATATTATAAAGCCATCATCAGCAAAACAGCATGGTACTGGAACAAAAATA
GGCACACAGACCAGTGGAACAGATTTGAAAGCCCAGAAGTAAATCCCAACACCTATGGAC
ATCTAAGCTTTGATAAGGGGGCCCAAGCATTAAATGGAAAAAGGAGGCTCTCTTCAATAA
ATGGTGCTGGGAAAACTGGGTTGTAACATGCAGAAGAATGAAATTGAACCACTTTATCTC
ACCAGAAACAAAAATCAACTCCAAATGGATCAAAGACCTAGATGTCAGACCAGAAACAAT
CAAATACTTAGAGGAAAACTTTGGTAAAACACTTTCCCACCTACACCTCAAGGATATCCT
TGATGAATCAAAAATAATTGCAAGGAAGACTAAAGCAGATACAAACCAATGGGACTACAT
CAAATTGAAAAGCTTCTGCACATACAAAGAAACTATTAAACAAACAGAGAGACCCCTCAC
AGAATGGGAGAAGATCTTCACATGCCATACATCAGACAAGAAACTAATCACCAAAATATA
TAAAGAGCTCAGCAAACTTAGCACCAAAAAAGCAAATGACCCCATCCAAAAAAAGGAACC
GGGATTCTTATGCCAGTCATTGTGCCTCTCTCCATGTGCGCTTAACCCCCTGAGCTACCG
CCCAACTCCTAAATTACAGTGTTTTGATAACGAGCAGGATGAGCTTTTTTTCTGTATGAA
AATGTGTTAATTCCAGTGGAATGAAAAATCACATAGTTTGAAGCTTTTAAAAAAGTCATT
GGTATATACTCAATGGAGTACTTACTTAGCAATTTTAAAAAAGACTATCACGTGTCCTTT
GGGACTAAATGGATGGGATTGGCAATGATTAGAGTGAGTGAAGGAAGGAAGGAAATGAAG
CACAACTATGGGATGATCTCACTCATAAGTGGAATAGAGAGAGTTGAAACACATGAATGA
ACACACACATACACACACACACATACCCTTGGGAGAATAATGCTGATTACCCTTGGGGTA
TAGGACTTTGGTGGTTGCAGTAGTATGGAATTATATCCCTATGTTATTAAATCTTGTTAA
TCACTGTTAGATCATTAATAAATATGTAAAACAAAAATATGTTAATTCTAGTGCCTTTTT
TCTTTTTTCATTTAGTTTGTAGTCTTTCATCTGGAAAATTTGGGACATTACTTAGTGGCT
CATGGGACATGACTGCTAAAGTCTGGCTGAATGATAAATGCATGATGACCTTACAGGTAA
CAGTATTTCTGTGTGACTATTCTGGATACTTAAATGTGATGACTCTGTGGCTACTTCAGT
TAATACCCATTTTAATCACAGGGTCATACTGCTGCAGTATGGGCAGTAAAGATCTTACCT
GAACAGGGTCTAATGTTAACTGGATCAGCAGACAAGACTATTAAACTGTGGAAGGCCGGA
AGATGTGAGAGGACTTTTTCAGGTAAGAACAGAGTGGGCAGCTTATTTGCTTGTTTATCT
TATCACTAGCTTCAGTGCTCCAGACTGACTTTTTTTTTTTTTCCTGATTGGGAGGATGGG
GAGAGACACCACAACACTGAAGCTTCCCACAGTGTGATGGGAGCCTCCAGCCTGGGTTTA
TCATGTAGCAAAACTGATACCCTTCCTATATGAGCTGTTTTATGTGAACAGCTTCCAAAA
ATCTCATCCCTTTATATATCCCCCCCCTTTTTTTTTCCTCAGAAATTTAGAATCATGAAA
GTGGTATTTGAAACCTTCAGTGGGGCCAGAGGAGATGGCATAATTGTTATGCAAAATATT
TTAATGCCTGAGGCTCCAAAATCCTAGGTCTAATCCCCAGCACCAGCATAAGCCAGAGCT
GAAGCAACTCCCCTGCAGGTGGTGAACTGGGGGCTCTAACCAGGATCCTTGCATGGGTCC
TTGTTCTTTGTACTATGTCTGCTTAACCAACCTGGTGCACCAGAGCTCACCCCCCCCTTT
TTTTTTTAAAGATTTATTTTGTTTTATCTTGAGAGCATGAGATAAACCAGAGCACTGCTC
AGTTCTGTCATGTGGTGATGCCAAGGATTGAAACTAGAACCCTTTGGGACCTTGGGCATG
GAAGTCTGATGCTCTATATTTATGTTATCAACCCCAATTTTTTTTAAAAACCTCAATTAT
TAAAGAACTGAAGCATCTGCTTGCTAGTAGTATTGTTAGCCTTTTGTGGAGGATTAATAC
TTTTGGTATGCAATGATTTATTTTTGCCATCAGAGTTATTGCTGGAGCTTCATATCTGTA
AGTTGCTACTATTCCCAGGGGCCCCCCACCCATATGTTTTATATATATACTTTTTTTTTT
AGGACGAGTTGAGAAAGATGTAGAGACAGAGAGGAAAGACACCTCGAGCATTATTCTACA
ATTTCTGGTGCTCCCACACTCGAGGTAGGTGCTGGGCGACTTGAACCTGGGTTCTCATAT
GTAGTGATGTGTGGACTCTACTGAGTGTACCACCATGTGGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGAAAATTGTGAGGGAATCAAAATTTTGTTTGTACA
ATGTTTAGAAATAATTTTGGAATTTTGGGAGAAGGTATGATTAAAAAAAAACAACAAACT
TCATAAGGCTAGTGATAAAAAGTATTGGGGTGAAGGTAGATAACATAATGGTTACGCAAA
GAGACTCTCATGCCTGAGTCTCCGAAGTCTCAGGTTCAGTTCTCCTCACCACCATAAGCT
AGAGGTGATCAGTGCTCTGGTTATAAATAAAGAAATAAAAGTATTGGCAAACTGGGGCCA
GGTGGTGGCACACCTGGTTAAGTGCTCACATTAAAGTGCACAACCCCCTGGTCCCCACCT
ACGGGGGTTGGGGGGGGAGAGCAGGTCTGCAGGTGTCTCTCTGTCTCTCAACCTTACTAT
CCCCCCTCTCCTCTCAATTTCTCTGTCTATCCAATAATAAATAAATATTTTAGAAGTATT
AGTAAACCTAAATTATAAATTTGATTTACTTTGTTTTTCTGCAGTAAAAAAAAAAAAACC
CTGAATTTTTCTAACTTGACAATCTGTGTTTACTATGCACTGATGCTTTATAATATTAAG
TACATGTATACATCTCTAAGTGATCCATCTGACTGATTTGTACTCTCTGTTTTTCATACA
GGGCATGAAGACTGTGTAAGAGGGTTGGCAATTTTGAGTGAGACAGAATTTCTTTCCTGT
GCAAACGATGCTAGTATTAGAAGGTGGCAAATCACTGGAGAGTGTCTTGAAGTATATTAT
GGACATACAAATTATATTTATAGTATATGTGTCTTTCCAAATTGTAAAGGTAAGATTATC
TCACCTCTCTCATTACATTAATTCAGATTTGGTAATTGCATTGTAATAAATTCTTGGAAG
TACAAGGGAAGATTCTGACTTGTTGAGAAGTATAGTATGTGTAAGATCCAGGGCTGGTGA
AATAACTCATGACCCAGGTTCAAGTCCAGCGCCCACCACACTGAAGGAAGTTTTGGTGCT
GTGTGGTCTCCTTTATTTTCTCTTGCTTTGCCTTTCTGCCTCTCTCTCTTTTTTCATTAT
CTTTATTTTTATTTATTGGATAGAGACAGCCAGAAATTGAGAGGGAAAGGTGGGATAGAA
AGAGAGACAGACACCTGCAGCACTGCTTCACTAGTTGTGAAGCTTTCCCCCTGCAGGTGG
GGACCAGGGACTGGAACCTGGCTCCTTGTGCATTGTAACCTGCGCTCAACCAAGTGTGCC
ACCACCTGGCCTCTTTTTAAAAAAATTTTTAAAAACTTTTTATTTGTTTATAATTAGATA
CAGACAGAGAGAGATTGAGAGGGGAGGGGAGATAGAAAGGGAGAGAGACAGAGAGACACC
TGCAGCCCTGTTTCACCACTTGTGAAGCTTTCCTCCTTCAGGTGGGAACCAGGGGCTTGA
ACCTGGGTCCTTGCACACTGTAATGTGAGAACGCTTAATCAGGTGCGCCACTATCTGGCC
CCCACCTTTCTGCTTCTCTATATTTATATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGATGTCGTTAGATAGGACAGAGAGAAATGGAGAGAGGAGGAGAAGACAGA
GAGGGAGAGAAAGAGACACCTGCAGACCTGCTTCACCACCTGGGGCTCAAACCAGGATCC
TCGCGCCGGTCCTTGCGCTTCGAGCCACGTGTGCTTAACCTGCTGCGCTACCACCCGACT
CCCATACATGACCTTCTTAATAGAATGAATGCCAAAGTATAAAATACACCAAGTACCATG
GTGTATAGTCATTTAAGTTGTGGACTTACATATCTATCCCCTTTTTTAATGGAATGCCAT
TTTTATTTCAAAGGATGCCTAACTAGTTGTTCAGGCTTGCAGATTTGTCAGATACATTTT
GAAAATGAATTAAATGAGCACGTTATTTTTGTTATCACTGGGCTTCACTGCTTAGACCAG
CCTTCTCATACATAAAGGGAGAGAGGGACCTGAGCACCAGAGCTTCCCTCAGTGCAATAG
CACTCCCATGGGAAGGACCAGAGACTTGAACCTAGCTTGCACACATGGCAAAGTAAGTAC
CTTTCCAGGTGAGTTATCTTATTGGACTACCAGGGTTTCAAGTTTGATCACCAGCATCAC
ATTGTGCCAGTGTGACACCTGGTTCTCTTTTTCTTTCCCCTTCTCTCATAAATAAGTAAC
CAGACAAACAAATCTTTTTTTTTTTTTTTTTTAAGAGAGAACAGCTGATGGTGTTTTGCA
AAGATAAAATTGAAACTTTGTAGTGAAAATTGAAATTTTGTAAAATGTGTTATCTGCCAC
CAGGAGCCTGATAGGTTTTGTAATTAATATATTGTTCTAAAGATTCCAGTGTTTTTTCAT
TTTATTTATTTTTTATTGCCACCAGGATTATTGCGGGGACTTGGTGCCAGCACAATGAAT
CCACTGCTCCCAGCAGCCATTTTGTTCCTTCTTTTTTCCCTTTTATTTATTTGATAGGTT
AGAGAAATTAAGATGGCAGGGGGAGGTAAAGAGGGGGGAGAGAGAGACAGACACCTACAG
ACTTGATTCACTGCTGTGAAACGTCAGGGAGTGGGGTCTCAAACCCAGTTTCTTGCATGT
GGTAATATGTGCATCCAACCAGTTGTACCATATGACTAGTTAATGGTGCTACAAAATCAC
AAATGGGTAAAAGATCTGTTCGAAGGGTAAGATAGACCAATGGGTTTTAGTGCATTATAG
CTTGAAAAATACATGGATGGGCTGGGGAGATAGTTGGAGGTTATGCCAAGACTTTTTCTG
ACCTCAGACTGTGAGGCCCCAACGTTAACCCCCAGCACCACCATATGCCAAAGCTGAGCA
GTACTCAGCTAAAAGCTCTATTAAAATATCATTAAAATAAATATTTTAAAAATATTTATT
GACATGGTCTTAGATTCTACATTGTAAATTTTTAAGGACCTGTACTTTTAGAATATACAG
TTTGTGGGGGCCAGGCTGTAGTGCACCGGGTTAAGTGCACATGGATCCCGGTTCAAGCCA
CCAGCTCTCCACCTACAGGAGGGTCACTTGTACAAAAGTGGTGAAGCAGGTCTACAGGTG
TTGGTCTTTCTCTCTCCCTCACTGTCTTCCCCTCCTCTTTCCATTTCTGTCTGTCTTATC
CAACAACAACAGTAGCAGCAACAGTAATAACAGCAACAATGGAATAAGGATGGCCACCAG
TAGCAGTGGATTCATAGTGCAGGCACTGAGCCCCAGCGATAACCTTGGTGGAAAAAAAAA
TATTCTAAAAGTTGTTAAAATCTTTACCAAGATAGATCCCTGTTTAATTATTTAATTTGT
GAAAAAGTGGATTTTCCTTTATGTACTTCAAAACAACAGATTGAAAAGAGCTAGGTGTAG
TCCAGGAGGTGGTGCAGTGGCTAAAGCACTAGACTCTCAAGCATGAGGTTCTGAGTTCAG
TCCTCAGCAGCACATGTACCAGAGTTATGTCTGATTCTTTCTCTCTTATCTTTCTTATTA
ATAAAATCTTAAAAAAAAAAAAGAACTAGGTGTGATAATCCAGCTATTCTATATTACAAT
ACAGTGAATAGATTCATATTAATGTAAAACTATTAGCCTTTTCACTGAACTTCTTTATTT
CTTAAATCTTTATTTACTGGATAGGGACGGCCAAATAACTGAGATGAAGTGGGGGAATTA
GAGAGAGAGAGGAAGGAGAGAGAGACCCCTGCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGGGGTTCCCTCACAGGCAGTGAAGCAGGTCTGCAGGTGTCTATC
TTTCTGCCCCCCCTCTCTGTCTTCCCCCTCCCCTCCTCGATTTCTCTCTGTCCTATCCAA
CAACAACAAGGGCAAAAAAAAAAGGGGGGGGAGGGAATAGCTTTCAGGAGCAGTGGGTTA
ATAGTGTAGGCACCATGCCCCGGCAATAACCTTGGAGGCAGAAAAAAAAAAGTATCTCTA
ACTACTATAACAGATAAACTCAAGTCTTAGTAGCTTAACAGAAGAGAAACTTCTTTGTTG
TACTTTTTTTTCTTTCTTTTTTTTTTTTTCCTTATTATACAGTTAAAGTTCAGTTTGTCA
CAGGATGTGTGGGGGCATATTTGTACAGAGATTTTTGTTCTTCATGGTTATTTAAGGACC
TAGGTGTATCAAAAGTATACTGTTTACAATATATACAGCCACCTAGCTTGCATTGAGTAT
AGACATTCAGTTAGGGTGGGAGAGAAGGGTGGATAGAGCATGGTGGACTGTACCTAGAAC
TAGGCTATATCAAATCCATGTAGATTTCACTGATCCTTATTCAGTTTGACATCTAGGGAA
TACAAGTCTATCGAGTAAACACTGCAGTTGACAGCTGCGGCCTATGAAATGAGAACATGA
ATCTGGAAGTGTCTGAGCCAGAATTAACAGCAAGTGCAGACTCTGGTGGAAATAGAGTGA
TAGGATGAAGGAAGGCCAAGTGTAATATGAAGTTTAGAGAGGATAGATGAGGCATTATAT
ATTTGGCCTTGTAGATCCTTAATGAAAGTGAGGTGAAAAGTCCATGAAGGATCTCTGGCA
AGAGTGTCGTGAACTCCTTAAACTTTTCAGAGAATTTCTATAGTTGCTGCCTTGAATATA
GACTGTTGGAAGCCATGGAATCAGTCTAATTGAAAGATGATGTTTGCTTGTAAGATAGCA
ATGAAAATGGTGAGGAGAGTTAATTTTTACTTTTTTTCCCCCTCACTGGAGTACTCTGGT
TTCTAGTGGTGGGTGGGGAGGATTAAACCTGGAACTTTGGAGCCTCAGGCATGAGGGCCT
CTGTGTTTGACCATTATGCTGTCTACCCCCACTCTTTACTTTAAATTTTAAAAATGCATC
TGATAAGAATTTTCAGAAGGATTTGCTATGCCATTGAAAAGAAAAAAAATTGGACTCCTA
TGGTTGTTGATCTGATCTGTTAGAAGAATAGCGAGTAATTTGCTGAGATGAAAGTGTTGT
CACCAGATGTTCAACAATAAAGCTTGTGTTGTTTTTGGTAGATCAGGTAATTCCTAGTAG
AACCACATTTTCTTAAGCTTTTTTTAATTTTTAAGTAAAATTTCCTTTTAATTATCTTCA
TTCATTCATTTATTTTCATTTTCACTTTTTATTTACCTACCAGAGCACTGATCAGCTCTG
GCTTATGCTGGTGCTGGTGCTGGGGATTGAACCTGGGAATTCAGAGCCTCAGGCATGAGA
AGTCTTTTACTTTACTGTTATGCTATCTCCTCAGCCCACCATTTTCTTTTCGGCCACTTT
CTAGTAGAATTACATTTGAAAACAAATTTGATAAAATTTCTATTAAACCAGAATACATAT
CCTCAATGTCTTAAGTTTTAATGTTTTTTTTTCTTTTCTATCTAAATGTGTTTGAATTTT
ACTCTACCATTCTACTTTTTGTTTTAAGGTACTAGGGAAGGACAGACTCGTCTAATTAGA
GATGGGGAGAAAGTTGAAGCCTATCAGTGGAGTGTTAGTGAAAGAAGGTGGATAAAAATT
GGTGATGTTGTTGGCTCATCTGGTGCTAATCAGCGAACATCTGGAAAAGTTTTATATGAA
GGGAAAGTATGTTATCGGTCTTCTTTCTGATTAACATTCCTCCTTTATTTAATTTTATTT
ACTAGTTGTATGCGAAAGAGAATGAATGTGTGAATGAGAGTAAGACCAGTCCATCGCCCA
GTTCTGACCTCATGCGGCCAGGACTGATCCTGGCCCCGCTGGGGAACTCAGGCATGCAAG
TCCTGTGCTCTACTTAATACACTTTATCTCCCCAACTCTGATTACTATTATCTTAAAGCA
TTAGACATAGTTACAATTCTTTTAATTTTCCCTTTTATGCTTATGGATATAATCTTATTT
CCTTTTTTTAAAAGGACTTATTTTTATGAGCAGGAAAGAGAGAGACATTAGAGTATCGCT
TAGTTCTGGTGTGTGTGATGTGGGAAATTGAATCTTAGGGCTTTGTGCATGCGCATTCTT
TGGTGTTCGGGTACTTTGAATTGATTTCTGAGTGGCCAGGTAGCTGTGTCAGCAGTAGAG
AATCTGACTTACATGTGTAAAGCCCTTGCTCCAATTCCCTGCACCACACAAGAGTATCAA
AGACAAAATAACTTAGTCAGTCTGTCTCTGTCTCTCTCTCTCTCTCTCAAAATAAAATTA
GACAGACCAGAGAGGTAGCTCAGTATTACTGTGCAGAGGCCTTGAGTTCAATTCTTGGTA
GCAGTAAAATAATTGGTTAAATAATCAAGGTGGGATTGGTAGCTCTCCAGGTAGGGTTTG
TGCTTTACCTAGAGCACAGCCTTGGTTCTGACTAGCATCGCAGGGGAGGTACTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCATAGAATGATAGAGTAGTGCTGT
GATGTCTCACCCCTTTGTGGCTTTCCCTCTGTTTTTTTCTGATTGGACTTGAAAGGTGAA
ATAATGTCTGCCTGCAGCAGTAGAATTAGGCCCTAACCACATAAAAATAAAAATAATGTT
AGAGAAACAGGCCAGGAACAACTGTTGCCTTTATTCTAATCCTACCTGCCTATTAAGCTC
TGTTTAACTTAACACTATATGGAGAACATTGCAAGGAGTAGTGTTTATAATGCTAATGAT
GTATTGGTACAATATGGGAATAGTTAATACTTTCCATCTTGGCATCAAACCATCTTTTGG
CATTAGGATTGATATGTGCCATAATCCCCCTTCCCAACTACCTCCAGTGAAATACTAACG
TGAAGATGGATGGTCTTAACCATTTTATGCAAACTAGATTTTAGTGTTGCACTTTAGACA
AAGTACTTTAGTCATTAACATAAAGAACACAATGCCTGTGTTCTTTCATTAAAACACATG
AACAGATAAATTAGTAATCATGTTTTTATATTTCTATTAAAGGAATTTGATTATGTTTTC
TCAATTGATGTCAATGAAGGTGGACCGTCTTATAAATTGCCTTATAACATCAGCGATGAC
CCCTGGTTAGCTGCATACAACTTCTTGCAGAAGAATGATTTGAATCCTATGTTTTTGGAT
CAAGTGGCTAAATTTATTATTGATAACACAAAAGGTCAAACACTGGGAGTTGAGAATGCT
AATTTCTCAGATCCATTTACAGGTAAGTTAGGACTTTTATGAAGTCTTAATATCCTTTCA
TCAATGTTGGTTGACTTTCTTTTTATGTTTTTTTGCATATTTTAATGAAAAACCAAAATT
TATAGTTCTTTTCCATCATCTCATAATCTTTGCTTTTTTTCTTAAAATTTTTAAAATTCT
CTATTCATTTACTAGAGACAACCAGAAATCGAGAGGGAAAGGCGAGACAGGGAGAGACAG
TGGTCCTGGAGAGGGCGCATTAGATAAAGCACTGGACTCTCAAGCATGAGGTCCCAAGTT
CAGTCTTCAGCAGCACATGTACCAGAGTGGATATCTGGTTCTTTCTTTCTCATCTTCCTC
ATGAATAAATAAATAAAATCTTGAAAGAAAAAAAGAGAGAGAGACACCTGCAGCACTGTG
TCACCACTTGTGAAGCTTTCCCCCTACAGATGGGGACCAGGGGCTTGAACCCTGGTTTGT
ATGCTCAACCAGGTGCACCACCACCTGGCCCTACCTTTTTTTTTTTTTTAGCTTCAAATT
CATACTTAAATTTTGTGGTCCTAGGGTTTTGTTCATGGGCCAGCTTTTCATGTTTTCATA
TGGTGAGGGTGGTAAGACACCAGCTCTACTATGCTATTTGTTGAACTTCCTGTAGTGCCT
TGGTATTCAAGTGTGGTGCTGGGGCTTGAACCTGGCACCTCACATATAGCAAGGTGAATG
TTCTACCAGGTGAGCTTTGTCCCAACCCCATATTCTCCTCCCCGCCCATTTTTCTTTTTA
CCTTCTATTTCATTTGATAATTCAGAGAAATTGAGAGGGGAGGAGGTGAAAGGGAGAGAG
GAAGATAGACACTTGCAGGTCTGCTTTGCCGCTCGTGAAGTACCTCTCCAGCAGGTGGGG
GTGGGAGTTCTAACCCTTGTAGTGAACGTGGGAAATGTGTGTAATCAGCTGGGTTCACCT
GCCCCCATATTCCAAGCTTATCAGTTGGATTAGTTACCTCCAGGGTTATGCTGTGGCTCC
GTGCCTGCGTACTAATCACTGATCCTGGAGGCATTTCCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAAACTTG
GCACTTCACTTCTTATATATTTTTGGTGGTCATCTTCTGTTTTTTCATGTCTCCATGCTG
TTTCCTATTCCTCTTATTTCTCTTCCCTGTTTGAAACCCATACCCTGTTGGTTTAATCCA
CATCACAGATACATTATATCCCCAAATTGTCTCTTCTCTCAGTTCCAAAATCACATTGCT
CATTCATATAATAAAGTCAGTATGACTTACATGTTGACTTAAACAGAATTGTCAGCTTGA
AGCACTGTGAATTATGTCATCTACGAATAGTTACACTTGACAGGAAAAGAAAAAATGCCT
TTACTACTTAGATATTTCTATTAGTTGAATTTCAGAGACTGTAAGATAATGAAGACAGAA
TTGCAGTGTTTTAAAGGATGGAAAACAGATAATACATTTGGCATTTTATAAGCAGCCATA
CTTGTAGACACCTCTGATTATTTCCCTAGATATTCTAACAAAACATACACCACTCATTTA
AACATGTAAATTTAAATCTCTTTGCTATGTAGCAGTCTTCATCTTTGTGGATATTTTTTT
TTCCGATAGATTGTAAGCTTCAATAAATACTAGCAATCTTGTTCCCTGCTGGATCCAGCT
CTGAAAGCACCCTTTGACGCATGGATTAATGAACCCAGGGGTTTTCTAAAAGATTAATGT
TTGATGCTTGTGCTTTTGATGCAGCAGCAACAGCAGGAATTCTAGGAATAAAAACTGGAT
TTACTTGTATACTATATCGTCAGAGACCAACTGCAATTTCTCTTTTTTAGTGTGGAATGT
AGATACAACAAAATAACTTTAAGTTAAAACAAAGGGCGGGAGCTGCGCGGTAGCACAGCT
GGATAAGTGCATGTGGCACTTAGAACAGCAAAAGGATCCTGGTTCGAGCCTGCCCCCTGG
CTCCCCACCTGCAGGGGTTGCTTCACAGGCAGTGAAACAGGTCTGTAGGTGTCTATGTTT
TCCCCTCTCTGCCTTCCCTTCCTCTCTCCTATCTAACAACGACAACATCAGTAACAACAA
CAATAATAACTGCAACAACAATAAAAAACAAGGGCAACAAAAGGGGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGTACAAAGCTCCACCTCCACAAAAAGTTA
AGAAAAATAAAACTTGGGCAAATCACTAGAATATTAGCTTCTTAAGTAGAAGATTCTTCT
TTTTAAAAAAAAATTATTTATTTTCCTTTTTGTTGCCCTGTTGTGTTTTTTTTTTTATTG
TCGTAGTTATTATTGTTGTTGATGTCATTGTTGTTAGATAGGACAGAGAGAAATGGAGAG
AGGGGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACTGCCTGTGAAGCGACTCTCCC
TGCAGGTCGGGAGCTCAAACTGAGATCCTTACACAGGTCCTTGAGCTTTGCGCCACCTGT
GCTTAACCAGCTGCAGTACTATCCGACTCCCATTAAAGATTCTTCTAATATGAACATTGT
CCTATTTCTGAAACTCCAATTTTGGACCTGCTTTAGCTTTTACTTTGCTTGCTTACACAG
GTGGTGGTCGGTATGTTCCAGGTTCTTCAGGTTCTTCAGGATCTTCTAACACAGTGTCTG
CAGCAGCAGATCCTTTTACAGGTGCGATGTAGTTTTGAGTAATATTTTCACTAAATATCT
TAGTATGACATTACATTGTGGAGATATAGTCAATAAGTGCTAATTCCCTTATGTGTATTT
CCATTGGTTCTTTCTTTCTTTCTTTCTGTCTTTCTTTTCCTCTTCTGGAATACTTTCGTA
GCTTTCTTTATGACTTTTAAATAGCATACTATTAAAACAATATATTTTTTTTCCAGTGGT
TCCTCCTACAGAGTAGTTAAAAGCATAGGTTTTTTTTAGAGTCAGGCAGACCTTGGTTCA
AACTCTGGCTCTACCAGTTACTTGCTATGAAAAGTTGGCAAGGTGCGTCACCTATGTGAG
CCTTTTATTTAATCCGTAAAATTAAATAATAGGGGAACCCACCAGACAAGACTCAGCATG
AGTGCTATCATGGCACTACTGATCATGAGCAGAGAAGGAGCCATGTGAGTCCCTGATGCT
GGATGGAGAAGTACAGGGAAGAAGTCTGATCAGGCATCTTTTTCCTTAGCATCGAAGGAG
ACAATCCACCCATCTACCTAGGATTAGCCTTACTAGTCTAAGTTATTAGTGACCCTCATG
AAGCCCTGGAAGTGTTGGTGATACTCGTCAGAAACCTTTATGGCCCAGGTACGCAACCTC
AGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTTCTTCTTCTTCT
AGCGTTGCCCTTCTTCCGTAGCCAGTCAACAGCGTCAGGTTGAGCCTGAGTTTCGAGACC
TCCTTTGAATCTGGAGAGGTGTCAGTCGTTGACTATGTGGGTCATAGTCTGTCTGTAGCT
GCAGGGGCAGTTCGTGTTGTCTCTGGCTCCCCAGCGATGGAACATAGCGGTGCACCGGCC
ATGGCCTGTTCGATAGTGATTGAGGAGGGCCCAATCATAACGTGCTAGGTCAAAGCCGGG
TTGACGCTTGCAGGGGTCTGTGATGAGGTGTTTGTTCTTGACCTCAGCTGACTGCCAACT
CTGTTTCTAAGAGTCTGGAACAGAGAAGTTCAGTGTAGGCGTAGGGGACCAGATTGGGTG
ACAAGACCTCAAGCGTTGCTCAGTGGTTTAAAAGCCTCTTTCTTTTTTTTCCTTCCCTGT
AGGCTATGGGAGCCTGAGGGCTTTTAAACTATCAATAGGCTTCTTAGCTTAATCACTGAC
TCCTGACCGAGAGATAAAGCAGGGTGTGGCAGAGATAATCCAGTGGTTATGCAAAGAGAC
TTTCACAGCCCCTCAGCTATGCCACCGAGGTATAGGTCTTCTCCTGAGTTTCCTGGTTAG
ATCTCTGTCTCCTGGTGTACTTCCCTGTCGCTGCTTCAGATTCTGAGGGTAGTAGCAATG
GAGACTCAGAGTTGCACTTGGTGAGTCTCTGGGGAGTCCTCTCCTCCCTTAAGCTGTCCC
CTTGTTGGTGGAGCAGACTGGAGGTGGTGTCTCAACTGATAAACTTCTGAACTGTTAGCA
GTCACTTAATCTCTCCTTAGGCTCCTCTCTCCTCTCTGTCACCAGCCACACGTGTTTGTA
CTCACCTGTGATTTGCTGGGTTCCTGTGGTCATTCTAGTCCTGTCTTGTTTCAGTCTCGG
ATGGTCTCCTTTGGTATTCCTAGTTGATCCAGGAGAGGAGAGGAGAGCTGATAACTTTTT
TCTTTCAGCATATTCAGTTACAGTGATGCCTTGAAACGTAGAATAGCATTTCCTTGGCAG
CAGAAAGAATAACTTCAAATAAAGCCAACAAAATTAAGAGAACTTCTGTGATCATTTTAA
CTGGAGCAGATCTCAGTTTTTTACAGTCATTCAGCAGATACAGTGGTAGTGAAGATGCAT
GTAACTTACCATACTGAATGTTTAAAATATAATTATCAGAGTAACTGAATCACACTGTGA
TTAAAACACACAAAACAGATAGCAACACTTAGCCATATTGAGTTTTGAAAATTAAATGGT
ATAGAGTGGTCCGTCCAGGAGGTGGCACGTGGATAAAGCATTGGATTCTCAAGCATGAGA
TTCTAAATTCAATCCTTGGCAGCCCATGTACCAGAGTGATACCTGGTTCTTTCTCTCTTT
CCTCCTTTTTTTAAAAATATTTATTTATTTTTCTTTTTTTGTTATTGTAGTTATTGCTGT
TGTTATTGATGTCGTTGTTGTTAGATAGGACAGAGAGAAATGAAGAGAGGAGAGGAAGAC
AGAGAGGGGGAGAGAAAGACAGACACCTGCAGACCTGCTTCACTGCCTGTGAATCGATTC
CCGTGCAGGTGGGGAACCGGGGGCTCGATCCGGGATCCTTCTGCCATTCCTTAAGCTTCG
TGCCATGTGCACTTAACCCGCTGCGCTACTGCTCGACTCCCTCTCTCTTTTCCTTCTATC
TTTCTCATTAATAAATAAAATCTCTAAAAAAAAAAAAAATTAAATGGGTGATCTGGGAGG
TGGCGCAGTGGCTAAAGCACTGGGACTCTCAAGCATGAGGTCCTGAGTCCAACCCCAGCA
GCACATGTACCAGAGTGATGTCTGATTCTTTCTCTTTCTCCTATCTTTCTGATCAATAAA
TAAAATATTAAAAAAATTAAATGGTATGATGCACTAATACTGAGCAAAATGCTCAGACTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAACTCGGGACCT
CATGTTTTGAGAATCCAGCGCTTTATTCATCGTGCCACCTCCCAGACCCACACATTTCTT
TTCTTTCTTTTTTTAGATTTTAAATTAATTTATTTTATAATTTAATTTTTTAAAATATTT
ATTTATTTTGAAATAGAGACAGAAAAATTGTGAGGGAAGGGGGAAATAGTGCGGGAGAGA
GACAGGCAGACATCTGCAGACCTGCTTCACCACTCATGACGCTTTCCCCCTGCAGGTGGA
GACTAGGGCCTTGAACCCGTTTCTTTGCATACTGTAATGTGTGCACTTAACCAGGTGCAC
CACTGCCTGCCCCCCTTTTTATTTATTCATGAGAAAAAGGAGGAGAGAGAAAGAACTAGA
CGTCACTCTGGTACATGTGATGCCAGGAATTGAACTTAGGATCTCACGCTTGAGAGTGCA
GTGCCTTATCCACTGTGCAACCTCCCAGACCACAAGAATTACTTTTCTGGCTCAACATGT
ATAAAAAGATGTCATTATGAAGAGTTACTAGTAATTAAAATAAATTATTTAGTGTAAATA
ACGAGCAATTAAGTATCCAAGGAAGTCTTTCTTTTTTTTATATTTATTCCCTTTTGTTGC
CTTTGTTTTATTGTTGTAGTTATTATTGTTGTTATTGATGTCATTGTTGGATAGGACAGA
GAGAAATGGAGAGAGGCAGGGAAGAAATGGGGGAGCCGGGGAATTCTTAATGTGGGTCCT
TGCGCTTTGCGCCATGTGCGCTTAACCCGCTGTGCTACCGCCCAACTCCCTACCAAGGAA
GTTTATGGAGAGAAGAGCAATGGGCTTGCAAACATGAGGTTGTGAGTTCTATCTCTGACA
TCATTTATGTCCAAGTAGTGAGTGCTCTGACTCACACTCACTTCGCACTAATAGTTTCTT
TAAATAAAAGAATGAACAGTTTGAATTTTATGATCTGCAGTTACTTTTGTTTATAAGAAA
TATTAATGCATTTTAGGTGGTGGCCGTTATGTGCCAGGCTCTGCTGGTACAGGAACTTCC
ACGGCTGGAGTTGATCCATTTACAGGTACACATTTAAAATTTTCTTTTAGAGTTTTAAAT
TTTAATGAAACTTATTTGATGAAAAACTATGGGGTGTGTGTGTTTTCAAGGCCACACTTA
CTTGATGAAAAATTATGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTATTCAAG
GCCAAACCCTGTAACCTAGCTTTTAGAGTATTCCCAGAAACAGTGCAACCCTCTTGCACT
ACTGGTGGGAATATAAATTGGTCCAACCCCTGTGGAGAGCAGTCTGGAGAACCTTCACAA
GGCTAGAAATGGACCTTCCTTTTGACCCAGTAATTCCTCTCCTAGGGATATATTCTAAGG
ACTCAGTCACACCCATCCAAAAAAATTCATGTTCACCTATGTTCATAGCAGCACAATTCG
TAATAAACAAAACCTGGAAGCAACACAGGTGCCCAACAACATATGAATGGCTGAGAAAGT
TGTGGTATATATATACATAATGGAATACTACTCAGCTATTAAGAATAATAAACCCACCTT
CTCCAACCCATCTTGGATGGAACTAGAAGGAGTTATGTTAAGAGAGGTAAGTCAGAAAGA
GAAAGACAAGTATAGGATGATCCCACTCATAAACAGAAGTTGAGAAAGAACAGAAAGGGA
AATGCACAATAGAAGTTGACTGAGTTTACAGTATTGCAGTAACTAAAAACCTCTGGGTGG
GGGGTAGGGGGGGTAACAGACCTTTGGTGGCTAGAATGGTGCTAATACACACTCCTACTA
ACTTATAGTATTATAAATCACTATATAATCAATATGAGAGGAGAAAAATGGGTTTTATGT
CTCAAACTTTTTGATGCATAGACCCTAGTTCTGAATTTATTTTCCTTCAATCTAAGTACT
TAACATGTCAAATTGGTAACCTGACTGAAGTTTAACAGTGGGCTTAAAATGTCATACATC
TCTAACAATGACTATTTCTTTGAAATATTAAATCACCTATAATCTTAGACCAGGGAGACC
AGAAGCAACTGGTTGTGTCACTATATAACATACAGCTATATAAGAATAGCATTAAGGGAG
TTGGGCGGTAGCGCAGGTGGCGCAAAGCACAAGGACCGGCTTAAGGATCCCGGTTCCAGA
CCCCAGCTCCCCACCTTCAGGGGAGTCGCTTCACAGGTGGTGAAGCAGGTCTGCAGGTGT
CTATCCTTCTCTCCCCCTCTCTGTCTTCCCCCCCCCTCCATTTCTTTCTGTCCTATCCAA
CAATGACAACAACAATAATAACTACAACAAGGGCAACAAAAGGGAATAAATAAAATAAAT
TTTTAAAAAATAGCATTAAATGACATGAATCATGGTGAGAGCTTGTATGACACAGCAAAT
CCTATTCCTGGGATTTTCAAAGTAAACCAAATTCCTAAATAACTTCGTTACAAAAGTAAC
TTTCCTTCTTAAACTCTAAGACAGCAGGACCCTTCCCCCTTCTCTATAAAACCCATATTT
CTCCCAGTCCTAGAATACTCCCAGAATTATCTTATTACTGCCCATTTCGGGAGCTTATAA
AAGTATTTCAGGGGCCCCGGGCGGTAGCACTGGGTTAAGCGTACATGATGCGAAGCACAA
GGACCAGCATATGGATCTGGGTTTGAGCCCCGGCTCCTCACCTCCAGAGTGGTCGCCTCA
CAAGTGGCAAAGCAAGTCTGCAGGTGTCTTATCTCTCTCTCCCCCTCCTCTCTGGATTCC
TCTGTTCTATCCAACAACAAGGACAGCAATAACAATAATAACAACAATGATAAGGGCAAC
AAAAGGGGAAAAATAGCCTCCAGGAGCAGTGGATTTGTAGTGCAGGCACCAAGCCCCAGC
AGTAACCCTGGAGGCAATAATAATAATAATTTTTGACTACTTACTGTGATTTTCATCTTT
TGTTCTGTGAATAGGGAATAGTGCCTACCGATCAACTGCATCTAAAACGGTGAATATTTA
CTTCCCCAAAAAAGAGGCTGTTACTTTTGACCAAGCAAATCCTACACAGATATTAGGTAA
GTATGTTTTAATTAAATAATTTTCTCATCTATTCATATACCCTTGAAAGATCTCAGTGTT
TTTTGTCCTGGGAACGTGGTATTGACGTCTGCTATGATATTATATAACTACAACAAACAT
ATAGTCTGATAATGAGTCCTTAAATCTTTGTAAGAAGCCTAATAAATATAAAGTAAAGGC
TGAGGAGATAGCATAATGGTTATGTAAAAAGGCTTTAGTGCCTGAGGCTCTGACACCTCA
GATTCAGTTCCCAGCACCATCATGAGCCAGAGTTGAGCAATGTTCTGATAAAATAATTAA
AATAAATAGTTACAAAACATACATATATATTAAGTACCTAATGATGACTTTAGTAAGAAA
AAAAAACTAGAGAAAAATGTAAGTTCTATTCCTGTATTCTCTTAATGTCTTCAGGTAAAA
ATATGCAAACAATTTTACAGTTTTATTAATGAAAGAACCATACCATCATTGTATTTATGC
AGTGCTGAGTTGAACTCAGGACTTCATGTTTTCAAGTCCTACTTTGAAAGTCCTATACTC
TTGTTACCTTCTGCTGTACCACCTGTCACCTTTCTGCTACGAGAAACCATTTTAGAAAGT
AAAAATTGCATCTTTTTAAAATTAGTGGCCTGGGGCCTGGCGGTGGCGCACCTGGTTAAG
CACACATTACAGTGCACAAGGACCCAGGTTCAAGCCCCTGGTCCTCACCTGAAGGGGAAA
AAAGCTTCATGAAAGAAGCAGAGCTGCAGATGTTTCCCTCTCAATTTCTCTCTGTCTCTA
TTCAATAAGTAAATACATATATGCCCAGAGCCAGGTGGTGGCACACCTGGTTAAGTGTAC
ATGTTACAATGCTCAAGGCTCGAGTTCAGAACCCCTTTCTACACCTTCATGGGGGGAAAG
CTTTGCAAGTGGTGAAGCAGTTCTACAGGTATCTCTCTCTCTCTCTCTCTCTCTTTTTCT
CTCTGTCTCCCCCTACCATCTCAATTTCTGGCTGTCTATCCAATAAAAGATAATCTAAAA
AAATTGAAAAATACTTATTAAAAATTAGTGGACCGTGGAGTCTATTTAACTAAAAGATAG
TTTAAGTTGTACATTAAAAGTGAGAGTTGGGAGTCGGGCAGTAGCGTAGCAGGTTAAGTG
CACATGGCGCAAAGGACAAGGACCGCCGTAAGGATCCCGGTTTGAGCCCCTGGCTCCCCA
CCTGCAGGAGGTTGCTTCACAGGCAGTGAAGCAGGTCTACAGGTATCTTATCTTTCCCTC
CTCTCTATCTTTCCATTCTCTCTCCATTTCTCTCTGTCCTACCCAACAGCAACTATGACA
ACAATAACAACTACAACAAGCACAACAATAAGGGCAACAAAATGGGAAAAATAGCCTCTA
GGAGCAGTGGATTTGTAGTGCAGGCACCTAGCCCCAGCAATAACCCTGGAGGCAAAAAAA
AAAAAAAAAAAGTGAGAGTTGACATAACTATGACCTTAGGAGAACTATGGTGGTTATAGC
TGGAGAAGAGTGGGGGCACAGAATATATATACTGAATATATTAATAATTAAATATATTAA
TAATATATCTTAATATATTTTTTAAATGAGGTTTGAGGGGCTGGAAGGAGTTGGACCCAG
TTAAGTGTGTGTTTTTTTTTTTTATTTTTTTACAATGTACAAAATCTGGATGCAAACTCC
CAGTGCCCACCTGTAGGGGTAAAATTTCACAAGCTGTAAAGCAGTGCTGCAGATATCTCT
CTCTCCCTCTTCCATCGTCTGTTTCTCCCTTCCCTCTTGATTTCTTCCTGTCTATCCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGTCGTCTTTGTTGTTTTTATTGTTGATGTCGTCTTTGTTGGATGAGAGAAAT
GCAGAGAGGAGGGAAAGACAGAGAGGGGGAGAGAAAGACTCCTGTAGACCTGCTTCACTG
CTTGTGCAGCAACTCCCCTGCAGGTGGGGAGCCAGGGCTTGAAATTGGGATTCTTATGCT
TATTCTTGTACATTGCACCACATGCGCTTACTCCACTCTGCTACTGCGGAACCCCTTTTA
TTGTTATTTTTTTTTAGATTGGATACAAATATATTGGGATTTAATTGAGATAAGATAGCT
TCTACATATGAACATGAAATGAGATTTCTGGACATTTTTTCAAGTCATAAAAATCTAAAG
GGACTCTTATTTTATATTCCATATAGAAATGTTCAGTATTCTGTTAGTGATAAACAAAAA
CTTTAGGGCCAAAGAACAGTGAAAGTGTTTCAAGTTTTCTGTTATGGTTAATAAAAAATT
TATAAATTGGGACAATTTATTTTCCTAATCCTTTTGTGATAGTTGTTTGGGCTCTTTCTT
TGAGAAAACAATATAAAATGACTGAGTGAACTGGGAGGTGGTACAGAGAATAAACAGTGA
ACTATAAGTAATGTGTTCAGTGTGTGTAAAAGAACTAAATAAATTAAGCATTGGAAAAAT
ATTTAAGTCTTTGACTATTTTCCTGACAGGTGAAATTTAACTCACTGAAAGTGCTTCTAA
ATTTTCTTATTGAGAAAATGTGGGATTGACTTTTTTGGCATATGATATATGACATTGTTT
TGAAAATAGCAGTGATTACAAATATGATATATTTTAACACTTGCACTAAGTGAAGAGCTT
TAGAAGATCTTAGAAAAATTACAGGTAAAGGGGCCAGACAGTAGCACACCTGGTTAAGCA
CTCATATATTATTGTGTTCAAGGACCCAGGTTCAAGCCCCTGGTCCCCACCTGCAGGGGG
GAAAGCTTCACGAGTGGTGAAGAAGGGCTGTAGGTGTTTCTCTGTCTTTCCTCCTCAATT
TGCCCCATCCCTCTCAATTTTTCTCTGTCTTTATCCAATAAGTATATAAATATTTAAAAA
ACAAAAAAACATAATATAAAGTATAATATAATATAAAGTATATCTGTAACTTTTCTTTTT
TTGTATTATGCTTAGTTTAAAAATACTCAGTGGACCTTGATTGTATGGTCTTTGATAGTT
GCTGTGAAAAGTCTGTCTTCCCGTGGTGTATTGTAGAGTACTGTTATTCAAAATTTTCTT
ATTTATCTATAACTGTCTGTTTGCATACAGTAAGAGAATTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAACTATAGTGTTA
AGTTATAGCAGTCTAGATTGAGATTAAGTCATCTATATCTGCTTAAGGCTCTGATATGTC
AGTTGGCCTTATTTCTCTGGTCCTTTCGTACTAGGAGAAATATTTAATAGATAGAAACCG
ACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAC
CCTCCCCCTTCCCCTCTCCCTCTCCTTACTGGATGTAAAAAAAAAAACAAACTACCCAGG
AGCAATTGAATCATATATGCAGGAAGCCACGGTGGCACAGAAAAAGCGGGAGAAAGGAAG
GACTTTTATGAGACAGGCACATGATCTTTAATATTTTCTGAAATTGTAACAAGAAAATGC
AATCGTTAAAAATTGAGGTACAGTCATAGATTTTTTTTTTCCCTAAACATTAATGAATTT
TTCTCTTTTAATAGATATTGTCTTTCCTGCACTTGACATTCTTCGGTTGTCAGTTAAGCA
TCCCACTGTGAACGAGAACTTCTGCAATGAAAAGGAAGGGGCTCAGTTCAGCAGTCACCT
TATCAGTCTTCTGAACCCGAAAGGAAAGCCAGCAAATCAGCTGCTTGCTCTCAGGACTTT
TTGCAATTGTTTTGTTGGCCAGGCAGGACAAAAGCTCATGATGTCCCAGAGGGAATTGCT
AATGTCCCATGCAATAGAACTGAAATCAGGGACCAATAAGAACATTCACATTGCACTAGC
TACACTGACCCTGAACTATTCTGTCTGTCTTCATAAAGACCATAACATTGAAGGGAAAGC
TCAGTGCTTGTCTGTAATTAGTACAATCTTGGAAGTTGTACAAGACCTAGAAGCCACTTT
TAGACTCCTTGTGGCTCTTGGGACACTTATTAGTGATGATTCAAATGCTGTACAGTTAGC
CAAGTCTTTAGGTGTTGACTCTCAAATTAAAAAGTATGCGTCCGTATCAGAACCAGCTAA
AGTAAGTGAATGCTGTAGACTTATCCTAAATTTGCTGTAACGGCGGGGGAGGAACTAAGA
TTTTCAATTCATTAGTGTATTGTTTTTTTTTCCTCACATTTTTCATGACTGATTACAGAT
GATAAACAAATGCTGTGGATTAAGATTTCAGATCTTGTAAAGTTTGGGAAGGGGGGCAAA
GGAAAAATAAAATTTTTGCATTGATGGACTGTGAAAATTTCCTGTGTAATGTCAGTGGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1149, 23506..23699, 27127..27227, 27313..27433, 30953..31120, 31923..32058, 32159..32328, 54020..54177, 55594..55813, 60592..60672, 65708..65776, 67686..67787, 71352..71516, 72066..72631
1001..1149, 23506..23699, 27127..27227, 27313..27433, 30953..31120, 31923..32058, 32159..32328, 54020..54177, 55594..55813, 60592..60672, 65708..65776, 67686..67787, 71352..71516, 72066..72628
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved