Erinaceus_europaeus Locus TCP1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus TCP1
Erinaceus_europaeus
TCP1
GeneScaffold_2905
SNORA29, SNORA29
5814..5952, 7486..7619
12662
GGACGCCCCCAGATTTATGAGCCTAGAACCGGGGCTGGCAACCTCTAATCGGGACAAGC
TGCAAGGGAGAGAGCGACGAACTAACAAAAGGCCAGAAGCCTTTGGATCAGCGACCGTCT
CTCGTTCACAAGACACTTCTAACACCCCCCCCACACCGGCACGCCCGTTTCAGCCCCTTT
TCTAGAAAGCACGCGAATGTACCAGTGCGCATGCGCCCCCCGTAGCCCCTCACTTCCGGC
CCCCCTCCCCTCGCACCCTGCTGCCGCGTTCTCATTGAGCGAGGAGGCTGAGTCCGCCTT
CTCGCGGCTCCTCACTTGCTGCGCCTTCACGGAGGCCCCGCCCCACTTCCGGTCTGGCCC
GCCCCGCGGCGCGGCTCTCTGGAGGGGCTCCCAGCAGCCCCCGCGCGGTCGTTCAGGCCG
CTCTTCGCCGTCGCCCTCCGCGTCGTAGCTGCCGCCGCCCGACCCGGGAACCGAGAAGCC
GGTGGTGTCCGCGCCTCCCCGAGAGCCCGCAGCCAGCATGGAGGGGCCTCTGTCCGTGTT
CGGGGACCGCAGCACCGGGGAGGCGATCCGCTCGCAGAACGGTCAGGCCGCGCCTCCGCC
ACGCGCGGGCCCCCGGGAAGGGCCGGGAGGGGGCGCGCCCCCGGGGGAGCGAGTTCGGGG
GACCCGGATGGGGGGGGAGACCCGGGCCGGCGGAAGAGGCCCGGATGGCGGTGACCTGGG
GCCGGGGGGGTGGGGGTGGGGCCGGGGACACTGCCGCACCCCCGCGCGGACACGTGCGCC
GCGCCCCGACTTCCGGCGGGAGGGGGGGAGCCCGCGGCTCTTTGGTTCCGGCCCAGGTGG
GGGCGGGGGGCGAATGGAGACCCCGGGTTCGAGTCCCCCGCTCCCCGCCTGCCCGGGGCG
AAGCTTCCCGAGGCTCTGCCACCCCTTCCCTCGGGATGCCAGTCCGGAGACAGTGAATGA
AGACGGGGGGAGTGGCCGCCGCCGGGGCGGTGGATTCGACTGGCAGCGCAGACTGCGGCG
ACCTGGTTGGCAGAAGACAAAGGGACGGAGGCAGGCAGGCAGGCAGCGTAGCAGCCGCCG
CTCCCTGAGTACCATAGCCCTGGGGGGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNACACGTGCGCCGCGCCCGACTTCCGGCGGGAGGGGGGAGCCCG
CGGCTCTTTGGTTCCGGCCCAGGTGGGGGCGGGGGGCGAATGGAGACCCCGGGTTCGAGT
CCCCCGCTCCCCGCCTGCCCGGGGCGAAGCTTCCCGAGGCTCTGCCACCCCTTCCCTCGG
GATGCCAGTCCGGAGACAGTGAATGAAGACGGGGGAGTGGCCGCCGCCGGGGCGGTGGAT
TCGACTGGCAGCGCAGACTGCGGCGACCTGGTGGCAGAAGACAAAGGGACGGAGGCAGGC
AGGCAGGCAGCGGAGCAGCCGCGCTCCCGGAGGACCATAGCCCGGGGGGGGGGGGGGACA
TGTCGGGGAAGATGGCCGCAGGGCTGTGAACCCCACTCCATCAGGACCCAGGGAGAGAGG
AGGAAAAAGCCAGGCGCACCCGGGGGTCGCGACCCGTGTAGGTGTGACATGGAAAGGAAG
AGAAGGCAGGCCCAGGGGGGGGGAAAAATATATATATATAATCACACGCACGCACAAAAT
ATACATATACACGCACAAAATATACACATACGCGCACGCACAAAATATACACATACGCGC
ACGCACAAAATATGCATATACCCACGCGCGCGCGTGTATGGCTGCAGAAGTGACCATCAG
CCCGCATCGGTGACCTTGGGGGAAACCGCTTCCGTTCCCGGTGGCGGGGCTGGGGGCGCA
GAACTCCGGTGCTGGGAACGGGGTGGGATGGCAGCCCTGTGGCCTTGTCGTTTCGTGAAT
CAGTACTAAGTCACTGATCAGAAATTTTTATTTATTTATTTTTTTATTTATTTTTAAGAG
CTGGCGTGATGGTTCTGCTAAGAGACTCTGGTGTCCTGAGGCTCCAAAACCCCAGATTCA
GTTCCCAGCACCACCACAGGCCAGACCTGAGCAGGGATTTGGTCAAGAAAATTAAATAAA
CAGGGGCCAGGTGGTGGTGCATCTGGTGGTTAAACACATGTTAGGGTGCACAAGAACCCA
GGTTGGGTTCAAGACCCCGGTCCCCACGTGCAGGGGGAAAAGTTTCAGGCGTAGTGAAAT
AGGACTGGAGATGTCTCTGTCCAAAAATAACAATAAAGTTCAATAAACAAACATAAATGT
GTTGTCTCCGGATCCGACACTGGGGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAGAAAGAAGAAGGTGCTC
TTGGGCAACCTTTGCTCGTGAGCTACTGGGATCTGCTGCTTCTAAAACGACGACAGTAGT
TTTGTCTGTGTAACTTGTTCATACTCATCAGGCGATGTGTCGTCTCAGTCCCCCCTCCCC
ATCTAATTACTGATAAGACCAGAGCACCACTCTGGAACATGCAACTCCAGGTATTGAACG
GTTAGATTTTACTTTGGAAAGTGTCATATTTTGCCTCTCAGTAGTATTTGAGTTCACTTA
ATCCACTGTACTGCCTCCTGGACAGCTAAAAAATATTCCTTGATACTCTGTACATCTATA
GATTTAAAAGAAACTAAGTGGCCTGAAATAATACACATATTTGGGTAGTCCTGATTCTTA
AAGGCAGTCAGTGGGGGCCAGGAGGTGGCTTCGTGGTACAGTTCACCCGCCTGGTATGCA
GGGGCCCTGCACTCAGTCCCTGGCATCGCGTGGTGGGGATGCCAGTATCAGAAAATAAAG
ACCCCGAAGGAGCTGGCCAGTGTTCCTGGTTGAACACACATTATGCAGTGTGCGAGGCCC
TGGGTTCAAGCCCCCGGCCCCCCGTCTGGCTTTGTTGTTTTCAGGTTTCTAGTTAATGCC
TCTTTCATTTCACTGCGTCGCCAGCTGAGTCTCATGAAGAGTGGTCTTTGCTCTGCAGGT
CATAATTGCGGCCGAGCTCCTCAAAAACGCAGACGAGCTGGTCAAGCAGAAGATCCACCC
CACATCGGTCATCAGTGGCTACCGACTGGCATGCAAGTAAGAGCGCTTGCACTCGCAGGA
GGTTTGTGGTGCTTGGTGCAGCACGTAGTTTGTGGTCTGCAGATGTCTTGAGCCGTTAGA
TTTTACTTTGGAAAGTGTCGTATTTTGCCTCTCAGTAGTATTTGAAGTTTTTTCCCATTT
GACTACCACATTTTCTTCTCTTACTGGAATTTCGTGGCTATGCTTGTGGGATAGAGTAAT
GCCGCCGTGATCTGAAGGAGGAGGGTTTCCTGTGTCCTCCTCCTATATGAAATGGCCGGA
CAGAGCGGTTTCGCCTGTGTTGGTGGCATCACGGTCGACGTGAAACCACACTGAGCCGGG
GGTTTCTGAGCGTCTTCTCCCCATCCTCCGATTAGGGAAGCGGTGCGTTACATCACAGAA
AACCTCATCATCAACACAGATGAGCTGGGGAAGGATTGTCTGATCAACGCTGCCAAGACA
TCCATGTCATCCAAGATTATTGGGATGTATCCTTGCGTGGTCTGGGAAGGGTCAGGCTGT
TGCAGAGATGCGGCTGTGTGTCCGCTTTTTGTGCCTGACATGGGCTGGGCTGGGCTGGGC
TGGGGGTGGCTGCCTGTGGCCTGGTGCATGCTGTGCTGTCTGGCTGAGCCACTGGCCTGG
CCTGTGCTCCTTGGACACTGCTCTTCTCTGTAGAGAAGGTGACACCGCGGGTGAGGAGTA
CTCTGGGCTGCCGAGAGGAAGCCTTTTTGATTGAGCGTCGGCTTCGTGCATGCCCCATGT
CCGTACCAGGCCCTCTCTCCTTAACTGTGGCCATAGAAACAGTGATTTCTTTGCTAACAT
GGTTGTGGATGCTGTGCTCGCCATCAAGTACACAGACACGAGGGGCCAGCCGCACTACCC
AGTGAGCTCTATAAACATTCTGAAGGCTCACGGGAGGAGCCAGTCGGAGAGCTTGCTCGT
CAACGGCTATGCGCTCAACTGCGTGGTGGGCTCGCAGGGTGAGGCTCCGCTTACTGCTGT
CAGGCTCCCGGGGAGGGAAGGAAACCGCGCTGCGGTCAGTTTCTCTGTTGTGACTGACAC
ACACAAGCCGGGAGGGAGGCGGGGCAGGTGCCCGTGGCGCAAAGCACAGGGACTGGCATA
AAGATCCTGGTTCGAGCCCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCACAGGCGATGA
AGCAGGTCTGTAAGTGTCTGTCTTTCTCCCTCTCTGTCTCTCCTCCTTTCTCAATTCCTC
TCTGTCCTATCCAATAATGAAGACATCAATAACAACGATAACTACAGCAACAAAAAACAA
GGGTAACAAAAGGGAAGACGTTTTTAAAAAAAATTTTTTTAAGCAGGGAAATGCATTTCA
GTGTTGCAGAGGTGGGTTCCTGGGATTCTGTGCGTACAGGTGACGGACGGTTCAGGGCTC
CCCCGCTGTCCTTTGGGCCTACGATTCCGTTACGGACTGCTAGTTACTGTGTTTTATTAT
TGATTGCAGGCATGCCCAAGAGGATAGTCAACGCGAAAATTGCCTGCCTCGATTTCAGCC
TCCAGAAGACAAAGATGAAGCTTGGTGTGCAGGTGGTTATCACAGACCCTGAGAAGCTGG
ACCAAATCAGACAGAGGTACACTGGCTCTTTCTGGTGGGGGGGGCTTTGCATCAGCTAGA
GAAAGCGCTCAGCTTAAGAATCCAGAAAATATGGCTGTAGTGAAGGAGACAGACCTTTTA
AAAGACTCGGAACCGCTGTGCGTCTCAGCTCACGACTGTACTGTGTGTGTGTGAGTACTA
AGATTGGGAGTGAAGAGGCCGGACCACGCCTGCTGTATGCTTTTTCCCATTTGACTGCCA
TGTTTTCTTTGATAGTAGATTTTCATGGATATGCTTGTGGGATAGAGTGATGCTGCCGTG
ATCTGAAGGAGGGGGGTTTCCTGTGTCGTCCTCCTATATGAAACGGCCGGACATCATGGG
CGCCCATGGATGTCAGCGGCCCTCCACTCCGCTCAACTCGTGTGACACCCTTTTTCCCAC
CTTGCCCCCAGCCTAGAGGAGGCCCACCTGTGATGCGATGTCTCTTGCCGGCATCTGAAA
AACTGGTGTTTTGTTTCTCATTTCCTCCCCTTTCATTTTAGTGATCAAAGGACTACTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCATTGGTGGTGACCCCAGA
GCTGACCGATGCCCCTCAGACCTCTACTATCATCTGTTTAGACCCACTCTACCTTTTTTT
CTGAGGTACAAATGATTCCAAAATCTCTTTTGCTGCCATGTAATTAACTGCAAAACTAAT
TAAAAAAATTTTTTTTATTTAAGAAAGGATTAATTAACAAAACCATAGGGTAGGAGGGGT
ACAACTCCACACAGTTCCCACCACCAAATCTCCATATCCCACCCCCTCCCCCGATAGCTT
TCCCATTCTCTGTCCCTCTGGGAGCATGGACCCAGGGTCATTGTGGGTTGCAGAAGGTAG
AAGGTCTGGCTTCTGTAATTGCTTCCCTGCTGAACATGGGCGTTGACTGGTCGGTCCATG
CTCCCAGTCTGCCTCTCTCTTTCCATAGGGTGTGTCTCTGGGGAAGCTGAGCTCCAGGAC
ACATTGGTGGGGTCTTCAATCCAGGGAAGCCTGGCTAGCATCCTGATGGCATCTGGAACC
TGGTGATTGAAAAGAGAGTTAATATACAAAGCCAAACAAATTGTTGAGCAATCATGGACC
CAAAGCTTGGAATAGTGGAGAGGAAGTGTTAGGGAGGTACTCACTGCAAACTGTAGTGTA
CTTCTACTTTCAGGGTATATATTTTGCAGTAGTTTATGGATATGTGTGAACATAAACTCT
CTCTCACAGAAACTGGTGTATATCTAGGTTATGGGACTTTGTTAGAAAGTGAACTCCCTG
AGATGAAATTAGAATGTACTATAAAAGGAAAGGTCTCACCGCAGTAATGAAGCCGAAGGG
TTGTCATTCCCACATGTGAAGTCTCTGGACACAGTCTGAGGTGAAGCATGTTGAGGTGGC
AATCGTTGCGTTGGTTAGGTTGTGATCGGCGGATGCAATATTATTTGGTTTGGATTGGGA
GACGCATACGGGAAAGTGGGCCCTGTCCAAGGGTTCCAGGACTGGGGGAAGTAGGGGCTT
TGTAGTGGAGATGTGAGGTTCCTGCTGTCTTAGGGTTCAAAAAGACAATCGAGAAACAAA
ACACCAGTTTTTCAGATGCCGGCAAGAGACATCGCATCACAGGTGGGGGCAAGGTGGGAA
AAAGGGTGTCATTCAATTTTAGTGATCAAGGACTACTGCCAAGCCTTGGAATACTTCTTT
TTTGAAACGGGGGGTGGGGGGGGGCAGGCAGCTGTGCTTACTTCCCAGTCAAAACCTGCC
GCTCCCTGAACTTGTGATCTCAGTACAGGACGACAGCCTGTCCCAAAAGGAACCCCCTTT
CTGACTAACGCCAGCTTAGTTTTCTTTCACTCCAAAAATGAACATACCCGTCACCCAAGA
CCCTGTGTTCTCAGATCAGGTCCTCTCTATTTGTTACCTCTATCTTTGGTCATGCTGCTT
CCTGCTTTAAAATGTTAGGCTTTGGACCAGCCCATGGTTTTTGGAGGTACCCATCTTCCT
ATTTGACCTGGACTTAAAGATCTGTAAGCTTTCCTTGTCATGCCTTCCACTCTGAATTCT
AACCACACTTTTTGGTTGGCAGTCCAGATTGGATCAGACGAGAGCTAAGTGATGGTGGGT
TTTCTAACACACACAAGAAGAAGGGGGGGGGGGGGGAGGAAGGAGACTAGGAGAGAGAGA
AAGGCACCTGAAGTTCTGCTTTCGCCTGCACGTGGGAAGTGGGTGCACCACTGTCTGGCC
CATTAAATGGGCTTTTAACTCCTTGGACTTTTTTTGTAACAAATGGTTGATTCGATTTAT
CTGGACTACCTTTATGAAAACCTCACCATGGGAAACTGGATCATTACTGTGAAGCACACA
AGACAGCCCTGACGTACTCCTCTAATGCTTCTCTCCCCAGAGAGTCAGATATCACCAAGG
AGCGGATTCAGAAGATCCTGGCGACCGGCGCCAACGTGATTCTCACCACTGGTGGGATCG
ACGACATGTGTCTCAAGTATTTTGTGGACACTGGCGCCATGGCAGTCAGGAGAGTCTTGA
AGAAGGACCTGAAGCGCATCGCTAAGGCTTCTGGAGGTCTGTCCGGGGCTCGCGGTGCTT
TGGGAAACAATTTAGGAAGCTCAAGGCGCTCTGACTTTCCTTATCTCGAGGGCTGTGTCA
CTTTGATAGTTATTTCTAACCATTGTGTTATGTGTGACTTAAGTGGACTTATTACAGGTG
GTGGGTTTTTTTCGCCACCAAGGTTATTGCTCAGTTATGGTCTCAGTGCCTGCATGACAA
ATCCACCTCTGCCTGTGGGCATTTACTTGCGCCTATTTTGGTAGTGCAGAGACAAGCTGA
GAGGGAGAAAGGTGAAGTACCCCCACGCCCACCCCTGCATGTAGGGGTTAGAACCCAGGT
CTGCCACTGCCCAGCCACCTGGCACAGGCTTTTTAATTTTTTTTTTCCCTTTTGTTGCCC
TTGTTTTTGTTGTTGTTATTGCTGATATTGATGTCATTGTTGTAGGACAGAGAAATGGGG
AGAGGAGGGAAAGAGAAAGACACCTGCAGACCTGCTTCACCACCTGTGAAGCGACTCCCC
TGCAGGTGGGGAGCCAGGAGCTGAAACGGGATCCTTAACCATTCCCTGAGCTTTGCGCCA
CCTGTGCTTAACCTGCTGCACTACCGCCCGACTCCCCCGACAGCGGTCTTTACCTGGTTC
CACAATACCAGTATATGGGGACTAGTCCCAGGGTCTCCTCTTGGGAGCTTCACTGGGGGT
GTGGGGAGTAATGCTTTACAGTGTGACCACTGCCACACGAGCCTTTCATTATGCACCAAG
CCCCAAAGTGCTCTTCTGCCCCTCCTTCCCAGAGTCCTCTGCTTTGATGCCATGCTTAGT
CCACTCTGAGGTGTCTGTCTGACCTAGCTCAGCAATTCTTTGAATGTTAAGTCTTGCTTT
GTCAGGTTTTTGTCTAGTAACCTGCAGAGAAATAATACATAGATATTCCTGAACCTGTGG
CAGGTTAGGAGTGTTCATGGGAGGAGAACCTGCTTACGGATCTTTTGTGATTGTCTTGCT
ATAGCCATTATCCTGTCAACACTGGCCAACCTGGAAGGGGAAGAAACTTTTGACGTCTCC
ATGTTGGGACAAGCAGAAGAAGTGGTCCAGGAGAGGATCTGTGATGACGAGCTGATCTTG
ATCAAAAAGTAAGAGCTCCCTTCAGGTGACAGAGCTGCCCAGGCCTCGCCGGCTTCCCAT
TGATTTGCTGCCACGATCTCGCGGTGACGTGAGCAGTTATACGCATGGGATACAGCAACC
CCAGGCCACTGCGAACTGGGCCGGGCGGCCTCCCTCCTGCCTCTCTCTCCCACGCGTGGT
CTGGACATCTCGCCACGGCCTCTCCGTCCTGTGCGAGCGGGGCTCAGAAACAGGCTGGCC
TGGGCCTCCTGCTTCTGACAGTGACGTGCTCCCCTTGCAGCACGAAGGCTCGTACCTCCG
CGTCCATCATCCTGCGTGGGGCCAACGACTTCATGTGTGACGAGATGGAGCGCTCTCTGC
ACGATGCCCTGTGTGTGGTGAGGCGAGTTCTGGAGTCCAAGTCTGTGGTGCCCGGCGGTG
GGGCCGTGGAAGCAGCCCTGTCCATCTACCTCGAGAACTACGCGACCAGCATGGTGAGCG
ACCAAGAGAACCGGGGGTGGGGGGGTGAGGCCTCCATTTATTGGGGGGGGTGTCCTCACT
TGGCGGTCTCTTTCCAGGGCTCCCGGGAACAGCTGGCCATTGCAGAGTTTGCCAGGTCTC
TGCTCGTCATTCCCAACACCCTGGCAGTCAACGCTGCCCAGGACTCCACAGACCTGGTTG
CAAAGTTGAGAGCTTTTCACAATGAGGCTCAAGTTAACCCAGAACGCAAAAACCTGAAAT
GGTAAGTGTGATCTCCACTCCCCACCTGTGAACCCGGAAGCCTCCCATGTCCCTGGTGTG
TGAGGATTCCCTGGGCTTCCCAGCCTGCCCCCAGATGAACATGATTGGGACGCTTGGAAC
AGGAGTGAAAAGGCCACCTAACTGGTTTATTTTTCTAAAACTGCAGGATTGGTCTTGATT
TGGTCAACGGTAAACCCCGAGACAACAAGCAGGCAGGGGTGTTTGAACCCACGGTAGTCA
AAGTCAAGAGCTTGAAGTTCGCCACAGAGGCCGCCATCACCATCCTCCGCATCGACGACC
TCATTAAGCTGCACCCCGAGAGCAAAGACGACAAGCGTGGGGGCTACGAGAACGCCATGC
ATTCGGGGGCCCTGGATGACTGACTTCCTTTCTAGCAATGTTACAGACACACAGTTGACC
TGTTCCTGCAGTTACATTAAACACGAGTTGACACAGCTCAGCTTCTGTCCTCTTTTGGTC
CGGTGGTTTTCCCAGCCAGTCTTGGTGACGTCCAGGTTTCAGCGGCGGTTAAGCTCACCC
CCTCTGCACACACAGTGCTATCCCCATCCCGCCCCCGATGCACAGGGCAGCCACCCCGCG
GTTGCCGCCCGTCCGCTCCAGGGTGTGCAGCAAGGTGACCAGGATTCGGCAGCCCGACGC
TCCCAGGGGGTGCCCCAGTGCTATGGCACCTCCTTGTGAGTTGACCTGCAGGGAAAGATG
TGGTTTATTGTAAACCTCCCAGTGTCCTCGGCCCCTTGCTAAGCAAAGTGACCTGACTGC
CAGCACCCTGGACATAGCCAATCACCTACCTGTGTTACACAGTCAAGACTGGAATCGGGT
CACTGATCTGAAACCCGCTCAGGGTTGCTAGTTGATACTTACCTTTTCTGGGTCTAATCC
GAGCTCTTTCATTATGGCGACAGACAGGACTGCAAAGGCTTCGTTAATTTCAAATGCGTC
CACGTCTTCCAGGGCCCAACCTGCTTTTGCCACCTGAAAAAGATCAATAAGGTTGACGTA
TTAAATTCAAGTGGGTGGTCCGGGAGGTGGTACACTGGATAAAGCGGTGGAAGGACCGGC
GTAAGGATCCCGGGTTCAAGACCCTGGCTCCCCACCTGCAGGGGGTCGCTTCGCAGGTGG
TGAAGCAGGTCTGCAGGTGTCTCTCCCCTGTCATCCCCCCCTCTCCATTTCTCTCTGTCC
TATCCACAACGAAGAAATAAATAAATATATATATAAAGAAAATTCAAGTGGAAATGAGGG
TAGATGGCATAATGGTTATGCAAAGTAACTATCATGCCTAAGGCTTCAAAGTCCCAGGTT
CAGTCCCCTGCACCACCATAAACCCAGAGCTGAGCAGTGCTCTGGTTAAAAGGTGGTGCA
AGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 3720..3805, 3906..4034, 5582..5679, 6039..6149, 6460..6641, 7153..7279, 9764..9939, 10928..11051, 11324..11516, 11601..11764, 11930..12146
1001..1064, 3720..3805, 3906..4034, 5582..5679, 6039..6149, 6460..6641, 7153..7279, 9764..9939, 10928..11051, 11324..11516, 11601..11764, 11930..12143
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved