Erinaceus_europaeus Locus SRCAP
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SRCAP
Erinaceus_europaeus
SRCAP
GeneScaffold_926
SNORA30
2007..2138
47417
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACCTGCAGACCTGCTTCA
CCACCTGTGAAGCGACTCCCCTGCACGGTGGGGAGCCGGGGCTCAAACTGGGCTTTGCGC
CACATGCGCTTAACCTGTTGTGCTACTGCCTGACTCCCTCTTAGGAATATCTTTAAGGTC
TCATCTCTCTTTTTTTTTCTCTCTCTTTCTCCAGAGCACTGCTCAGCCTGGTTTATGGTG
GTGGCAGGGATTGAAACTGAGACTTTGCAGCCTAGACATGTACCATTACCCAGTCTGTCT
CTTCCCTCCTTTTGTGACTATGTATTCATGACCATGTATTCATGACCATGTTTTCAGGTC
AAAAGATCCTTGATGACCCAACCATTTCATGTTTGTGACAGGTGGTGCAATTCAAGCAAC
AGTCCCGACTGGAAGAAAAGCGCAAAAAAGCTCTAGACCTGCATCTGGATTTTATCGTGG
GGCAAACGGAAAAGTACTCAGACCTCTTGTCCCAGAGCCTCAACCAGCCTCTAGCCTCCA
GCAAAGCTGGCTCTTCCCCTTGCCTTGGGTCTTCCTCAGCTGCCTCTAGCCCTCCACCCC
CCGTTTCCCGACTGGATGATGAAGGTGTGTGTCCTCTTTGGCTCTGTTACTTTTCCTCTT
GTGCCCTTTCCAGAGCTGAAAACCCACCCTGTGGCTTGCAGGGCCCCGTGGACTTTGTGA
CCTTGTTCTCCTGCTATAGATGGGGACTTCCAACCCCAAGAGGAGGAGGAAGAGGATGAT
GAGGAGACCATTGAGGTTGAAGAACAACAGGAAGGCAATGATGCAGAGACCCAGAGGCGC
GAGATTGAGCTACTTCGACGTGAGGGAGAACTGCCGCTGGAAGAGCTGCTCCGTTCCCTC
CCCCCTCAGCTGCTAGGAGGGCCTTCCAGCCCCTCAAGGACCCCCTCATCTCATGATAGT
GACACCCGAGATGGGCCTGAGGAAGGCGGTGAAGAAGAACCCTCTCAGGTGTTGAAGGTA
TGGGCAGAAGGGGTCGAAGGAGTAGAGAAGCTGAGAGAGAGAAGTTCAAGGACTGAGTTG
TGGACAGTAAGGCCGATGGTGGCTTTTAGCCATCTTCTCTGGTTAGGAACAGTTGGGCTT
TCGTGGGGAGGGCATCTGGTTTTTGGGGGGGAGTTGTAGTCGAAGATGCCAGACTTGAAG
GATGTACTGTACTCTTTAAGTTGATGTATCACTTTGCAGAGAATACTTATATTGATGATA
ACCACTTCAATGCAATGGCCCTGATACTTCCTTACTGGATTACAGGTTCAGAGCCAGATG
GTAAACTGACAGTCTCTTGAGATTCACGTTTTGTGTTTCCTCCATGTCTGAATGCATGGA
AGTGGTGTTGGGGCCTCTGTGTCTTGTCTAGAAATTTCACAGGTCCTACCCAGCAGGCAG
TGGGGCCAGGATTTGGCAGCCGTAACTGAGAGAAAAACCCTTGATTGTATTCTTGCCCTG
GGGCAGTGTCAGTGGCCATGGTCACTCAGTGGAATAGACAGACCGTTCCAGCCCATCTCA
TTCAGCATTTTCTTGCTGCTCTAACCTTATAGACCTTCCTTTTCCATTCTTTGCCATGTA
GGAAAAGCCCTCGACCCCTGCCTCACAGTGCAACAAAAAAGCATGGCATCCAGATGAGGA
TGATGAAGAGTTCACTGCCAACGAGGATGAAGGTTAGACCTAATTCTCTGTATCTGCCTA
CCCAGTGCATTGCCTGGATCCATTGTTTCAGACTTGTTCACTTTGTCAGCTTGTACTGTC
TTTCATGCCTATCTCTGTTGATGTGATTTCATTTTCTTTCCTAGCGGAAGATGAAGAGGA
TACCATCGCAGCAGAGGAGCAGTTGGAAGGGGAGGTGGATCATGCCATGGAATTGAGCGA
CTTGGCTCGAGAAGGTGACACTCATTAGCTATCTGAGGATTTACTTTGTCTCTGCATGAA
GTGCTCGGGATAAAGAGATGAATAAGAGTGGTCTGGGGGAGTCAGGCGTGCAGCGGGTTA
AGCAGCGTAAGGAACCCTGTTTGAGCCCCTGGCTCTCCACCTGCAGGGGAGTCGCTTCAC
AGCCGGTGAAGCAGGTCTGTAGGTGTCTTATCTTTCTCTCCCCCCCTTCTGCCTTCCCCT
TCTCTCTCCATTTCTCTGTCCTATCCAACAATGACAGCATCAGTAACAACAACGATAATA
ACTGCAACAACAGTAAAAAAAGAACAAGGGCGACAAGGGGGGGAAAAAGAGTGGTTTGGG
AGGTGGCACAGTAAAGCACTGGATTCTCAAGCATGAGGTCCCAAGTTCAGTCCCTGGAAG
CACAAGTACCAGAGTGATAACTGGTTCAGATTTTTCTCTTTCTGCCTATCATTCTTCATA
AATAAAGTCTTAAAAAAAGAGAGAAATAGATGAATAAGGAAATATTTACACCACCAAGCC
CACCCCTCGTCTTATAACCACCACCTTGAAGAACTCTAGTTCTAATGACCAAGACAGCTT
TGTAAGTAATTAGGTCGTATAATGGAAGTTAGACCAGTGTGAGAACTCGGTGACCAGAGA
GTTGTGGTGATCAGTAGTAAAGTCCATACTCTACCTAGTCAGCACAGGGAGGTCCCAGCT
ACGTAGTGATCCTAACACTTCTAGTACTGGTCAGCACAACCTTGGTCTAGCCTAGGTTGG
GGGTTTGGACTTAGGTAGATGGTGTTGAAAGTAAAAAATCAAAAATAAAAAAAAATCAAT
TCATCATTGGATAGAGATGGAAAAAATTGAGAGGGAAGGGGAGATAGGGAGAAAAATACC
TGCAGACCTGCTCTGTTGCTTGTGAAGCTTCCCTCCTGCAAGCAGGGATGAGGGCCTTGA
ACCCAGGTCCTTGTACATTGTACTGTGTGTCTTCAATCAGGCGCGCACCACCCAGACCCT
GAAAGTAAACTCTTTAGGCTCCCCTCAGACATGGACCTATTAGTGTCTCTTCATCAGGGC
CTAGCCAAAATGAACTGGTGTAGCTCCCTTTCTCTCTGCCTCAAAGCAACCCAAAATTTG
TTCTTCGTTCTCTCCCTTTAGGTGAGTTGTCTATGGAGGAGCTGCTGCAGCAGTACGCAG
GCGCCTATGCTTCAGATGCCTCTGCCCCAGACTCTGGGAGCAGTGAAGAGGAAGAGGAAG
AGGAAGATGAGGTTGAGGCTAACAGCTCTGATTGTGAACCAGACAGGGCCACAGAAGCTG
AAGAGGCTCAGGAGGAAAGCAGCAGTCAGTCAGGTGAGTGTGAGGCGGCAGCTGGGAAGT
GTCTGCAGCAGCATACCTGCAGCAGCGGGTATGATAAGCGCTCAGCTTTGACTTCTGCTT
TAGACTCTGCTGAGGAGCAGACTGAGGATGAGGAAGATGAGCATTCTGAGGAGGATGAAA
CAACTGGAAGTTCTCAGTCGGAAGAATCTGAATCTGATGAATCTGAGGAGACTCAATCAC
AGAGCCAAACAGATGAGGAGGCGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAAGAAGATG
ACTGTGGCGTGGAGTACTTGCTTGCGAGGGATGAAGAGCAAAGTGAAGCAGATGGGGGCA
GTGGGCCTCCCACCCCAGGGCCCACGACCACTCTAGGGCCTAAGAAAGAAATTACTGACA
TTGCTGCAGCAGCGGAAAGTCTCCAGCCCAAGGGATATACCTTGGCCACTACCCAGGTAT
CCCGAGACCCTCAGGACCTGCTTCTGCGCAGTTCCTATCTTTGCTGTTTACCAGGGACAA
GCGGCTCATCTGCACTGTGAAATCTTTCTCCCTGCTAGGTGAAGACACCCATCCCCCTGC
TCCTTCGGGGCCAGCTCCGGGAATACCAACACATTGGACTGGACTGGCTGGTCACGATGT
ATGAGAAGAAGCTCAACGGCATCCTTGCTGATGAGATGGGGCTTGGCAAGACGATCCAGA
CCATCTCCCTGCTTGCCCACTTGGCTTGTGAGAAAGGTAACTGGGAGAGCTGCTCATTTG
GGTTCCCTTGGCCAACTCCTAGGAACTCCCGCTACAGAAGGGCGAGACACCCCTAAGCTT
ATTGTTCCTCACCATCTCATTCTTTTGAAAAAAACAGGTAACTGGGGTCCACATTTGATC
ATTGTCCCCACTAGTGTGATGTTGAACTGGGAGATGGAACTAAAGCGTTGGTGCCCCAGC
TTTAAAATCCTCACTTACTACGGAGCCCAGAAGGAGAGGAAGCTCAAGCGGCAGGTTTGC
TTCTCCTCTGCCTTCTTCCCGGGAAGCCCATGCCCCTACCCCACACATTCTTTAATTTTA
GACTATCTTCTCAGATGAGTTCTTTTCCCTTCTATTCTTGTTGGCTCCATGGTGCTCCTT
TGACTCTTGTCTTTTCTCCCAACCTGATTTCAGTCCCTTAAGGACTTTTTCATATTTCCC
TCTGGGCCTTTTCTTACTTTTTCACCCTACTCTGTTGCTTTCTCCTGCAACCTCAGGGCT
GGACCAAGCCCAATGCCTTCCATGTGTGTATCACATCTTACAAGCTGGTGCTGCAGGACC
ATCAGGCCTTCCGCCGCAAGAACTGGCGCTATCTTATTCTGGATGAGGCACAGAACATCA
AAAACTTCAAGTCACAACGCTGGCAGTCACTGCTCAACTTCAACAGGTGGAGATGGAGAT
GAGGATTTCATGGAAGGATTGGCCAGGCCTGAAGGGTTGGTTGCTTGGAAGCCTACTAAT
CACTTTCTCTTTCATTTTTTTTCTTGCAGCCAGAGACGCCTGCTGCTTACTGGAACTCCA
CTGCAAAACAGTCTCATGGAGCTATGGTCTTTGATGCATTTTTTGATGCCTCATGTCTTC
CAGTCTCATCGAGAGTTCAAAGAATGGTTCTCTAACCCCCTAACTGGCATGATTGAGGGC
AGCCAGGAATACAATGAGGGGCTAGTCAAACGCCTCCACAAGGTAAGGCCTTTAATTTGT
TTGTTTAGTATTTTATTTTAGTGAGAGAGAAATACAGGGAGAGATCCTAGAGCACTGCTC
ACCTCTGGCTTATGGTTGTGCTGAGGATTGAACCTGGGACCCAGGAGCCTCAAGAATGAA
AATCTTGCTGAGCCAGTATGCTGTCTCCACCAGCCTTTTACTTTTCTCAGGGGTAGTGGG
AATGGTGAGGCTTTAAGAGCCTATCGTCAAAAAGCTTTTAGGAAGAGAATTTAGTGCCAT
GTTGAACTCATCCATTGTTAAGCTACAGTGTTTTAGTGACTAAATCCTTTGCCAGATTGA
GTGACCTCATCAACTTAGTTGTCATTCTACTTGCTTTCTTGGCATTCTGTTTTCTTACTT
ATTAAATGAGGAAGGAGAAGCTGAAATGCTCTGATTTTGAGGACATCCAGTGATATTACT
GTCCATCTAAAAATGATTCTGTTAATTCCTTGCTTGTAATACTCTTGACCTTGCTTGCTT
TCAATATATATTTATATATTCGAGCACTTACCAGCTCTGGCTTATGGCCTTCATAGTATT
TTTGCTGTGTTCTCCGTCTTCTGTTTTTTGTCTTCTTTAATTTATTTTGTTATCTAACTT
TTATTTTGTTGTTTAGCATTTAGCTAAGCTTTCTTTATTCTAATATTTCATTTATTCAGT
ATATACATACATATATTCAACTTTTTTGTTTGATAGGACAGAGAGAAGTTGGGTGGGGTA
GAGAGATACCTGCAGCTCTGCTTCATTGCTCGTGAAGCTTCGCCCCTGCAGGTGGGGAAT
TGTAGGCTTGAACCCTGGTCTTTGCAGTTGGTAACATGTGTAGTCAATTTATTAATTAAT
GAGAGGGAAAGAGAACCAGAGCAGCACTCTGATACAGGATGTCCCAGGGATAGGATTCAG
GACCTCATGCCCTTAAGTCCAGTGCCTTATCCATTGTGTCACTTCCCAGGTCACACTGAT
TGGTAGTTTTGTTTTTTTTTAATATTTTATTTATTTATTTATGAGAAAGATAGGAGGAGA
GAAAGGACCAGACATCACTCTGGTATATGTGCTGCCAGGGATTGAACTCAGGACCTCATG
CTTGAGAGTCGGATGCTTTATCCACTGTGCCACCTCCTGGACCACGATTGGTAGTTTTAA
TTCTATGACTCTCTTAAGCCTGTATTTGAATTTCTGGCTTTGTGTGTGTGTGTTAAATGT
TACATATTTTACCATTTATACCTCTAGCCCCTCAGTTGAACTTTTCAATATACTTTTGTT
TTAAAAGCAAACTTCTCATATAGACTATTATTTTTTTCTTTAATTTTTTTTTTTTTTTTA
ATTTTTTATTTTATTTTATTTTATTTTTTATTTTTTTTTTATTTATTCCCTTTTGTGGCC
CTTGTTGTTTTATTGTTGTAGTTATTATTATTGTTGCTGTCATCGTTGTTGGATAGGACA
GAGAGAAATGGAGAGAGGAGGGGAAGGCAGAGAGGAGGAGAGAAAGACAGACACCTGCAG
ACCTGCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGGGGCTCGAACCGG
GTTTTCTTTAATTTTTGAAAGGATAAAGAAATGGAGAACACACTAGGGGCCGGGGGTAGA
TAGCATAATGGTTATGCAAAGAGACTCATGCCTAAGGCTCTGAAGTCCCATGTTCAATCC
CCTGTACCACCATAAACCAGAGCTAACCTCTGGTAAAAAAAAATAAGTAATTAAAGGAAC
AAAAGAGAAACCTAAAACACCAAAGTTTCTCCCTTAAAAAGGCGGTGGGGGAGAACACTA
ACTAGGGCATTACTCTGGCACATGTGATGTTAGAAATTGAACTAAGGTTCTTGTGTGTAA
AAGTCAGGCACTGTACCTACTGTCCCATCTTGTGGCCCACAAAACCAAGAAGTGTTCTGA
GCTAGTTATTCGTATTCATTGCTAGCAAGGTTATTACTGGGGCTTGGTGCCTGCATCCAC
TTCTTTTCTATTTATTTGACAGAACAGAGGGAAATTGAAAGTGTAGGGGTAGATAGAGGA
GAGAAAAAGACACACTGTGCTGGCCTGCTTCGTCACTTGTGATTCATCCCCCCTGCAAGT
AGGGAGCAGGGTCTCAAACGCAGGTCCTTGTGTGTGGTAGTGTGTACAGTCAGTTGGATT
TGTGACCATCCGGTCCTCTGTCACTTTTTTTACTTTTATTTTTTATTTTTATATTTATTT
ATTCCCTTTTGTTGCCCTTGTTTTATTGTTGTTATTGATGTTGTTGTTGTTGGGATAGGA
CAGAGAAATGGAGAGGGGGGGAAGACGGGGAGAGAAAGATAGACACCTGCAGACCTGCTT
CACCGCCTGTGAACACCTGCAGACCTGTGTCACCTCTTATGACTCCCTAATGTTATTTTT
AATTATCTTTATTTACTGGATAGAGACATCCAGAAATTGAGAGGGAAGGAAGAGAGAGAC
ACCTGCAGCCCTTGCTTCACAACTTGTGATCTTTCTCCCATGCTGGTGGGGACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTGCAGGGAGTCACTCAAGGGAGTTGCTTCACAAGCGTGAAA
CAGGTCTGCAGTGTCTCTTTCTCTCCTCCTCTCTATCTCCCCTCCTCTCTCCATTTCTTT
GTCCTATCCAACAGCGATGACATCAATAACAAAACAATAACTATAACAATAAAACAACAA
GGACAACAAAAAGGGAATAAATGAATATTAGTGAGAAAGAGAAAACCAGAGCGACACTCT
GACACATACATTGTCCATAATGGAATTCAGGACCTCATACTTTTGGGTCCTTAACTTAAT
CCACTTCACCACCTCTCAGGACACTAAAATCTTATTCATTCATTCATTTTTTCACTTATT
TTTCTAGAATTCATTTTTTCTTTTTTAAGTATTCCCTTTTGTTGTCCTAATTATTACTGA
TGTCATTGTTTGATAAGACAGAGAAATGGAGAGAGGAGGGGAAGATGGGTAGAGAAAGAT
ACCTGCAGACCTGCTTAACCTGCTGCGCTACCGCCCGATTCCCAAAATTTTATTTATTAA
CATGAGAGAGAAAACAACATGTAATGCCAGGAATCAGACTCAGGACCTCATGCTTTTATA
AAAAGTCCAGCATTCTTGGCATTTTGTCCACTCCTTGTTAACTTCAAGACCATCTGGTTT
TGCCTTCTGAGGTCTCAGACTAGCCTTTTTTTTTTTTTTTTTTTAAATAAAGATTTTATT
TATTAATGAGAAAGATAGGAGAGAGAAATAACCAGACATCATTCTGGCAAGTGTGCTGCT
GGGGATCGAACTTGGGACCTCATGCTTGAGAATCCATAGCTTTATCACTGCATCACCTCC
CAGACCACTCAAACTGACCTTTTCTTTTCTACTCTGCTGTCATTGCCGCAGTCTTTGTTC
TTAACTTGCTTTCTGTTACCCTTGAAATGTGAGTGAGGCCATTCCCTCCTATATAATTTG
TCGCTCTGCCCTCTGTTCCCTTTTATCATTTATGTTGTGGTGGTGTCATCTTTGTGTCCT
TTAGCAGACAGTAATTCTTTGAGAAGAGGTCTTGTTTCTGGCTCTTTTGTATGGGTGTCT
CAAGGAAGGAAGCTCCATGACTCCATTAAGGGTTTCCTGACAGTGATAGCAGGGCCAAGC
CAGTCCTGAGGCCTGAAGCCAGCCGAAGAGTTCAGCTGTGCCTCAGTGCTCCCTGTTCTC
CTGTCAGTCTCCTGCTAACTTGCTTCTAGGTTTTGCGACCATTTTTGCTGCGCAGAGTTA
AAGTGGATGTTGAGAAGCAGATGCCTAAAAAGTACGAGCACGTTATTCGCTGCCGGCTCT
CCAAGCGCCAGCGCTGTCTCTACGATGACTTCATGGCACAGACCACGTAAGGGGGCAGTG
GTGGTGGCCCCAGTGTGGAAGCCTAGATTGGAACAGAAGTGACCATCTGAATGCTGAATC
TCTCTTTCTATTTTATTTTTTTTACCCTCTCAGAACTAAGGAGACACTGGCCACAGGCCA
TTTCATGAGTGTCATCAATATTTTGATGCAGCTCCGAAAAGTGTGTAATCACCCAAACCT
CTTTGACCCTCGACCTGTCACCTCCCCCTTCATCACCCCGGGCATCTGCTTCAGCACTGC
ATCTCTGGTACTGCGGGCCACTGACATCCACCCCCTCCAGGTAAGTTAGCCCACAAGATT
ATTGGCCTCACTCTTCTCTTTAGGCTGGAGTCAAACTTTGCATCCTCCTTCTGTCATTAC
AGCTCTAGTCCCTTTCATTGTTTTCTAGCTACATGCTGGGGTGCTGTGTGTGTATGGGGT
CTGTGTGTGGGGGGAGGGTAATTTGTCTTCAGCCCTGTTTGCTTGCTTGAAAACCTAAGG
ATTGTAAGACCTTTGTTGCCATGAATATTTATTAAATGTGCCTGTCACTTCCTTACCCTC
TTTTTAGTTCTGAATTTTTGTTTTATATTGTGACAAAACATTTTAAAAAATATTTATTCC
CTTTCGTTGTCCTGTTTTTTTTTTTTAATTGTTGTTATTGATGTCGTTGTTGGATAGGAC
AGAGAAATGGAGAAAGGAGGGGAGGGAGAGAGAGAAAGACACCTGCAGACCTGCTTCACC
ACCTGTGAAGCGACTACCTTGCAGGTGGTGAGCTGGGGTTCAAGTCAGGATCCTTATTCT
GGTCCTTGTGCTTTGCGCCACCTGTGCTTAACCCACTGTGCTACCGCCCGACTCCAGACA
AAACATTTTTTAAAAATATTTTATTTATTTATTAATGGGAGATAGAAGGAGAGAGAGAAA
GAACCAGACATCACTCTGGTACATGTGCTGTCGGTTATTGAACTTGGGACCTCATAGCTT
GAGAGTCCCAACATGTTATCCACTGCGCCACCTCCCGGACCACCACAAAACATTTCTCAA
GGCTCCTTTTTTTAATTTTTATTCTCTTTTGTTGCCCTTGCTGTTTCATTGTTGTAGTTA
TTATTGCTTTTATTGATGTTCTTGTTGTGGGATAGGACAGAGATAAATTGAGAGAAGAGG
GGAAGACGGGGGGGGGGGGAGTAGACACCTGCAAACCCTGCTTCACAGCTTGTGAAGCAA
CTCCCCTGCAGGTGGGGAGCTGGGGGCCTGAACTGGGATCCTTAACGCCGGTCCCTGAGC
TTTGCTCCACGTGCGCTTAACCCACTGCACTACCGCCCAACTCCTCATTTTTACCACTTT
AACTGCTTTTAAACACAGTTTAGTGATATTAAGTTCGTTCACGTTGTTGTGCCTCTGTTA
GCACTATTCATGTTCAGAACTTTTTTTCTTTAAAGCCGAAACTCGATACACATTAGATCA
TGATCCTTCATTCTCTCCCAGCCCTTGGTGGCCATTATTTTCTCTTTAAATTTGAGAGAG
AATTTATTATCGGCTTGTTTCATTTAGCATCATGTCTTCAAAATCTGTCCATGTTGCAGC
ATGTGCCAGAATTTTTATGTTTTGATAATACATACATTTGCATATATATAGTTGACCCTT
GGATTGTGAGTTCTTTTATGCTTTATATGTGGAGTTTTTTGTTTTTTTTTCTAACCATGA
GTTCCTGACTCCTGGATTAAGCTGTGGATGTGACATCTGCAGATACAGAAGGCGAACTGT
CAGGATATGCAGCCTTGGGTGAGAGGCCTGAGTTACATGTAGAGGCTTTTTGTTTTTTTG
CTTTTGTTTTTTCCTTCTTTTTTCCCCCAGGGTTCTTGCTGGCTCTTGATGCTATACTAC
ACATCTATTGCTCCTATGACCTTATTTTTTGGATAGGACAGAGATTGAGAGTCGAGGGGA
AGATAGAGAGGGGAGTTGTGCGTTTGTGCAGCGGGTTAAGCCTAGGGGATGCAAAGCACA
AGGACCAGCTTAAAGGACCAGTTCGAGCCTCTGGCTCCCACTTGCAGGGGAGTCACTTCA
CAAGCGGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCTCCCTCTCTTTATTCCCTATCTCT
CTCCATTTCTCTCTGTTCTACCCAACAAGAACAACATCAATAACAGCAACAATAATAGCT
ACTGCAATAAAACAAGGGCAACAAAAGGGAATAAATATAAATAAATGAATAATAAAAAAT
AAAAAGAGGGAGAGAGAAAGATCTATACCTGCAGACCTGCTTCACCACTTGTGGAGCAAC
CCCTCCATGCAGAGTTTTGACTGTCAGGATCATTCCCTGCGTCATTCAAGGGCTGACTGC
ATGTGTACAGTTCATCTCAGTTCATCCCTCGGTATACATTGGCTGGCCTCCACCAGTTGG
TTGTTGTGATAATGACACTGTGAAGATAACTACGAATATTTCTCTGCATGCCTCATTTAA
ATCATTTGGAGACACATGAAGTAAAATTGCTAGGTTACCTGCAAATTTCTCGAGAAGCTG
CTGTGATGCTTTCTGCGTGATGACACTTTATAGTCCTCATCAGTAGTTCACAAGGGTACT
GATTCCTCCTTCATTGCTGACACTATATTCTCTCTTTCTCTTAGTTTTTCATTTATTATT
GGATAGGAACAGAAATTGAGAGGGGAAGGGAAGATAAAGAGGGAAGTGGGGGGGGGGACA
GGTGGTGGCATGCCTGGTTGAGCACTAACATTACAGTGCACAAGGACACAGGTTCAAATT
CCTGGTCCCCACCTGTAGGGGGAAAGCTTCATAAGCGATGAAGCAGGGATACAGGTATCA
CTCTGTTTCTCTTCCTCTCTGTCTCCCCCTTCCCTCTCAATTTCTGGCTGGCTCTATCAA
ATAAATAAAGGTAATAAAAATTAGAAAAAGAAAAAGGGGGGCAGATGACACAGACACCTG
CAACACTACTTCACCACTCAGCTTTCTGACCCCAGCGGGTGGGGACCAGAGGCTTGAACC
CTAGGTCCTTGCATACTGATGTGTGCGCTTAAACAGGTGTGCTACCCCTTGGCCATGACA
CCATATTCTTTTAATCTTTATCATTATTATTATTATTATTTTAATAGAGCACTGCTCAAC
TCTGCTCTGGTTTATGGTGGTGCAGGGGATTGAACCTGGGACTTTGGAGCCTCAGGCTTG
AGAGTCTCTTTGAATAACAACGTTATGCTATCTACCCCCACTTTTACTAACTTTTTTTTT
TTTTTTAAGAATTTATTCATGAGGAAGATAGGAGGAGAGAGAAAAAGAACCAGACATCAT
TCTGGAACATGTGCTGCTAGGGGTTGAACTTGGGACCTCTTGGCTTGAGAATCCAGTGTT
TTATCTACTGCACCACTTCCTGGACCACATCTTTTTTTGCCTCCAGGGTTATCACTGGGG
CTCAGTGCTTGCACAACAAATCCACTGCTCCTGGGGGCTATTTTTTCCCCTTTTGTTGCC
CTTGTAGTTTATCATTGTTGTTATTATTGTTGTTGTTGCCATTGTTGGATAGGACAGAGA
AATCAAGAGGAGGGAAAGACGGGAAAGATAGACATCTTCACTGCTTGTGAAGTGACCTCT
CTGCAGGTGGGGAGCTGGGGACTCAAACCATGATTCTTATGCTGGTCCTTGTGCTACGCG
CCATGTGCACTTAACCTGCTGTGTTACTACCCGCCCCCCATCTTTTATTAAATTTTTATT
GTCTTTATTTATTGGATAGAGATAGCAAGAAATTGAGAGGAAGGGGTAGATAAAACAGGA
GAGAAACACAGAGACACCTGCAGCCTTGCTTCACCACTTTTGAAGCTTTTCCTCCTGTAA
GTGGGGACTAGGGGCTTGAACCTGGGTCCTATGCATTGTAACGTGTGCTCAACAAGGTAT
GCCACCACCAAGTCCCAATCCCCTTTATCATGAAAATTGATGTCATTTCTAGTAAAATTG
AGCATCTTTTCTCTTTATTTACTTACTTATTTGCTTCCAGGGTTATTGGGGCCCGGTGCC
TACACTATAAATCCACTGCTCCTGTGTCCATTTTTAAAATTTTTTTTGGATAGGACAGAG
AAATTGAGAGGGGAAGGTAATACAGAGAGAAAGATAATACATCTGCAGACCTGCTTCACT
TCACCACTTGTGAATCAACCCTCCCTGCAGGTGGGGAGCCGGGGGCTCAAATGTGGATTC
TTGCATGGGTCCTTATGCTTTATACAATGTGTGCTTAAGCTGGTGAGCCACCACCTGCCT
CCCCCCCCCCCCCCGCATCTTTTCTCTCTCTCTTTTTTTTTTTTTTAAAGAAAAGGTCTT
TTTTTAAAAAATATTTCTTCGCTTTTGTTGCCCTTATTTTATTGTTGTTATTGATGTCAT
CGTTGTTAGATAGGACAGAGAAATGGAGGGGGGGGGAGAGAAAGATGGATACTTGCAAAC
CTGCTTCACCACTTGTGAAATGACTGCCCTGCAGATGGGGAGCCGGGGGCTCGAACCAGG
ATCCTTACACCGGTCCTTTTGGCCACCTGTGCTTAACCTGCTGCGCTACCGCCTGACTAC
CTCACCAAGCATCTTTTCTTTTTTTAAATTTTATTTATTTATTTTTATTTAAGAAAGGAT
AAATTAACAAAACCATAGGGTAGGAGGGATCCCAAGCATCTTTTCTATGAAGAAAATCTA
CCAAAGATTTTTACTGTTGCTGTTGTGGTTTTTCTTTTTACTTACTTTACTTTTATTTTT
AAAACTCTTTTCCCTTTTGTTGCCCTTGTTGTTTATCATTGTTGTTGTTATTGCTGTCAT
TGTTGTTGGATGGGACAGAGAGAAATGGAGGGGAAGACACGGGGAGAGAAAGATAGACAC
CTGCAGACCTGCTTTACCACCTGTGAAGTGAACCCCCGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAAGCTTTCCCCGTGCAGGTGG
GGACTGGGGGCTCCGATCGGTAGGGTCCTTGTGCACTGTAACCTATGTGCTTAACTAGGC
GTGCTACTGCCCAGCCCCCCCCCTTTTTTTTAAATATTTATTTCCTTTTGTTGCCTTTGT
TGTTGTGATTGTTGTTATTGTTATTGATGTCGTTGTTGTTGGATAGGACAGAGAAATGGG
GGGGAGACAGAGGGGGAGAAAGATAGACACCTGCAGACCTGCTTCACCACCTGTGAAACG
ACTCCCCTGCAGGTGGGGAGCCGGGGCTCGAACCGGGATCCTTCTGCCTGTCCTTGTGCT
TTGCGCCACGTGCGCTTAACCCGCTGCGCTACTGCCCGACTCCCGCCCCTCTTTTTTTTT
TTAAACCAGTGCACAGTTAAGCTCTGGCTTGTGGTGTGTGTGGGGGGGATTGAACCTGGG
ACTTTGGAGCCTGTTTGCATAATCATTATGCTGTCTACCCTCCACTCCTTTTTTCCCTTT
TGTTGCCTTTGTTGTTACTGTTGTTGGATAGGACAGAGAGAAATTGATCGAGAAGGGGAA
GATGGGGAGAGACAGACACCTGCAGACCTGCTTTGTCACCTATGAAGTGACCCCCCCTGC
TGGTGGGGGACGGGGGCTCTAACCAGGATCCTTACGCCACTCCTTGCGTGTTTAACCCTC
TGTACTACCTACCGACACCCCCCCCTTTTTTTTTTAAACCAGAACACTACTCAGCTCTGG
TTTGTGGTGTGGGAGATTCAACCTGGGACTTTTGGAGCCTCAAGCATGAGAGTCTCTTTG
CATAACCATTATGCTGTGTATCCTCACCCTACGACTTGTAATTTTCTTGTCCTCTTTTGT
GGGTTGTCTTTTCCCTCAGTTTATAGAGACATTTAATGCAGATCAGTTTTTTCTTTTGTT
GTATATGTTTTTGATAACATGTCCAAATAATCATTGCCACATTGGTTCTTTGATGCATTT
TTTTGTGTTCCTCCCTGTGCCAGCGGATAGACATGGGTCGCTTTGATCTTATTGGCATGG
AGGGTCGTGTGTCTAGATATGAAACTGACACATTTCTGCCACGATACCGCCTCTCCCGCC
GGGTCCTGCTAGAAGTGGCTATTGCTCCTGACCCCCCACCACGACCAAAGCCGGTCAAGA
TGAAGGTCAACAGGTACCGGGCTGAGAAATCAGGGAGTGGGCTCCTCGGAAAAAGGGACT
GCAGCTGGCTGGGGAGGTGGGGCTGGAGAACTGAGCAGGAGGGCCCCAGAACAGCTCCTC
TGGAGAGTGCACTTGCTTTCCCGTTCACGTGACCTAGGTTTGGTCTACCCTCTCTCCCGT
ATCCTTGGAGGAAGCTTCCCACTGTTTCTGTGTGAAAAAATATAGAAATTAGTTTGAGCT
GTGATTTAAGAAACAAACAAACCTCACAACCTGTGATGACTAAAAAGAAAATTATAGCTC
GAAGGTAGACTAGAATGTTTATATGGGGTGGACGCAAAGTACTACGGATCAGTTTAGAGT
GGAAAATAACTAGGCCCTCTGAATGGGCCCTTGTGTTTGTCACTGGTCAGTATGCCTTGG
CTTAGTGATTATTGGTTACCTCTGTTTCTTTTTGTCCTTTGGGTTCTTTCGTTTTTCCCC
TTTGTTTTTACAGTCTTCCTGACTCATCTTTCTAATTCCTGTTTTCCTATTCTATATTCC
CCTTCGCTACCCTTCCCTTATTACCCCCGCCACTTTCCCCTTTCCATCTTAGGATGCTGC
AGCCAGTGCCCAAGCAAGAAGGTCGGACGGTAGTGGTGGTGAACAGTCCACGGAACCCTC
TAGGCCCCGTCCCAGTTCGACCTCCTTCAGGCCCCGAGCTCTCAGCCCCACCTGCCCCTG
GCCCAGTTCCTCCAGCGATGCCAGCACCACTGATGGCGTCCACCTCACCTGCTGGGACCC
CACATATTCCAACATCCCGGCCTCCTGGCCCTGTTCTACTGCCCCCACTGCAGCCAAACA
GTGGGGCACTCCCTCAGGGTAAGTGCATGGGGGCTGGGAAAACCGGGTACTGCAGGCAGG
CTTTTCAGGCTGGGGACATAGTGATGAAGGTAGTAATGGAGCTGGCTGGGAGATGTGTGT
GCTCTTGGGTGGTCTGGAATAATATGTATGTCGGTTTCTGCAAGCAGGCTATGGCTCTGG
ATAAGGTTATCTGACAGGGGTTTGCCCTGTGTCTACAGTGTTGCCATCTACCCTAGGGGT
CCTGAGTGGGACCTCACGGCCTCCTACGCCAACCCTGTCCCTGAAGCCAGCCCCACCGGC
CCCCGTTCGCTTGAGCCCTGCTCCACCACCAGGCTCCTCGAGCCTGTTGAAGCCTTTGAC
AGTGCCACCAGGCTACACCTTTCCTTCTGCTGCTCCTGCTGCCACCACCACCACCCCTGC
CGCCATAGCCACTGCTGCCACCACAGCAGTGCCAGCTCCTCCTCCTGTGCCACAGCGCCT
CATCCTGTCTCCGGATATGCAGGCTCGCCTACCCTGTACGTTCCCGGGGCTCTGTGGGGG
TGGGGACTAGAAGTGCCGCAGAGCTGGAGAGGAATCGTTGAGGAATGTGAGGGTATCGCT
TCCTAAGTGGTTAGCGTGTTTCAGGTCTTTGCCAGACATCAGTATTTCATAATCAAGTAA
AACGCCTCAAGTGGTTTAGTCTAATGGGGATGATGACACATAGGTGAGTAAGTAGTGGTA
AGCTTAGCAGGGAAAGATGATTGGGTGAATGTGCTGCCTAGTGGAGGGTGGTGATTAGCT
TAGTCTCGTGGCAGGTCACTAGAGAAAGTTCGGGAGATTGGTAAGGAAACAAGTGGATTA
ATGAGAAACACGGCACAAGTCTAGGTTATAGAAGAGGCTGAGTTTGCTGCAGCTTGGTAA
ATAGGGAGGGCTGGAAGAAGTGCTGTTGGCAGAGTGAGCCCGCTGTACATGAAGCCCCTT
CTCTGTTCATAGCAGGCGAAGTGGTCAGCATCGGGCAGTTGGCCTCACTGGCTCAGCGTC
CAGTGACGAGTGCAGGGGGTAGCAAGCCTCTCACCTTCCAAATCCAGGGCAACAAGCTGA
CTTTGACTGGTGCCCAGGTGCGCCAACTTGCTGTGGGGCAGCCCCGCCCGCTGCAAAGTA
GGTAAAACCCACCCCCTGTCCTGCCTTTTTCCTCTTCCTCCTCCACCCTCCTCCCTCCTC
CCTCGTTCCCTTGTTTTTGTGGCTCTGAAGATGTCAGCCATTTGTGTTTCTTTCCCTAGC
TTTTTGGAGGTGGGGCCAAGGGGAATGGTTGGATGGGGGTCTTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTA
GCCCTTGCTGCCTTGGTTCTTTCTGGCGCGCCTTGGGCTACTGTCTCTACAGCTTTTCAC
AGTGTTTTCCCTTGCCAGCACTTCCGATGTATGTCTGCTACCCACTCGTGCCCCTGGACT
TCTTCCATCCTTTGGGTCTCTTGTTTCTTTTCTACCTTCCCCTCAATATAGCTTCCTCTT
GCAGTGCCACCAACCATGGTGAATAACACAGGCGTGGTGAAGATTGTAGTAAGACAGGCC
CCTCGGGATGGACTGACTCCTGTTCCTCCATTGGCTCCAGCGCCCCGGCCACCCAGCTCT
GGGCTTCCAGCTGTGTTGACTCCACGTCCCACAATAACACCTGGTCGACTACCCACACCT
ACCCTGAGTACTGCCCGGGCCTCCATACCCACGCCCACTATGGTGAGGCCTCTCCTCAAG
CTGGTCCACAGTCCGCCTGAAATTAGTGGTGAGTTCAATAAGGCCAGAAATTTTTGCTAG
GAGTGGAGACAGGGCAACACCCAAGAGATTTGTGGTCACGACAGATTTCCTTCATAATCA
ACGTACTGATTCATTTTGCAGTGGACCTCAGCAGGGGTCTGAGTCCTGACCCAAGTCTAA
AATATATTTATGGGAAACTTGGAAGGAAAGGAAATCTTACAGTTCTGAATTTGTTGATTC
TTCGATTTTATAGTGTGGAAGTAAATAAAGATTCTGGGAAACAGGTGAAGCTTGGGGGCC
GAAAGGAAAGGGTGGGGTAGGGGAACAAAGTATAAAAAGAGCTCTAGGCCTAATTGATAC
TTCTCCACAGCTTCAGCACCCGGAGCTGCTCCCCTGACCGTCTCCTCTTCTCTTCCTGGG
CCAGCCTCTTCTCCAGTGCCAGTTCCCAATTCCTCTCCCCTCACAAGTCCTGTGTCCTCT
ACAGTTCCAGTGTCATCTTCACTGCCTGTCTCTGTCGCCTCCACACTTCCTGTCCAAGCC
TCGGCTCCACTCACCATCCCCATCTCAGCCCCTCTGCCTGTTTCGGCTTCAGGGACAACA
CTATTGAGCACCATGACTCCAACACTGGCACCCGTTGTCTCAGCAGCTCCTGGACCCTCT
TTGACAGCAGCTGGGCCTTCCCCATCCGCATCACCCTTGACTCTAGGCTTGGCCACAACA
GCATCCTTGTCCCCATCTCAGGCACCTGCTCACCCTCTGTTGTTGGCTCAGACCTCTTCA
CATGTTCCGGGCTTGAACTCAGCTGTGGCTCCAGCATGTTCACCTGTCCTGGTGCCAGCT
TCGGCTCTGGCTAGTCCTTTCCCAGCAGCACCAAACCCAGCGCCAGCTCAGGCTTCCCTT
CTGGCTTCAGGATCTTCAGCATCTCAGGCTCTGGCCCCCTCTCTGGCTCCCATGGCAACT
CCACCAACAGCAGTCCTGGCTCCTCCGGCTCCTTCTCTGACTCCTCTTCCAGTCCTGTCC
CCGTCATTGGGTCCTGCTCCGATCCTGGCTCCATCACAGACTCCGGTTCCAGTTTTGGCT
TCTTCATCTACTTCAGGAACTCCCTTAGCCTCCGCGTCTTCATTGGCGTCAGCCTCGACG
ACGGTGTTGGCGCCATCCACTCAAACTATGGTACCAACCCCAGTCCCGTCAGCTCTTCCG
AGCCCAATTTCCATGCAGACGTTGACCTTGGCCCCAGCTTTAGCATCTACTCTTGGTGGC
TCATCTCCATCTCAAACACTCTCCATGGGAACAGGGAACCCCCAGGGCTCGTTTCCAGCG
CAGACATTGTCATTGACTCCAACATCACCCCTCGTACCAGCCCCAGCCCAGACACTGTCC
CTGGCACCAGGACCACCACCGGGTCCCACCCAGGCACTGTCTCTGGCTCCAGCACCTCCT
CTGGCTCCAGTTTCTCCAGTGGGGCCAGCTCCGGCTCACACACTAACCCTGGCTCCAGTA
TCATCTGCTTCACTCCTGGCCCCGGCTTCAGTGCAGACATTGACGTTGAGCCCGGCTCCC
AGTCCGCTGTCCACCTTGGGCCCAGCTGCAGCTCAGACTCTGGCACTGGCCCCAGCCTCT
GCACAGTCTTTAGCTCCCCAGGCGTCCTCCCTTGTTTCAACATCTGGTGTCTCCCCCTTG
CCTGTCACCATGGTATCCCGACTGTCTGTTCCCAAGGATGAGCCTGAGACACTGACATTG
CGCTCTGGTCCCCCGAGCCCTCCTTCCCCTGCTACCTCGTTCAGTGGTCCCCGGCCTCGA
CGCCAGCCCCCCCCACCACCTCGTTCCCCTTTCTATCTGGTAAGTGTTAGTATTTCTTCA
CTTGTTTACTAGGACAGAGAAATTGAGACGGGAAAGGATAGGGTGAGAGGAAGAGAAACA
CCTGTGGCACTGCTTCACCACTTGTGAAACTTTCCCTGCAGGTGGGGGCTGGAGGTTAGA
ACCCAGGTTCTTATGCTTGGTAATCTGTGCACTCAGCAGTGTGCTACTCCCCAGCCCCTT
CCGTCTGGTAATTTTTACTATCTCAAGAGGGAACAGGAAGTTGTTTCTTTTTTTCTTTTA
TGTTTATTTGAAGAGACCTGCTTCTGCAGCTCTTCTCTCTCTGTCTTTTGCTTTTCCCCC
TTTTGTTGCCCTTGTTGTCTTATTGTTGTTATTGATGTTCCCCCTTTTATAAAATTTTAT
TGGACAGGACAGAGAAATTGAGAGAAGTGGGTGAGATTGAAAGGAAGAGAGAAAGATAAG
ATAACCTTCAGATCTGTTTCACTGCTTGTAAAGCTACCCTCCTGCAGGTGGGGACCAGGT
GCTCGAACTGTGTGTTCTTAACTTGGTGCACCACCACCTGACCCCAAGATTTCTGTTTGT
TAATGAGATGGGAGGAGAAAGAGAACCAGACATAACTCTGGTACATGTACTGCTGTGGAT
TAAACTTGGGACTTCATGCTTTACCCACTATACCACTGCCCAAACAGAAGTTGAGTTGCT
TTGTCATGTTGGTAGAGTGTAAGGACCAGAATAATGGCACTTTTTTTTTTTTTTTTTAAA
GCTCCCCACCTTTTGTTGACCTTAATTTTTTTTTTTATTGTTGTAGTTGTTGTTGATATC
GTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAAACAAAGAGGAGGGGGGAG
AGACAGTCACCTGCAGACTCCCCTCCAGGTGAGGAGCGGGGGGCTCAAACCTGGATCCTT
ACAACAGTCCTTGTGCTTCATGCTGCATGCGCTTAACCCACTGCACTATCGCCCAACCCC
CCAGTGTCACCTTTTTTTGGTACTGAGGAATGAACACAGGGCCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCATGGTTTGGGTTTGCATTT
TTCTGATGGCTAGTAATATTGAACATCATTTTTCAGTGATTCCTGATCATTTGTCTCCTT
ATTTTTTTATTCTCTTATTGGATAGAGACTATCAAAAATTGAAAGGAAGGGGGAGATAGA
GAGGAAGAGAGACACAGACACTTTCAGCACTGCTTCACCGCTTGTGAAGCTTTCCCCCTG
CAGGTGGGGACCAGGGACTTGAACCCAGATCTTTGCACATTGTAACATATGTGCTCAACC
AGGTGCTCCACCACCCAGCCCCATTTTCTTCCTTTCTTCCTCCCTCCCTCCCTCCCTCCC
TCCGTCCCTCCTTTCCTTCCTTCCTTCTCTCAGATATATTTTATTTATGAGGACAGGAGG
AAAGAGAGAATCAGACATCACTCTGGTACATGTGCTGCCGGGGATCAAACTCAGGACCAC
ATGCTTTAAAATCCAACGCTTTATCCACTGCGCCACCTCCTAGACCACTCTCTCTCTTTT
TATTGCTACCCAGCTTATTGCTGGAGCTTGGTGCCTGCAGTATGAATCCACCACTTCTGG
TGGACCCCCCCCCTTTCTGTTTTGATAGGAGAGAGAGAAATTGAGGGGTAATAGGGAGAG
AGAAATAAACAAACACCTGCTACAGTGCTTTACTACTCATAAAGCTTCCCTCCTGCAGGA
GGGGAGTAGAGGAGGTGCTGAACTCAGGTCCATGTGCATGGTAATATGTGTACTCAGTCC
AGTGCACTACCACTGACCTTCACTTGCCTTGAAGAACTCTTTTCAGATTCTTTGATCTTT
TAAATTGGGTTATTTTGTTTAGAATTCATTTTTACCAGAGCCCTGCTCAGCTGTGGTTCT
TGGAGGTGCAGGGGATTGAACCTGTGATGTTGGAGCATCAAGCATGAGATATAACGTTTA
TCTTTGTATACCATTACGCTATCTACTCTTACCTTAAATTGAGTTATTTTGTCATTAAGT
TTATAATTATTATTATATAACATAAATTCTGGATATATGTTCCTTTCCAGATAAGTGATT
GGGGAATATTTTCTCTTTGCTAATATTGATTATTCTTTCAGGATGATTTCCCTCCTTGTG
TTTATTTATTCCCTTTTGTTGCCATTGTTGTAGTTATTGTTGTTATTGATGTTGTCGTTG
TTGGATTGGACAGAAATGGAGAGAGGAGGGGAAGATGGGGGGGGAGAAAGAGAAACACCT
GCAGACCTGCTTCACCACCTGTGAAGCAACTCCCCTACAGGCACTGGAACCAGGATCGTT
ATGCCAGTCCTTAACCCACTGTACTACCGCCCAACTCCCCCCTCCTCACTTTTAACACCT
GGAGTAAAGATAAGCTAAGATAGCAGCAAGAACGAAAATTTGGGACACTTTTTATCCCCC
CACACCAGTCCCTGGGGTTTATCGCCTTCATTACTTGCTCATTCCATTAACATTAATAGA
GCTCCTGCTATGCTGAGCTCTGGACATTGGGTAATTATAGTGAACAAGATCAGATAGAAC
TTGTGCTTTCAGTTTCAGCGGGTGGAAGACAATAATTGAAGAATCATACAGCTGTATGAC
TGCAGCATGGTTAGTGTTATAAAGAGTTAGTTGGTCTTAGAGCTTTGGACCTGGAAGCAC
AAGTGAGGAAGGGGTGGGTCACAACCTTAGAGATTTTGGAGAGGGGAATCAGGCGGTAGA
CAGCACAGCAGTTTAAGTGGACGTTGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCAGGGTTGTGGCTGATGCTCAGTGCCAATGTGACTGCTACTTCTGGTGGCCTTT
TCTCCTTTCTCTTTTCTTTCTTATGATAGAAACAAATAGAGAGGGGCAGAGGAACAAATA
GAGAGGGCACAAAGAAGAAATACCTGCAGCACTGCTCCACTACTTGTAAAGCTTCACTCC
TGCAGGTCGAGACCAGGTGTTTGAACCTGGGTCCTTGCACTTTGTAATGTCGTGTGCTCT
GATTGTGCCATTGCCTGGCCCCTTCACTTAACGTTGTTACAGGAATAACTCCTGGCAACA
TCTTGGAAGATTGTCAAAATAATTTTAGATACTAGATAACAGAAAAGTACTAAAAATAGC
TTCGTTTTTATCTTAACATTTTTTATAGATTATGTTTAATTTTGGGAGAAATTGTCAGGT
CTTGTATAAGAACACTGATTACTCTTTTTTACATTCGTTCCCCAGGACTCTCTGGAAGAA
AAGCGGAAGCGGCAGCGGTCTGAACGCTTGGAACGGATTTTCCAACTTAGTGAGGCTCAT
GGGGCCCTGGCACCCATGTATGGGACTGAAGTCCTGGATTTTTGTACCCTGCCCCAACCT
GTTGCCAGCCCCATCGGCCCTCATTCTCCTGGCCCCAGCCACCCCACCTTTTGGACTTAT
ACCGAGGCTGCCCGCCAGGCTGTACTGTTTCCCCAGCAACGACTAGACCAGCTGTCAGAA
ATCATTGAGAGGTTGGCAGGGCTAAGTGCTAATGGGAAGTGGGTCTTGGGACCTCAGTGG
ATGTAGTGGTTAGGGCTGATAAAGGTACTAACTTTTAGGGTCTTGCAGAGTTCTTTCTTT
TATACTGCTTGCCTTCTTCCTTTTACAGGTTCATCTTTGTCATGCCTCCTGGTGGAGGCA
CCTCCCCCTTCCCTGCATGCCTGCCACCCACCTCCTTGGGCTGGCCTCCAACGTCAGGCA
GCCTTCCAGGGAGCAATTGGGCCTGTGTGCTCTGGGCCCAGGGCTCGTCCTTTGCACCGT
ATTGTGTGTAACATGCGCAACCCAGGTTCCTGACTTGAGGCTCATCCCAGTATGATTGTG
GGGAAGTTTGCTGATCAGTGAGAGAACCTTGACCTCTTTTCCTGTCTAGAAGCAAGACTG
TTATTATCAGAGGGTTATACAAAATGCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAACTATGAGATCCATCAA
TATATTCACCCTCACATCTAGGTCGTTTTTCATCCACCATTTCTTCCTGCAAATGCCTCA
GTTATTCTCAACCACACCTCCCGTGGGTCGCAACAGTATCATTTTCAATACCTTCCCTTT
TTGTGCTTCGTTTAGTGAGAAAAATTACAACATTAAAAATAATCAGAATAGATGAATTCA
AGTCTAAGTAAGTGTTCAAACTACTATTAGAAATGTTACAGAAGGGAGTCGGGCTGTAGC
ATAGAGGGTTAAACTCATGTGACATGAAGCCCAAGGACTGGCATATAACGATCCAGTTTG
AGCCCCAGCTCCCCACCTGCAGGGGAGTTGCTTCACAAGTGATGAAGCAGGTCTGCAGGT
GTCTCTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTAT
CTAACAATAATGACATCAATAATAACTACATCAGCAATTAAAAACAAAAAGGGCAACAAA
AGTGAAAATAAATATTAAAAAATTAAAAGAAAAAAAAAAAGAAAGAAATGATTGTTGTGT
TTCATAGAAGATGGGTCATAAGATCCTGACTTTGTGACCTGTAAACCATGAGCACAGGTT
TGTTGATGTCTAGCCTCGGTATTTTTTATATTTCAGTTGGCATTATTAAGTGTGGTACTT
AGCATCAAAAGGACCAGGGATATATTTAAGTTGTTGATCACATATTTTTAGCATAGGTGA
GGCCCTGGATTTGATTCCCCAGTAGTAAAGCAAAACATGCATCACTTAAGATTTTTCTTA
TCACTCCAAGGGTCCTTTTACCTCTAGTTAAATTCATAGTAGATCTAAACAAGAAGAGAT
TAAAGACAGAAACCTTAAAGGAACAAGACAAAGCGGGATGCTTTTGATCCCCTGAAATCC
TGGCCTGAAACTTTATCTTACAGCTGCAGTCTACCTGTGCGTGCTCAGTGTTCTCCCCAT
TCCAACAGACAGATAGCTAACTCTCTGTACCCCTTCCTATCTCCTCAGGAAAGTTGCAAA
CGCTGGCAGTGCTGTTGCGACAGCTCAAGGCAGAAGGCCACCGGGTGCTCATCTTTACCC
AGATGACCCGAATGCTAGATGTATTGGAACAGTTTCTCACCTACCACGGCCACCTCTACT
TGCGTCTGGATGGATCTACAAGAGTTGAACAGAGACAGGTAACTCAGGCATTTGCAATCC
TTAGAGACTCACCTCAGCTGCTGTCTCCTTGCTCCAGAGTTCCAGGGGGGACCTCCCCAA
AACCTGTGCATGTTTCTGGGGGTATGTCTCCCAATATGGTGTTTTTTTCCCTTCCCCCTC
TAGGCCTTGATGGAAAGATTCAATGCAGACAAGCGCATATTCTGCTTCATCCTTTCACTC
GAGTGCGTGTGGTGTGAACCTGACAGGAGCAGACACTGTTGTTTTCTATGACAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACACTTGACCTCTTTTCCTGTTTAGAAG
CAAGACCTATATATCAGAGGGTTATACAAAATGCCTATGGGTGTCATTAAACAGGTTTAT
TTGGCTTTGTTTGTGGGCAAGATAGAGAAATAGACCTTGTGATGGACTACTAGCATTCAT
GAGTTTGACTTTGATGAGCATTGAAAAGAAGTGATGCTAACTCCTTCAGTAATTATTTTT
TGACCATTTATATTTCGCTAATTATTTGGGTTATAATACAAGTGGAAATTATTGGGGTTA
CAATGCACGTAGAGATAGCACAGTATTTTATCTTCCTATTTTTGTGGGAAAGCCTGTGGT
ACATTTCCTAAAGAGTGAGTAATAAACCTTGGTGAACGGGAAGGTAGTGCAGCGGTTAAA
CTCTTAGGCATGAGTTCCTAATTTAATCTGCAGCATCATGTGTGCCAGAGTGATGCTCTG
GTTTTCTCTCTGTCCCCTGGCCACTCATCTTAAAGGGGGAAAGGAAAAAAAATAATAATA
AGGCCAGTAAATTTTGTTTTGGGAAAAGGCAGAATTCTTATCTTGGTTAGAATACATCTT
GCTTCACCTGTTTTGATTCTCTATTTGTGATCAACAGAAAGCTACAAGATTATAAGATTA
AAGGGTATAGTTCTTAAGAAATTCTGAGGGCAAGAGAGCAAAAGAGCAAAGTGTGGGGCA
AAGGGAGATAGTATAATGGTTATACAAACAACTTTCATGCTGACACCCCTGGGTTCAATC
CCCCAGCACCACCATAAGCCATAACTAAGCACTGCCTTGGTTTAAAAGAGAAAGTGAGAG
AGCAAAGTATGTGTGTGGTGTGTTGGGTGTGCTTCTATGGAGTTAGGACCTTAGGTTCTT
CTGCCATCCTTAGTGTTTGTTCAGTGAAGAGGTAGAGCGCTCATCCATGCAAGATTTTAT
TGCTCCTGGATGAAGTTTTTCATCCTTTCCACTTGGGAGAGATGAAGACAGGAAGAAGAG
GAGCAGTGGAGACCACAGAACTGCTCTGCCATCTGCGCAGCTTCCCTGCTAGCACCATAT
TCTGTCTCCTGGTGCTGTGAGTTTTGAGACTTAGCCCATCTAAAATCCTAGGTCTTTATA
CATAGTGAGGTAGATACCCTGCCAGATGAGCTATAGCCCAGTTCTTATTCTTTTATCTTT
TTTTTTGTATTTATTGGTTTTATAGAGGGAAAGTGAAAAAGACACTATAACACCAAAGCT
TCTTTCACTGTGGTGGAGACCAGGCTTGAACCTGGGTTGTGCACATAACAAAGCAGCACC
CTATCCAAGTGAGCTGTTTTGCTGACCCTGTTGTTTTGCTCAGTTCTGGCTGTTGGTGGT
ACTGAGGATTGAGTCTCAGACTCTCAGATTCACATCCTGTGCATTACTGATATGATATTT
CCCCAGTTTTTTTTTTTTTTTTTCCTTTTTGGTGCCCTTGTTGTAGTTATTGTTGTTATT
GATGTCCTTGTTGAATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGGAGAGAAA
GATAGACACCTGCAGATCTGCTTCACCACTTGTGAAGCGACTGCCCTATATAGGTGGGGA
GCTGGGGCTCAAACTGGGAACCTTTCACCTGTCCTTGCACTTTGCACCACGTGCGCTTAA
GCCCGACTCCCCAGTTTTGTTTTTTTTTAAATATTGATTTATGAGGAGAGATAATAGCCA
GAGCATCACTGTGGCATACAGGATTCTGGGATCAAACTTGGGACCTCCTATTTAAATGTC
CAGTACTAGACCACCTCCCAGGCTGCTTGATCTTTGTGGTCTTAAGGTGACTACTGAGAC
CAGGAGGTGTGCAGCAAGTAGAATATCTGAGCTAAGAGCATGAGGTCTGGAGTCAGTCCT
GCTATGTACATGTTAGAATGCTGCTCTGGTTCCTCTCTTTCACTTACACACACACACACA
CACACACAAACACACACACACACACACACACTCATTAGTAAAATTTTAAAGTGTTAAAGG
AGTAATGGAGTTTGGGAGGTGGTACAGTGGATGACATGTTAGATTCTCAAGCATGAGAAT
TCTGTCCTTGGCACCATATGTGCCCAGAGTGTTGCTCTGTTTTTCTCTCCCTCCCTCCCT
AAAAAGATGACTACCATAATTCCAGGAAGTGTACCAATGCCCCAAACAGTAACCTTGCGT
ATGGTTGAGACAAAGCATAACTAGCAAAGCTTTTGTTTCTGGGGGAATGAAGTCCTCCCA
GTGACTTAGCTTTACAGATCATTGGCTCCTATTAGTCCATATGCCCATTCTTTGAGCGGT
GCTGACCAAAAAGAATGCTAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCCCGGCCCACCTCTTACCTGCCGTCCTGAGTGGACCTCCCAGGAGTT
GGAACCAGAGACCAGGTACATCAGGCATTTGGCAACTCTTAGAGACTCCCCTCATGCTGC
TGTCTCCCTGGCTCCAAGAGTCCCAAGGGGAGACCTCCCCAAAAACCTGTGCATGTTTTC
TGGGGGGTATGTCTCCCAATACGGTGTTTTTTTTCCCCTTCCCCCTCTAGGCCTTGATGG
AAAGGATTCAATGCAGACAAGCGCATATTCTGCTTTCATCCTTTTCAACTCGGGAGTGGG
GGGTGTGGGTGTGAAACCTGACAGGAGCAGACACTGTTGTTTTTCTATGACAGCGACTGG
AATCCCACCATGGATGCTCAGGCCCAGGATCGCTGTCACCGTATTGGCCAGACTCGAGAT
GTCCACATCTATAGGTACTGCCTACTTGTTCCTGGCTTCGCGTCCCTCTTTTTATTGATA
TTTTCAGCTGTTTACACATGGTCTTCATCACCTAGGCTTATAAGTGAGCGGACAATAGAG
GAGAACATTCTGAAAAAGGCAAATCAGAAGAGAATGTTGGGAGACATGGCCATTGAGGGA
GGCAACTTTACCACAGCCTACTTTAAACAGGTACTAAGATCTTCTCATCAGTACCAGAGA
GAGATCCTATGTCAGTAGGAGTTACTTTAAGAGGGTGCTTGATCTCCGTGGGCCTGCCTC
TTAACCAGTGGCATATGTAATACCCCATAGCTGTACCTCTGGGACCAGGGCTGATTCCAT
TGGCTCTGACACTTTTTCCCTGCTCAATCTAATAGCAGACCATCCGAGAGCTGTTTGATA
TGCCCCTGGAGGAGCCTGCTGGCTCGTCTGTGTCCTCTGCCCCTGAAGAGGAGGAAGAAA
CGGTGGCCAGCAAGCAGACCCATATCCTGGAGCAGGTGAACAAGAGTGGGCACTTCTAGA
GTAGAGCTAGTGGTCCCAGTATGTGTTGTCTCTTATCTGTTGACCCTTGGGGAAAATGGG
AGAGGGAGCATTCTTTTGCTCCCAGAATATTAACCTTTGGTTGTTCTAAGTATATTAGTT
AACATCTATTGAAGATATTGGAGTCCAATAGTGCTCCTTACTACTTTTGGGTGTCAGGCC
AAATGTGTTCACTCATCTGAACATCACTTTCTACTTCTAAAATTACAAGAAGTCAGTCAC
TGAGAAACTAAATGATATCGTAGTTACAAGAGGTGCCTGTACCTAATGTAATGTCCTCAT
TTTCAGAATCTACTATATCGTGAGTTTGGATGGTGAAGTCTAGGTTTGTTTTTAAGAGAC
CTATTTACTTTGAGAGAGGATGCAGATCAGAGCATTTCTCAAGTCTGACGTAATATAATT
CTAGGGATTGAACCTGTGACCTCTAACAACTGAAAATACTTCACCTGGTCAGGGGCCAGC
CGCTGACACACTAAACACAAGGACCCAGATTGGAACTCTTGCTTTACACTGGCGGGGGGA
GGGGGATGCCTCACAAGTGAAGCAGTACTACAGGTGTCTTATCCTTTTATCTTCCTGTCT
CTCTCTCCCCCTCTTGAATTTCTCTAACCTATCAGAATAGAAAGGAAAAGAAAATGTGGC
AGCTGGGAGTGGGGGATTCATAGTGCTGGCATCAAGTCTCAGCAATAACCCTGGGCGATT
AAAAAAAAAAGTGACTGGTGTAAGGATCCCAGTTCGAGCCCCCTGAAGGGGAGTCACTTC
ACAGGCGGTGAAGCAGGTCTGCAGGTGTCTTATCTTTCTCTCCCCCTCTGTCTTCCCCAT
CTCTCTCCATTTTTCTTTGTCCTGTCCAACAACAACGACATCAATAACAACAATAACTAC
AACAACAATAAAAAAGGGAAATAAAAGGGAAAATAAAAATATATATATTTAAAAATAAAT
AAAAGCAATCGAGCCCTGAGTAAACCCCCCCCCCCAAAAAAAAAGGCTCTTAAGGAAGAT
GATTAGAGAGGCTAGACAAAAAGCTCAGCTGTAGTGTTTAGATCTTGTATGCCAAGGCTC
CTGGTTTGATCCACATTGTTGCATGTTTTAAAGTAGTGCTCTGACTTCTCCCTCTCACTT
GGAACTCTGACTCCTGAATTATTTTTTTTTATTTCTTACAAAAAAAAAAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCATGAACATGGAATATCTTTC
CACCTCTTTGTGTCTTTTTCAATTTCCTTAAGTAGTTACTCATAGTTTTCAGTATACAAG
TCTTTCACTTCTTTGGTTAGGTTTATTCTTAGATATTTTATTGTTTTTGCTGCTATAATA
AAAGGAATTGATTTCTGGATTTCAACTTCTTCTAACAGTGTTTGCATAGAGGAATGCCAC
TGACTTTTGAATGTTAATTTTGTAGCCTGACACCTTATTATATTACCTGATGATTTCTAG
AAACTTCTTGCTGGATTCTTCAGGTTTTTCTATGTATACTATCATGTTGTCTGCAAATAG
TGAGAGTTTGACTTCTTCTCTTCCAATCTGTATCCCTTTAATTCCTTGCTCCTGCCTGAT
TGCTATGGCAAGAACTTCCAACCCTATGTTGAATAGTAATGGTGATAGTGGGCAACCCTG
TCTAGAACCTGATCTGAGGGGAAATGCTTTCAGTTTTTCACCATTGAGTATGATGTTGGC
TGTAGATTTGCTATATATAGACTCCACTATCTTCAGGAATTTTCCGTCTATTCCTATTTT
TGTAGTGTTTTGATCATGAAGGGATGTTATATTTTGTCAGAGGCTTTCTCTGCATCTATT
TATATGACCATGTGGTTTTTGGTCTTGCTTTTATTGATGTGGTGGATCACATTGATTGAT
TTACGCATATTAAACCAACCTTGCATGCCTGGGATAAACCCCACTTGGTCATGATGAACA
ATCTTTTCAATATACTGCTGTATCTGCTTAGCTAGTGTTTTGTTCAAATATTTTAGCAAC
TAAGTTCGTCTGAGATATTTGATCTGTAGTTTTCTTTTTTGGTTGTGTTCCTGTCTGCTT
TTGGTATTAAAGTGATGTTGGCTTCATAGAAGCTGGAAGGGAGTATTCCAGTGTCTTCAA
TCATCTGTGTTGGGGTCTCTGGTGGGGTGATCTCCAGGATAAAGGTAATGGACAGATTCT
TTCTCACTCGCGCACTGGTCGACATGAAGTAAAGACACCGGGAAGACCTGCAGCATGCTC
AGATCTCGTTTATTAGAAGGTGGACATAAGTTAAATAGAAAATCAAGCAAAGGGAATTAT
TGAAATATGTCAGAAATTACAGGTTTCTTAAAGATCAGCTTGCCCTTATGGTAGGGGGCT
AGTATGACAGGAATTAATGAGATATAAGACAGTTATTCTCCATGACGCAAGCAACTTAAT
TATCCAAAGGTATTTGAGAGAAGCATAGGGGTTAAACCAGTAGGGTGAGACAGAGAGAAG
ATGAATATCAAAAGGCCATATAGTTTGGAATTTCTCTTGTCTGGGGTCTGAGGTGTATGA
TGGAGTGTGTGATAAGGTGTGTTCTTCTGTGATCAGAAGGTAAGGTGACTTTGAGTAAGT
GAATCATAAAGTAGGCGGCCATGTGGCCTGCAGTTAATGGGGAGAAGTATTGGGGTTTCT
GTGGGCCTGAGTGTCAAGAAGGAAAGAACTAAGTCTGAGCTTCTCCCCTTTGCTCACCTC
GGTTGAGAGAGACTAACCAAGAGGGTATCTTCTCAGACCTCCATCCAAGGATGGGGGGTA
GTAGTTCTCCCTAAGCTCTATCAAGCTTACACATAGTCCCAATAGGAGGGGTCGCTTCAC
AGGTGGTGAAGCAGGTCTGCAGGTATCTATCTATCTCTCCCCCTCTGTTTTCTCTACCTC
TCTCCATTTCTCTGTCCTATCCAACAGCAATGACTGCAACAACAATAATAACGGTAAACA
GCAAGAGCAACAAAAGGTTAAAGATGGCCTGCAGGAGTAGTGGACTCGTAGTGCAGGCAC
CGAGTCCTAGTGATAACCCTGGAGGCAAGAAAAATAATAATTTACTTATTATTGGATAGA
GACAGAAATTTAGAGAGGAGAGTGGGAGAGTTGGGGACCTACGTCACTGCTTCACCACAG
GTGAACCTTTCCCCCTGGGAAAAGGACTTGGGACCAGGGACTTGACCTTGGATCCTTGCA
CATAGTTATGTGTGTTTAACTAGGCACACTACCACCTGGTTCTCTCTCTCTCTCTCGATT
TTATTTGTTCATGAGAAAGATAGGTAGAGAGAGAGAGAGAGAGAGAGAAAGAACCAGACA
TCACTCTGGTACATGTGCTGCCAGGAATTGAACTTAAGACTTCATGGTCGAGAATACAAT
ACTTTTATCTATTATTGTCTCCTGGACAACCCCTTCTTTCTATCTCCCCCTTCTCAATTT
CTTTTTATATTTTGGAGGAAAGGGAGGGGAAATAAAAAAAGGCTGTAGGGACATGTGGGT
GCTTTTTTTTGTTTTGTTTTGTTTTTCCTTCCTCCATGGTTATTGCTGGGGCTTGGTGCC
TGCACCACTGCTCCTGGAGGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCAGCCACCGCCGAAG
TAAGAAGGCCAAGGCCCCCGAGCAGGTCCAGGAACTCGTGTCAGCGAGCGTCTTCGTGGA
GTCCGGGCAGAGATTCAAGGGTCCAACCACACTCCTGTCACATCCTCCCCTCATATCTGC
AGCACCTCCACACCCTCTCGTAGTCCTGCTAGAGAACGAGTTCCACGGCCAGCACCTAGG
CCTCGACCCTCTCCACCTTCCTCTGTAATCCCAGTCCCTGCCCCCATCCCTGTCCCTGAC
CCCGTCCCCAACCCTGTCCCCATCCCCGTCCCCATCCCTGTTGCTGCCCCCGCCCCCGCG
CCCATGCCCATTTCAGCTCCAAGTCCAATAACCATGCTCCCTGTCCATGTCTTGCCTTCT
CCCCCTCTTCCTCCTCCACAGGTCCCTCCTCCTTGCTCTTCTGTCTGCACTCCTCCTCCT
GCCTGCACACCGCCTCCTGCTCATACCCCACCACCAGCTCATACCCCACCACCAGCTCAT
ACCCCACCACCAGCTCATACCCCACCACCAGCTCATACCCCACCTCCAAATCAAACCTCT
CTCTTAACTCCTTCCTCTCCTCTCCTGCCTGATTTGCCTTCTGCACCTGTCTCGCCGCCA
GTCCCCACCATCGCCATGGGCCCGGGCCCTGAGGCAGAGCTGTGTGCTCAAGCCTCAGCA
TCTGCTGAGCCTCTGGAACTGGCTGATCAAACCAGTTCCGAAGCTTCTGCGCTTAGTCTT
GTGCCCCCTAAGGATTTGTCACCACTTGCCATTGAGACCCTGCCTGTGTTGGAGGAGAAC
CTTTCTCTTATCTCTTCTACACCCAGCCCAAAGCTAGAGGCCGGCAGCATCCCCAGCAGC
ATCCCCAACGGTCAAGAGCAGGAGGTGCTGGAGCCTGCCCAGGGGACCATCCCCCCAGTG
CTGCCTGATGGTGAGGAGGTTCCCACGGGCCTGAGTGAGAGCAATGGCTTGGAGCTCCCG
CCCTCAGCAGCATCTGATGAGCTACTGCAGGAGCCACTGGAGAATGCTAAGAATGCAGAA
GAGCCAGTAGAGACCCAGACTCCAACCTCCAGCCCAGAGAAGCCACAAGAATTTGCTTCA
GTTGAGGTCACAGTCCCATCAACCTCATCCTCAGCCACCTCCTCACCTGAGGGCCCTTCA
CCTGCCCGGCCCCCTCGGCGTCGCACCAGTGCTGATGTAGAAATCAGGGGTCAGGGGGCT
GGCCAGCATGGGCAGCCTCCAGGACCCAAAGTGCTTCGAAAGCTCCCAGGACGCCTAGTG
ACTGTGGTGGAGGAGAAAGAGCTGGTGAGGCGGCGGCGACAGCATCGGGGAGCGGCCAGT
GTCCTAGTGCCTGGGGCCTGCCCGGGAAGTCCATCTGCCCGCAGCACGTCGGGGCCAGAG
TTCTCACCTCACACCAGTGGACCCTGCAAAGCTGCTCCCCCATCCACACTGCCCACCCCA
ACCCAGCAGCCCTACATAGCTCGCCGCCGCATTGAGTTGGGGGTTCCTGGTGGGAGCAGT
CCAGAGAACGGGGAAGGGACACTGCTTGCCGTCACTCCCCCTGCTGTGAAGCGTCGGAGG
GGCAGGCCTCCCAAGAAGAATAGATCTCCCGCAGATGCTAGACGAGGGGTAGATGATGCA
CCTCTGTCCACCTCCAAGGGGAAAACCAACGGAGCTGACTCGGTCCCTGCAGCTGAAACC
CTGACTGTCGCAGAGCCTGTCCCAGAACCCCAGCGTGTTCCTTCACCCCAGCCCCTAAGG
CCCCGGTCAGCTCATAGACCTAAGCCCATCATCCTCTCACCTGTGGAGAAGAAAAGGCGT
GGGCGGCCCCCTAAGGCTCGAGAGTTGCCTACTCCTGGAACCACTTTCTCTCCAGGGGAT
GGCAGCTTGGAGAGTCGGACACAGCCACTCCCATCACAACCAACCTCCTCCCCCGCCCCT
GTTACACCACCACACCACCCCCTCGGCACTGCTGTCTAGCCCACTGCTCCTGTGGCCAAC
ACTGTCACAATCTCACCATTTCAACATCCCCACCCAAGCGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1223, 1339..1616, 2221..2311, 2444..2533, 3681..3872, 3963..4100, 4128..4315, 4418..4595, 4717..4853, 5096..5265, 5369..5561, 9509..9645, 9753..9939, 16163..16332, 16912..17177, 18132..18296, 19024..19287, 19630..20815, 20817..20824, 20830..21098, 27525..27790, 27928..27949, 27951..27996, 27998..28007, 28010..28027, 28029..28037, 28039..28052, 28054..28097, 28099..28124, 28126..28139, 31548..31668, 36799..36806, 36808..36813, 36816..36834, 36836..36842, 36845..36851, 36853..36854, 37010..37024, 37026..37054, 37056..37063, 37065..37072, 37074..37081, 37083..37094, 37096..37123, 37125..37213, 37295..37409, 37595..37714, 42924..43118, 43219..43302, 44263..44424, 44427..44637, 44668..44824, 44897..46292, 46306..46320, 46331..46343, 46346..46350, 46353..46355, 46359..46385, 46388..46417
1001..1223, 1339..1616, 2221..2311, 2444..2533, 3681..3872, 3963..4100, 4128..4315, 4418..4595, 4717..4853, 5096..5265, 5369..5561, 9509..9645, 9753..9939, 16163..16332, 16912..17177, 18132..18296, 19024..19287, 19630..20815, 20817..20824, 20830..21098, 27525..27790, 27928..27949, 27951..27996, 27998..28007, 28010..28027, 28029..28037, 28039..28052, 28054..28097, 28099..28124, 28126..28139, 31548..31668, 36799..36806, 36808..36813, 36816..36834, 36836..36842, 36845..36851, 36853..36854, 37010..37024, 37026..37054, 37056..37063, 37065..37072, 37074..37081, 37083..37094, 37096..37123, 37125..37213, 37295..37409, 37595..37714, 42924..43118, 43219..43302, 44263..44424, 44427..44637, 44668..44824, 44897..46292, 46306..46320, 46331..46343, 46346..46350, 46353..46355, 46359..46385, 46388..46417
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved