Erinaceus_europaeus Locus C9orf97
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus C9orf97
Erinaceus_europaeus
C9orf97
GeneScaffold_4058
SNORA44
18200..18325
25861
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCTGTTTCCCTGGCTTATTCCTAGGA
GCTAGTTAGCTGAAAAGAATCTGTCACTCAAGCCAGACAAGATGCCTCTCCAGTGCACAG
ATCAGGAGAGGATTTGGAGCCTCGGCTTTACGATTTTCGGACCTAGATTTAAAAGATTCA
AGACGCATCAACCCCACGAGCCGTCTCAAAGCAGAGTTAGATGTCAGTACAAAGAAGAAA
TTCTCATTTGCAAAAAAAAAGGTAAATTTTCTGTTAATGTTTGAGGATCACCTGTATACA
GTTTATTCAGATGTATCTACATGTAGCTTCTCAAGCCTGTCTGTGGGGAGTAGAGAGCTG
AGTAGACACTAGGCCGCTGCTGTGTCAGGTAAGGCCTCCTTAGGACCATGAACCAGTGAT
GCTAACTGAATACCAGGCAAAGGAGAATCCTAGAGAAAGTGTCCTGCAACAGGTTAAGAG
TAACTTCTGGTGGGCAACTTGAGGACAGCTAGATAGATACATCGTGTCTGTGCGGCAGCC
TTGGTAACAGCTTAGATCCTTTATTTATTTAGTCATTTATTTTAATTTTACCAGAGCACT
GTTCAGCTCTGGCTGATGGTGGTGCTAGGAATTGAACCTGGGACCACAGAGCCTCACACC
TGACAGTCTTTTTGCACAATCATGATGCCATCTCCCCAGCCTAATAACTTTTAATTGTGA
GCGAAAATAAACTGAAGTGCAAAATACTTCATCTTAACCTTTAAAAATGTCATATTCATG
ATTTGTAGGGGGGATGAGAAGGTGCTCCAGATTGGATTGGTGAGGCATGACAGCTGCATA
CGGAAGAAGCATCTTTAGTTGGGTCTTTACCAGTCATTTGCGGAGCTAGCACAGTGGTGA
CACACAGGCCTGCCGCGTGAGAGGCGGCACCAGTATCCAGAGTCAAGTGGCGCTCTGGTC
AAGGAAGAAAAGAAAAATACTATTTGCGATGGTTGATGATGGATGAATAGAACCTCTGCG
GTAGCCCTCTGTCTAATTCTAGCAACTTTTCTGTTCGTTTGAAATGATTGCAGAATAATT
TTTGAAAAATGTTGTGATCCTTTTGTGAGATATGGGGCGGAAAGGTAGCTCTTCGTTTGC
CCGAAGGCCAAGCTTGTTAAACAGTGACATATCTGCGATGTAACTGCAGGCCTTTGCCCT
TTTTGTCAAGACCAAAGAATTCACAGAAGCGCCTTTGCAGTGTAAAGAGAAAAGGTGGAA
GTGCTGTCAGCAACTATTCAGGGACCAGACAGGCATCCATAGACATGTGGCAGCACGACA
CGCCGATGAGGTTTGCCACCACACGGCTTGTATTTTAAAGCAGCTGTCTGTGAGCACCTT
GGACAGTCTTAAGTCTGCAGATGAACGGAACCCTTTAAAAGAGCCCCTTACTCACGACCG
TGACGTGTCTGCCTGGCTCCCTGACATAAGCTGTTTTAACCCTGACGAGTTGAAAAGGTA
AATATTTCATTCTGTATTTCGGGCATAGTTTTTCAAATGTTTCCCAGCCATCGTGAAATC
TCACAGTTGATCCAGTAAAATGACAACAGCCTTGAGGCAGAGTGCTTCTCTGCTGGTCTG
CACTTATGGTCTGTCCTATAGAAGGCCTACGCACTGGTGTACATCCACACAAGCGACGGT
GTTTGCTGGGTTCCTTAGAAACCATCCCACATCTTGTCTTCTGGAGGAGGAGGTGAAGCG
TAGGCAATCTTGTTATTTTCAAAGAGAAATGGGAAGGGACAGAAATGTTGATGCTCTCTC
TACTCTGAATAATGCAAGAGATTACAAAGGGACTGTGTTATCAGCTGTGATTTTTCTGAA
GGGCATATAGATCAGAAATTCAGTCGCTGTCCTTCAAAAACTAACCAAATCATAATATCA
CGAAAATTCTAGAAGACAGAGCTCTGCTTTTTTTTTTTTTTTTTTTTTTTGAGTGTTCTC
CGGTGTCCGATTCCTTTTTTTTTTTTTTAATTTTTTTAATTGTTTTATTTTTTTTAATTG
GGGAATTAATGTTTTACATTCAACAGTAAGTACAATAGTTTGTACATGCATAACATTCCC
CAGTTTCCCATATAACAATACAACCCCCACTAGGTCCTCTGAATCCTTCCTGGACTTGTA
TTCTCCCCACCCACCCACCCCAGAGTCTTTTTACTTTGGTGTGATACACCAATTCCATTT
CAGGTTCTACTTCTGTTTTCTTTTCTGATCTTGTTTTTCAACTTCTGCCTGAGATTTCTG
CTTTTAACAAATTCCTGAGCTATGTGAATAATTTAAGAAATGTCCAAACATACATTTTTA
TCACTAGTCTTCACTGCTAAATTTTCTTTATAAGAAAAACGGAAAAAGGCAAAAGTTAAA
AAAATAAAATTTATTTCATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAAATT
TATTTCATTTTACGGTCAGGGGGATTCTTTGTACTTTTACTTGCTTTCTTCTAAAGTTGG
AATAATAATGCCTGCCTTGCCCCTCTCACAGTCACAATATTGCTATATGGATTGCGTGAT
AGTAAGAGCAACATCATTTACATTTGTGTTACAAATGTAACATTTATTACAAGTGAACCC
ACTCCTCTTGGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGCTAGGACAAAAGA
GAAATTGAGAGAGGAGATGGGGGATAGGGAGAGAGAGAAGACACCTGCAAACCTGCTTCA
CCGCTCCTGAAGCTTCCCCCTGTAGGTGGGGAGTCGGGCTAAACCCTCCTTATCCTTGTG
CTTAACCGGGTGCATCACTGCTTGCTCCCCACCTCTTCACTTTTCTATGGTCATGCACCT
CAAGAAATTTGCTTTCTAGTTAAACAAAGAAAAGGATACATGAGACAATGAACAGATGAC
AAGAGAAGACAGGCAATATAATTATCAGTTACACTGTATGGCACAGATAGTAATTTGTTA
GAGAGATTTAGAGAAAGAAAAACTGACTCTAAAACAGGCAAATTTTAGATGAGACTAGAC
CCTTAAATGGGAGAGTACTGGTGAGAGATTCAAAAAGATGAGTAGGACTTCAGTGATCAT
GGAGGATAGATCCTCTCAAATGTACTCTGTGCAACTCAAGTTCTGGAGGATGATAAGAGG
CATTGGAAGAGACACTAAAGACAAATGTGTTGGAGAAATAGTAGGCTCAAATGCCTTTTA
TTGCCAGAATCCTCAAAATCTTCGGTAAAGAAGAGGATTTTCGCAGTGACTTCCAAAGCA
AAAAATACTGTCTTTAGAATTTCACACACATGTAACTTCACAGAAAGTGCCAATACAGTT
TGGGAAATTAAGTTTAATTCAGTTCTCTGGCTTTACAGATAAGCAAAACAAGGCTCAGAG
ATGGTAAGACAGGCACGCAGGCCCCAGAGGTAGGAGAAATAGCGCACGTCCTGATTGTAT
CTAGTAGCGGCTTCACCTAGGAGAAATTGGCCTTGCTTTACCCAGCTGTAAAAGGGGACA
CTAACAGCTTCCTGGGTAAGAGGATTATGAAAACGGAGAAGTCAGTTTTCTTTGTACAGT
GAGAAACTCAGAACAGATACTGTTTTAGAGAAAACTCCAAAATTGATTCAAATTCCTAAT
CTTCCTGTGGGGCTATTAATACCTGTGTTCCTGATACTACAATTTACACAGTGAAGCCAA
AAGAGGGGTGTTTCTCGCTTCAGGAGGACGGTAGCCGGAGCTAGCAGTCACCTCCCTCCG
ACATGCCTGCTGTGTATATTGTAGGAATTGGGCTTCTTTATTGCCAGTCTCTCAACTGCT
CCTTTCCTGCAGTTTCCTTCCTCTCTCCCTTCCCCTCCCCTCCATCCCTCCTTTCCTTTT
TTCCTTTCTTTTTTTATAGCGAGCAGGGCGGCGATGGAGGAGAGGTGCTGCTTTATTACT
GCTACTGTGACCTGGACGATCCCAACTGGATTTGTGCCTGGCAGACGGCTCTCTGCCAGC
ACCTGCACCTCACAGGCAAAGTAAGACCTTCTCTTGCACACAAGTCTGCACGGGGCTTGC
CTTAGTTCTTAGACATTAGCAGGATCCCGCTTAGCATTTCAGTAGAATACTAAGCAGACA
GCAGCCCAGGACGTGGCACAGTGGGCAAGATGCTGAACTCGCAAGCCTGAGGTCCCAAAT
TTGATCCCTGGCAGGAATAATGTGCTAGAGTGATGCTCTGGTTCTCTCTCTCTCTCTCTC
TCTCCTTTCTGTCATTAGTAAAACAAGGGGGTTGGGCAGTAGTGCAAGCGGTTTAAGTGC
ACATGGTGCACATGGTGCAAAGTACAAGGGCCGGCATAAGGATCCCGGTTCAAGCCCCCA
GCTCCCTACCTACAGGGGGTCACTTCACAAGTGGTGAAGTAGGTCTCCAGGTGTCTATCT
TTCTCTCCTCGTCTATCTTCCCCATCTCTCTCGATTTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTGGCTCAC
CGGGTTAAGCACACATGACAGGCACTAGCACGTGGGTTTAAGCACATGGTCCCCACCTGC
AGGAGGAAGCTTCCAAGTGGTGGAGCAGGGCTGCTGGTCTCTGTCTCTCTCCCTCCTCCC
TCTCCACTTCTCTCTATCTCTATGCAGTAATAAATAAATATATAATTAAAAAAAAAAAAA
GAAATTTGAGGGTATGTCTTGGTGGCTCTGGAAAAGAAAAATTATAAACTTGAGAATCAG
GAAAACAAATTTTGAATTCCAAATCTGCCTCCTGCCAGCTCTGCGCCTTTAGACAGGGTA
CTTGAATTCTTGGGGCTTCCATTTCTTTTTCTATAATTAATTAATTAATTAATTTCCATT
TCTTTTTGTGTGAAGTAGAGGACTCTGATATAAACCTTATAGATTATAATATAAAGCTCC
CATCTCATAGTATGTACTCAACAGATGCTAACGCTCACCTTTGAGCTCTGAAAATACAAG
GCTTCCTTCACCAAGGAAACCCTGAGATGGTTTCTGTTGACAGATCCTAGTAAGTGAGAG
TCTTGTGCATAAGTTTAGAGACTGCACTACCCCAGTTATGTAGGGAACAGATAGGTCTGT
CTTTTAGTTGGGCTCAAGTATTAAAACAGCATGAGTCAGAATCTCCCAGCCTACCTAAAA
GACAAGTCTGTAGAAGTCTGCATCTCTTACTCTTACCTCCACCGTCAGAGTGGTTGTAGT
GGGGCACTTCTGACCTTCCTATTTAGCTTTTACACTGGCTCAACTATTTATCCATGAGCA
AGAGAGAACCGGAGCATCCCTCTGCCACATGCAAAGCCAGAAATAACACTCAGGACGCCA
TATTTCTTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT
CACTTATTTATTATTGGGGATAGCATGTTTCCAAGGTTTGTGACAGGTCACAGCCGTGGG
ACCTCCAACTGCAGGAAGAATAACCGGAGACTCTGACAGCACAGGTCAGCATAGCACCTG
CAACCTTGCTATTTTTCAGAGCCAGGGCTTGGGTGCCTGTCTTGTGGATCTTTCACCAGT
TTCGGATAGAATTTATCTAAGAAATTTTAACTTATTCAGCAGGTTTCCTGGCAGTGTCAG
ATACTGAAGCTTGTGACAGAGACCACTTGCTGGAGTTTTGCTTTTTAGACCTGTTACCAG
GAGAGCTGTCCTCAGCTGCTCCTAGGGTGTGGTTGGCAATATAGAGGCGGAGAATCAAGA
GGAACCCAGCTGAGACAAGGACAAGTGTGGCAGGGGCTGCAGTGGCCAGAGTCTCGAGGT
TTGAAGGTGGATCCCAAGTATCATCTTCCTCTGGTGTTGATAAAAAGAAAATATTTTTCA
AAGTTTGGGGAGAAAAAAGGGGGGGAGAGATAGAGAGGAAGAGAGAGACACCTGCAACCC
TATTTCACTGTGAAGCTTCCCCCAGCAGGTGGGGACCAGGGGCTTGAGGGACCTTATATT
TTCAAGTCCAGCACTTCATTTCTTGCACTACCACTCAGGTCACTTACCTCTATTTTCTGT
AGTCCCTTCAAAACTATATAACCTGCTGGTGGGTAGAACAGCTGACTTGGCAGCGATGGC
GCTACATCCTAGACACTCTTCCCCATGCCCAAGACAGGCTTCACTAGACTCAGTACTCTT
ACTGAAGGAACCAGTATAATCTCTTGGGAGTCTGAATTGCCATTGTGAGTTGGCATTAGC
TTGTAAAGGGAATTCCATTTTTATCCACTCCCAAAAGAATTAAACAAAGGGAGGCAACAA
ATGAAATATATTCTCTGGATCCTGAAAAAGGACAACGTTAATTTTTTTTTTTTAATCACA
TAGTCGCACATTGGTGGATGTTACTGTTGTAGAAATGGTAGTAATAATACAGGACTTTGA
ATTACTTTTTCCATAATTAAATTATCATGATACCACCACACAGTGTTACATTTTTCTCTT
TTATACTTTTCTCTAGAGAGCTCAGTCCCCTTTAAAGATGACCCATCTTTAAACTAATCC
AAAGGATTAACAACTAACTTTGCAGACCACTGCCTATGAAACCAGTGACTTTATTCTGTG
CCCTAACCAGTGAAATCTTTCAAAGAAAATACAGGATCTGAGAAGATAAAGATACACGTT
GTTTTGTTCCACAAACCAGGCAGAGCGCAGGTCATCAGCCACCCTCCTGCACTTACGTCC
CTATGGGGGGGGTTGTGTGAGGGCCACGCTAATTTTAGTGTATGTGCTGTGAATCGAGCT
CTGTGTGTGGGTTTGCAGTGGTGGGTTTTCCCCACTACCATTGAGAGAGATACTCACGTG
TATCTTTGTGCGCTGTCAGATGTGTTCTGAGTTCTAGGACTTGAGTACTATCCCCTCAGT
AGTTGTTTTCCATGTTGGTTCTCAAGTTTCTCTATATACAAAAATGAAAAAAAAAAAAAA
AAGAGATTCAAATAAGTAAATTAGTTTTCTTAGGGCCACATGGCGAATCCAGTGGTAAAA
ATGAATGCTGATACTAGTGTCCACTAAACTAGATTTGGCTGAGTTAAGAATTCTTTGGTC
ATGGACCAGTTGGAGGGCTGTAGCAAGTGGAACTTCCCAGAAGTTTTGTTCATTCCATTT
TCATATATATAATCTATTCCCTTTTGTTGCCCTTGTTGTTTTATTGCTGGTTATTGTTGT
TATTGATGTCATTATTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGA
GAGGGGGAGAGAAAGACAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCCC
TGCAGGTGGGGAGCCGGGGGCTCAAACCGGGATCCTTACGCCGGTCCTTGCGCTTTGCAC
CGCCTGTGCTGAACCCACTGCGCTACCACCTGACTCCCGTTCATTCCATTTTCTTGTTTA
GCACACTCTGAGCACTTCATCAAAACTGTAGGCAGCCCCATTTTAGAAAGCAAGTATCTT
TGTTTGATAACACTTTGATAACTCCAGCAGTGTCTCTACTTTTCCTGTTAAATTCACTGA
CACAAACCTTTTGTATCGTGGGGAAATGTAAATGACGCTAAGAGCAAAGTGTTTCCTTCA
TCTCATCATCTCGTGTCTCAGGTTCGAATTGCTACAGAAGGGATCAATGGGACAGTTGGT
GGAAGCACACTGGCCACCAGACTGTACGTGGAAGCCATGCTTTCCTTCCCAGTGTTTAAG
GACTGTCTATGTAAGGATGATTTTAAGGTAAGAGAACTGGAAATAATTTGGGTTTGGAGC
TGCTTCTGCCTCTGTGCCTCTTTCTTCCTCTCTAGATTAAGAGGCCTTAGTAGAGAAGCA
AGCAGTCAGAAGGTCTGGGCAGTGGCGCACTGGGTTGAACGCACATAGTAAGAAAAGGAA
GCAGCCAGCCAAATGCCCTTTGTCCACTGAGTTAGGAGGCAGTGTGGCAGAGGGCACATC
CTCCTTCCAGTTCTTCCACTGAGGTAGCATGTGATCTTGGGCAAGTTAGTGTCTTCTCTT
GACCTTGCCCACCCCCCTTTAAAAAAAAAAAAATTTAAAATTCTAGAATATGAACATTAT
AGTCTGTATGATCTGAAGTCTAAAATTTAGGCTTCCTTGCGAGATGACATAGCTATTCAT
GGGGTGACCTAGTTAGTAAGTCTGGAGTAAGATCAGCGTTTTGCACTACACAATACTTTT
GCTCTCTAAATGGAGCTACTTAATTTGACCTCCTCACAACAGGTGGAGAAAGTGTCCGTG
CTGTCGGTGATAGGACAAGAGTGGTGACATCGACAGGGCAAAAGCTGGGACGTGGGCTTG
TTGAAATCACTCAGCAGTATTTCAGTTTTAGAGTTCTAAGTGCTGAGAGCTATGGGAATA
CTTTTCACCCCAACATTTCTGAACATAGTGGATAGCAAATGTTCCTGTCTCTGCAACACT
GCAGATAACTTCTTTTCCTATGGAAAACAATTGTTCCTCATTTTAGGGCATCTTAAGAAT
ATAGCTCTTGCATTATGACAAAACTGATAGAATTCTTACAGTTGGTACTTGGAGATAGGA
AAGAATGTATTCTGTTTTGTTTCTCGTTGACTAGACTAGCAAAGGAGGAGCTCACTGTTT
TCCGGAGTTGCGTGTTGGTGTGTTTGAAGAAATTGTACCCATGGGGGTCAGTCCCAGTAA
GATCTCCTACAAGAAGCCCGGTATGCATACTTCTAGAGGAACACTTTGCTTTTTGTTCTA
GACAAAAAATGTGATCTCAAGACAAATGTAAATGTTTGACCCTCTTAACCAGCAAGAGCT
GTGAGGAATCTTCTCTTTAAAATAGCTTTGGGGTGCCTAACACCTTAAGATGCTCCTTCT
CTCTGCTGCCATGGTAATTGAAGGCTCGCTCCTTCGAATGACCTGTCTTATTCTTCTCAA
TGGTGACTTGGCAAGCAGATGCTTTCTCTTTCTGAAGATAGCAATTCGGGAAGCATATAA
TTATTACTTGTAAAGAGCTTGTCAACTGAAAGAACACCCAGCCTATTGCTCTGGGAAGCA
AGTGGTTTTCAACACTAGAGTGAGCTACTTGCCAGTGCTCTAGAATGTTCTCTTCCCTGT
GTTCCCTTTGGCTCCTGTGGAGGGTCAAGACATTCATCTGGTGGTAGTTTTTGGTTTAGT
CTTAACTTTTTACTACTAAACATTTCAAACACTGAGAGAATGATTAGGCAGCCAGGTGAC
TCCGCAGTAAAGCACAGGACTCCCACGTGTATGACAGCCTGTTTCAGTCCCTTAAAGATG
TGATAAGTGTTTTATGTTTGTTTTGTCTTCACATTATTTTTGTTTGGCTCTTAGGAATCC
ATTTATCTCCAAATGAATTCCATAAAGAAGTAAAGAAGTTTTTGTCTCAGACAAAGCATG
CACAAAGTGACACTATTCTCCTGGATTGTAGAAACTTCTACGAGAGCAGAATAGTAAGTA
AGAAGCAGACTGAGTTCACTGACACAGTAGGTAGGCCTCCCCTATCCCACAGCATTGCAC
GTTTGCCATGGGGACACCATGCGCCTGCCAGTAGCTCAGTGCCATGGATCTCTTCCCACT
GTAACCACTTCTGAAAAAAACCTGTGCCTTTGCATTCAGGGGCTGGTAAGAAAATATGAA
TTAAAGACCACTTGGCACAGGGTGTACTCTTTGGCTTCTGTGTGTCTACTTTTGGTTGAC
AAATGTCAGGGCTTTTATAAGTTTGCTTCAAGCAGCCTGTCCAGTCTCAAGTGAGCGCTC
TTGAGAAGGCGGTCTGCAGCCTTGTTTTTTTTTTTCAGTTCCACGTCTTACAACCAGAGG
GTGGGATGAACACAGCAACTAGTAAGTGCTTCCTTGCTAGTGTAGGGTGTTGGGCATAGG
AAGACTCTTTATTCCCAGCACGTATATTTTCTGATAATTTTCATTTTGCTGTTCTTGTAT
CGTAGGGGCGATTTGAGGGCTGCCTAGCTCCGGACATCAGGAAATTCAGTTACTTCCCTA
GCTACGTTGACAAAAATGTAGAACTCTTCAGAGAGAAGAGGGTGCTGATGTATTGCACTG
GGGGCATCCGTTGTGAGCGGGGTTCAGCCTACCTTAAAGCCAAGGTGAGTCGCCCCCTGC
GGGGACAGTGGGCCTGGAAGTGAGTGACGCCCCACCAGCAACGTGTGGCACTCCCCATCC
TCCTCCTCATGGCCTCCCCCACTGCCAGCCAGGAGTTTGTTTTCCTCTTGGGTACTTTCA
GCCTAGAGTGCGTCGGCATCAAACCTAAAGTTCTTAAACCTCAAGATTTGAAAAGCACTT
AGCAGTCTTAGGGACTCATCCAGAACAAATGGGAAAGATTAGTTAACATCTCCTTTTTCC
AGATCCTTTTGCTTGATGCTAAAAAGAGCGAATTCAGTCACATCACATGCCCCAACAGGT
GTCTTCCTATATTTAAGGGGCAGCAAAAATAGTTGGGCTTCCACCGGTCTGGAGAGTGAA
GCCCTGCCTGCTGTCACCACCCATCCCCCACAAGCAGGGTCTGGCCAGCTGGCTCCTTGA
CCCCTTGGTTAGCAACTCCTCAGTGGCCACCAGCGGGAGGGAGCTAGGGGCCCCCTCCAT
CACTGTCCGTCAGGCAGCCCTCCCTCTTCTCCGCCATCTCTTACTGGTCTCTGCTCGTGT
CCTCGAATTTTCTGTTATTTTTACACATACAGGGAGTGTGCAAGGAAGTGTTCCAGCTTA
AGGGTGGCATCCACAAGTACCTGGAAGAGTTTCCTGCTGGCTTTTACAAAGGGAAATTGT
TCGTTTTGATGAGCGGTATGCCTTGTCCTACACAGTGACATAGTGTCAGGTAGGTCAGCA
CAGGGCTGGAACCTCAATCTGTCAGCAGGTACAGTCTCTGTATTTAGCCATTCTGGAAGG
AAGGTGAGGGTACCAATTACTTGAAGGAAAAAAGCAGGAAAAGGTATGCAGAGTACTAGC
ATTTCCAACTGGGGCTGGCAGAGAGAATCCTGGCCCAGAAAGTAGGAGGCCTGTACCTGG
GGTCTTGGCTTTACTATTTACTACTTAGTGGAATCCTTTCAAGAAAGGGGCACTCTCTCA
CTTTTTTTTTCTGTCTCCTGTGTATGTGCACTAGTGGACTAAATCAGGTGTCAGTATGTA
GAATTCGGGAGTTCTGTGAAATTTGGATGGGGGGTAATTAAATATTTGCATGATTCTTTA
CTAAATGTGGAAAAGTGTGAAATGTCCTAAGAAAGTAGATCGTGCTAGTTGTTAAGACTT
GAGTAGCAAGTGTCCACAGCTGGAGAAACTTGAGCCTGAGGGAGAGGGGCCTGGACCCCA
AGAGTTGAGTGTAGATGCGGAACCAGCTGCATTCAGACGTATTCCATGGTTTCTCGCTGA
GAAATGGAATAAATTAAAAGAGAAAAACTCTAGAGCAAGGAGTGGCTGTCTAGCTTTGGG
ATAGTTAATGAGCGAGGAAAAAAATGTTTTTCTAAATGAGAAGAAGTAAAAAGGCCAACT
AATGTGTCAGCTAGGAAGACAGTTCCCAGAGGCAGACTCGTTCCCAGAGTGGAGTGGTGT
GGGGTAGGATGGAGTGGGGAGCCCTTTCTGTCTAACCCAAGACTTGCTCTTTAGAGACCT
TCCATGGCCTCAGCAGGATGTAGTAGATTCCGGTGAGCTAATAGTTATATTTAGGAACGA
GAGAAGTGCCTGTCTTTGTGCACAGGTATTTATGGCACCGAGTATCTGTCTGTCTCTCTA
ACAGGGACTTTCCTTCTTCCCTAGAATGTTCATACTGTGGGGCCCCTTGGGACCAGTATA
AGCTCTGCTCTACGCCTCGTTGCCGCCAGCTTGTCTTGACCTGCCTTGCCTGCCAAGGAC
AAGGACTCACAGCCTGTTGTGTTGTATGTCAGGACAAAGGCAGGAGGCCGGCTTCATGCC
CTACACTGAACAGCTTCAAGGAGGAGTGTGAGTGCACAGCCCGACGGCCTCGTATTCCTG
ATGAACTTTCACAGCCTACACAACTGCCCGTGAGCCCAGAACCCAGACCTGACGTTGAGG
AGAACGGGCCGTGCTTACGTGAGCGTTTCCACAAGCCCTCACAAAGCTAGGCTGGAAGAG
GCCACACATAGGACACTATCAAGGCTGCAGCAGCAGAGAAGTGGGGAACTTCAGTCCTGG
CCAAGGCCACTGTCACAGATGGTTACCTGGACTTCTGAGTGGGTACTGGCCACTTACCTG
AGACATTTTGACCCAGCATACTAGAACACAGAAAAAGGTGAGCTCTGGGATTTCAGAGAT
GCTGTGGGATAGTCTTGAGTCTGGTGAACAGATCGTGCCCTCTGTACTGTGCAGTAAGCT
TGTCTGTCCTAGTGGACAACTGTGTGAAAACATTTCTGTACATGAACTTGCTCTGATCCA
CGCCACTTAGGGCATCTGTGCCCCCCACCTTCTCTGCCATCCTGAACATAGGAGATCACA
AGTCTGTAGAGCATGGCATCTGGCCCACCTCCTGCGTTTGTAAAGAAAGTTGTACTGGGA
TAGTCACGCCCATTCCTTATCTAATGATCCATGGCAGTATGAGTGCTTGGGACAGAGACC
TTAGGGGCTGCAAAACCCAAACAGTCCCTGTCTGGCCCTTTACAGGACCAAAACACATCA
GCAAACAAAACGACACCCGGTCTAGATTCACAGCTCTCCTGGGGGAGCAGATGTTCTGAA
GATGTGACTCACCTTCATCCTCTGTTGGTTTAGCCTGTGAGAGGTTCTCCCCAGCAGCCT
CTGCTACCCTTGATTGCTTTGGCTTAACAAGTATCTCGGGATATGAGGTACCGAGTTGGG
GACATCCAGAGCTGTTAATGGTGGCTGCACAGCCTTCTGGCCAACACACCAGCCACATTT
CCGTTACACAGGTCCCAAGAACACATACACAGTCATACATAGACCATTAATAGATTTAAT
ATTATATTGCAGTTTCCAGTGATGCCGAATACAGCTGCAGTTGTGTTTCAAGGAGAAGCC
GGGTGGGGCTGGCTGTCCCTGCAGCATGGAGCCACTCCAGGGCCCATTTGCAGCCTCAGT
AG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1008..1016, 1019..1021, 1024..1038, 1041..1160, 2089..2396, 15619..15739, 20421..20546, 21394..21499, 22134..22252, 22745..22903, 23492..23581, 23584..23610, 23613..23628, 24564..24847, 24850..24861
1001..1006, 1008..1016, 1019..1021, 1024..1038, 1041..1160, 2089..2396, 15619..15739, 20421..20546, 21394..21499, 22134..22252, 22745..22903, 23492..23581, 23584..23610, 23613..23628, 24564..24847, 24850..24858
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved