Erinaceus_europaeus Locus RPL30
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus RPL30
Erinaceus_europaeus
RPL30
GeneScaffold_5547
SNORA72
3423..3554
4781
NNNNNNNNNNNNCAGAATATATTTATTAATAATCTCTTTAACTTTATTTTACTATCAAG
TTTGATAGTAGGACGGAGAGAAATTTAAAGGGACATAGTAAGACACAGAGAGACACCTGC
AGACCTACTGCAGCTTTTGTGAAGATTTCCCCCTGCAGGTGGGAGAACGGGGGCTTGAAC
CCAAGTCCTTGTGCACTATAATGTGTGCACTTAACCAGGTGTGGCACCTTTTTTTTTTTC
TTTTCCCGTGCCTGATGTTTCCAGGGATCCGTCCATGGACATTACATCACTACCCAGTGT
TCTGAGCAAGATGATTGTTTAAAAGTATACCCCTCTGCTGCTCATTCTGGGCCACTTCGG
CTTCCAAGCGCTGGCCGCCAGCATCTTCAGACGCTTCTGCAGTTTACGCGAGTCCCAAGC
AGCGCATGCCAGGCGGGAATTCACAAGGAAGGCAAGAACCGGAAGCTGCAAAGTAAGGAG
TCCCACCGGGAAGCACGGCTTCCGGTAGAGAGGAGTTCCATGGCACTCAAGAGGTTCAGC
CACCTCCACTGCCACTTCTCTCTACTCCTCCCACTTTACCCTCGGTCGGCTTCTCGCCAC
GTCTGAACTTGCCTCATTTTTACCGTCCGCAGCTCACACAGGCAAAGTAACACAGAGTTT
GAAGTTTAGAATTACGAAGCCCAGAGAAACTTAACACCCGCACAGCCCCACAAAACAGAT
TCCTAAGTAACCGGCGGACGCATCCTGGACTCTGACCCCGCCCCTTCCGCTGTCGACACA
CTTCCGTTCCGGGTCTCGACCGGGCCGTGAAGAGCTTTGCATTGTGGGAACTCCTTCCTT
TCTCTCTCCCCGGCCATCTTGGCGGCTGCTCTTGGTGAGTGGCTCCTTCGGGCCAAGCTT
CAGGCGTCGCGGGCTGCCCTTTGGAGCCCCGAATTCTGAACGCCCTGTCCTGTCTCCTAC
ACGCTCTAGGTTGGGGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCGAAGAAGA
CGGTGAGTAGTGGAGCGGGCCGGGGCCGGAAGCAGGTTCACGTGGAGAGCCGGGGCTCGG
CCGGGCGGGCAGGTGTGAGCAGGCTGCGGGCTCGGCGCCGTCGCGGGAGACCCCCGACAG
GTCGCCTTGATGACTTGGGACCCTCGAGTTCCGCAGCTTCTTTTTCTTTTCCTATGGGAA
GGAGTCTGGCTTCCGAGAAGCTGGCTCCAGTTTTGAAGCGGCTGCCGGCAAGATCTTGAA
GTGAGTGTGGGATGTTTGCCTTGTAGAAAAAGTCGCTGGAGTCCATCAACTCGAGGCTCC
AGCTGGTGATGAAAAGCGGGAAGTACGTGCTGGGATACAAGCAGACTCTGAAGATGATCA
GACAAGGCAAAGCCAAGCTGGTCATCCTGGCCAACAACTGCCCTGCCTTGAGGTGAGCGG
ATCAGTCCGTCCCGTCCGGCGGTCCGTCCACGGGGAGTGTGGACTTGCAGCTGGGCCACG
TGAACTGGGTTTTAGGTGCGATTTGGTTTCTCCGGGCAACACTGGCAAAGCGCATTAAGA
ATGCTTGGCTCTTAATTCTGCTGCCTCCCCGGTCACATTCTCCCAAGTGTAAACTTGGTG
CTTGTGGGAAGTGCCGGCGGAAGAGAGAAAAAACACACAGAACCTCAGGACTTAGCAGGG
AAACACGCATGATCCATGCTTCTCTTTAACTTTGAGGTACTTTAAATTTTTTATTTTTTA
TTTTTTTTGGTAGAAAAACTGAGGTTTGGGCTTAGAAAAGCCGATCATCGTAAAAATAAG
TCGCTTTGTTCTTCCACTATGTTAATGTACGGAGCCAAGTTTTTTTTTTTTTTTTTTTGC
CTGATCCACTGTTTTTGAATTTGAACTCAGGGTGATGCTAATACATTAAAAAAAAAAAAA
AACATGGACTTTACAGAAGAGTGGTAGGTGTCCGACTTGTTCTGCAGCGTTTTAGGTGGG
AGTCCACATCACTGATAAACCTTGCAATGTGCTGGTTCCACGCCATTTGTTACTTATGTA
CCAGATCACTGCTCCTCTGGTTTACCGGTGGTACAGGAGATTGAACCTGCGACTCTGTAG
CCTGAGGTTTGAGACCCTCTGCATGACCATTATGCTATCTACCCAACCCTCCTGGTTTGT
TCTGACTACTGGTTTTGAGACTGGGAGACCACAGCACCAAAGTCTCTTAATGCAGCAGTG
GCCGGGCTCAAGCCTGAGTTTCACACATGGCACAGCAGCACACTATCCAAGTGAGCTGTT
TTGCCTGCCGATCTCTCATTTTAAGCCTTTAATGTCTTGTCTGCAGTAGCCTTGCTTGTC
AAATTATGCATATTAGTAATTATGCATAATCGTGTGCTTTGGTTAAAAGGCTGATCCGGC
GACTGCATTTTTAGCAAGTGTCTGGTGACATCTGGGCTTGTGCCATCCATCCACTTGTGG
TGACATTGGTGCTGTTAGGATTTTGAATTTGTGAGACTGTCAGTATTTATTATTATTATT
ATTATTACTGCTCAGCTCTGGCTTATGGTGGTGTGGGGGGATTGAACCTGGGATTTTGGA
GCCTCATGCATGAGAATCTGTTTGCATAGCCACTCTACGATCTACCCTCCATCCTCTGGT
CATATGCTTTTTGTACCATGAGTATGTTACTGTGTTAAGCAGATCTTTGGTAGATAATTG
GTTTTCCTTACTAAGGAGTCTCAAGAAAAGCATGATTAATATTTGTAGAGGACATGTGCT
TAAGAGCAATTTACTTAGAACTGCTTTAAGTCCTCACCAGTTCAAAGCTAGTGTGTAGTA
GTAACCTGTAGTTATTAGTTACTTAAGGTTTTCATTTTATGCTTCTCAAAAGGAAATCAG
AAATTGAGTACTATGCCATGTTGGCCAAAACTGGTGTTCATCACTACAGTGGCAATAATA
TTGAATTAGGCACAGCATGTGGAAAATACTACAGAGTCTGCACACTGGCCATCATTGATC
CAGGTAAGCTTTTTAAACAAAATACAGGCCCCCACCCCACACACACCAAGTACAGAAATA
CTTTTGTTACAGAAATATTTTTGGTTCCTGAGTTAAGTTAGTGAGAATTTGGATCAATGG
AAAGTGTATTGTTTTCATATTATAGAATTGATAACCTCAGTGCATTATGATCAAATTTGT
CACAAGCGAATTTACTTTGAGATGATGACTTTCATTTGAAGCAACTAAAATGACAAAGTC
AGCTTACTAAACGGATTTAAGAAAGTACTTAGGAAAAAAAAGTACTTAGGAAAAAGTGAA
ATTAAATGGGAAGAGTATGTATTTCTGGTTGTCTGAGTAGACATTGGGTTGAGCAAAAGA
AATGTCTTCTAAGAACATAATGTGTTGGGAACTTACACTTATTTACTTAATAATAATAAA
ATACTGCGAATATTCTCGCTGTTCTGGTTTTATAATGATCAGGGCAGGCTAACCATTCGC
TACATTAAGACCACGCATGTGTCCCCAGACCTAGTTCTTTACCTAGTTCTGGCTATCTAA
ATGCGGGTGATAAACCAAGTCTGATTGATGTGCCTGACATACGAAAGGTCTGTGCTAAAT
CTAGGCATCTTGATCAATCTAGAGGAGTGATGATACATAGCTACTATAATGACGTGTGGA
AATAAAGCCACTAATCTGGTGATTGTCTGTTGCCACTAAGTCAATTTTAAATTTGTTGTT
TTATCTTGTAGGTGATTCTGATATCATCAGAAGCATGCCCAGAACAGACTGGTGAAAAGT
AAATCATGCAAAAATTTTCTGTAATAAAGTATGAGGAGGTTTTAAAAGTGTTGTGCTTAT
TTTATTTCTTTATATCTTATATTTTTCTGAAGATAGACTAGGCAAGACTTTGGGGGAATT
AAGAACTACAACGTATTAGTTTCCATGTGCTTATAAGATATTGGTTTTTATAACTCCACA
GTGTTGCTTGGTATGTGTTTGAGACAAAATTCAGTACCTAGTTTAACTAGTACTGCAGTT
TACAGTTAAAAGTCCCCGTCTTTGTGGCAATGAGTATTAAATGACCTGTTTTTCCTCACT
CAAATTTTGCTACAGACTGAGACACTTTAATAAATTTGTGAAGGGAGATCCTTCCTAGAG
GTGTGTGGTTGAAAATTGTACTTGTATAATAAAAATAAGAAATAAAAACCTCACCCACAA
AGTTAACAATTACATAAATAAAATAACTTTACAAATAAAAGAGAAAATTGTACTTGTGTC
TAGAATAATCATGAGCTCAGTGGCTAGAATAATTAGATCTTAAAGAAGTTCATGATTGCC
CAAAAAGGTGTTAATGGTGTTATTTTAGTCATAAAGGACATAGTTCTTTTTTTTTTTTTA
ATTATTGATTTTTCCCTTTTGTTACCCTTGTCTTTATTGTTGTAGTTATTGATGTCGAGG
CGGGGGGGGGGGGAGGGAAGACACCTGCAGACCTGCTTCACCGACTGTGAAGCAACGCCC
CTGCAGGTGGGCATCTGGGGCCTCGAACCAGGATCCTTAGGCTTTGTACCACATGCGCTT
AACCTGCTGCGCTACCGCCCGACCCCCATAAAGGACATAGTTCTGCAGCACCTTCAGTTC
ATTGTTTTTTGGGGCGTATTTCACACTCAGTTTAGTGTTGGCCCTTAAGCAGGCAGTGCT
TCCTAGGACTTGTCTTATTTTTATTATTTTATTTTTTATAAAAAGGAAACTGACAAAACC
ATAGGATAAGAGGGGTATACCTCTACACAATTGCCACTACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1286..1431, 2872..3002, 3731..3756, 3758..3781
1001..1021, 1286..1431, 2872..3002, 3731..3756, 3758..3778
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved