Erinaceus_europaeus Locus HSPA9B
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus HSPA9B
Erinaceus_europaeus
HSPA9B
GeneScaffold_2362
SNORD63
19856..19929
28808
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTC
ATCGATTGCCTGCAGGCGGTGCATAGGCCCCGCCCTCAGCAACTGACGCAAGAAGACGAT
TCGGTTCGCAATTTATCCCGTGCGACCTTGAGTCTTTCCTTCCGCCGAGGGCCCGAGTTG
TCCAAAATAATGCCTTCCTACCTCTCTTAGCACTCTCGCTTCTCACTGATCCCAGACCTG
CGGCAGACAGGACGAGAGAACGTATCTTTTTTCTCTGACATACTAAAAGAGACTTTCATC
TGTTCGCGCAGTCTCCGAGAGGGAAGGACAAGGCCGTCTCTGCTCAGGCAGAGCGGCAGG
TGCCTCAGCGGAAGAGCGGGCCTCTGGGTCTCAGTGACCAGCCCCCGCCTCCATCCCACG
TGGTTGGAGACTTCCAGAAGCGCTGCTACCAGGGTGCTGCTGCGCAGCTCCCGGCTCTCG
GACCGCCTGTCTACTGCCGGTTTCCCCGCCATCTCGCCGCCATGATAAGCGCCAGCCGAA
CCGCAGCAGCCCGCCTCGTGGGCGCTGCAGCCTCCCGGGGCCCCGCGGCCACCCGCCACC
AGGTAAGGAGCTGCCTGGCCTCCGCCGAGGGGCTCACGGCCTTGGGCCTCCGTGGGGCAG
GCCGCGTCCTTCGGGGTCATAATTGTCCGCGAGGAATCGGGAGGGAGAGAGGTAACGGGT
CTCCAGCCATCGGCGCGGTCGGCTCAAAACCTAGTACAGGGTTTGGTTTGTTTTTTGTTT
TTTTTTTCTTTTTTTACCTGCACCTCTCGGGCCTTGCTGAGTCACACCCCTTTGTGGTCC
CGGTCTTCTCCAAGAAGTAACGGAGCGTGGTCCTGTGTCAGATTTAGGCAGGCTTGGCTT
GGCGGCACGGGAGAAGTAGTCTGTTGGGGAGAGAAACGCTATTTTAGTTAAAATTCACCA
AAACGCCCACGAGTCGAAGGACACTTGTTCTTTCTTCCAGCAAAATTAAGACCCCCGTGG
CCGTGATGAAAGGCAGGAAGAAGAGCACCTAAATAGCAGGTTATCCATCAGACTCCCTAC
TTTATTGTTTAAGAACATTTATCAAGTTCTCCAGAACCTTTGGTTTTAAGATTGTTGTTT
GACCTGCTATGTTACTTTACAAACATGTATGTCGGGCAGGTGAGGGCCAGTTAGCGACCG
CTGATTCTCAAGACTCAAAACATAACGGAGAACAGAAGTTGTGTAGAGTCATGCAGAATT
AAAGGAAGGCTTGGGAGTATCCTGAGGATAATGATTTTTTTTTTTTCCTTTCTATATTTA
CGACTCTGTCCAAGATAGACGGAGAAAGAAAGCTAGAGCTACCACCATAGGACATGCACT
GCTTGGTACTGAACAGACGAACCTCAGGCTTGATAAGTTTAGCACTGTAGTTAGGCCACT
GTACCACTAGCTGGGCTGCCTAGAGTAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTTGTGTATACTCAAAAGAA
TGGGAATGAACCTGCTTAAATTTGTATAATGTAATTGCTTTTCTTTTTTAGGATGGCTGG
AAGGGCCTTAGTCATGAGGCCTTCAGAATTGTATCAAGAAGGGATTATGCGTAAGTTTAA
CTATTTCTTTTCTTATGTAAAACATACCTTAAGGGCAGGGGTAGATAGCATAATGATTAT
GCTACCAGTGTGGGAAGAATTGTTAAGGTGTGCATCCCCAGTGATAATTGGGGGGTGGGG
CTCACCATATAGAGTTCACATTGCCATGCCCGGTAGTGGCAACTCAAACTCAAGCTCCCC
GGGCCCTACCTGTCATGGGAGGGAGCTTCACAAGAGGTGGGAAATGATGCTTTTTTTTCC
TCTCTCTCTCCCTATTTCTGTCTCTGCTCCTCTTATCAGAAAAAATAGAGAGAAACTTAC
CAGGAATGATGGAATCATACTGGTAATAATATATATGTGGTTATTCTTAGAAAAATTACA
CTGTAAATATTTAAAGACTATATAACATGTTGCTATTACTGTGTCAGATAACCTAGTCAT
TTTACAGACTGCTATTGGGATAACAGCATTTTAGATTTTTCTTTTTTAATATTTACTCTC
TCTTGTTGCCCTTGTTTTTTATTGTTGTAGTTATTATTACTGATGTTGTCATTGTTGGAT
AGGACAGAGAAATGGAGAGAGGAGAGGAAGACACCTGCAAACCGGCTTCACTGATTGTGA
AGCGACTCCCCTGCAGGTGGGGAGCCGGGGGCTCAAACTAGGATTTTTACGCCAGTCCTT
GTGCTTTGCACTACATGCGCTTAGCCCGCTGTGCTACCACCCAACTCCCATATTTTAAAT
GTTTTACAGATCAGAAGCAATCAAGGGAGCAGTTGTTGGTATTGATTTGGGAACCACCAA
CTCCTGTGTGGCAGTCATGGAAGGTAAACAAGCAAAGGTGAGTGTGGTTGGAAGATCTGG
CATAAGTAGTGGTAGCAAGTACGCAGTTCAATTTTCTGACTTAATGAGAAACAAAAAATT
ATTTGTTAAGAGAAACAACACATCACTTTGGTACATGAGGAGGGGGGTTGAATTTGGAAC
GTCACACTTTTAAGTTCAGTGCTCTAGCCATGGCTCCACCTCCCAGGCCACAAATAAATG
GTGGTTATTTCTGGCTTTGTTTTACCAGAACACTTCCCACCTTTGGTTTAAGGTGGTGCC
AGGATTGAACATAGAACCATGGAGCCTCTGGCATGGAAGCATGGGAATCTTGCATAACTA
CTGTTCTCTCTCTCCTCCCCCCTTTTAGTTTGAACTTTTTAAGACTCTTTAAAGGTGAAC
TTTCCTGCTTAATTGTTTGTTGTTAATGTGTTTCTCAGCATTTACGTGTATCCTCTTAGT
CTAAAGTGCACTACCCTTAATACCTATTGGTGACTCGAGGTATTGATAATTTAATCAAGT
TCCTGTGGGTTAGACCAGCTTACAAAAAAAAAAAAATGAAGCTTTGTATAAGGCATGGGG
CACATCCTAAGTGAAGTGTGTAGCAGCTCTGCTATGGAAGATTATAGTCTTAGTGAGGTC
TTCTTAGTCTGTTTATGGAATTTTCCTTATTGGGTTCTTTGCAAGATTAGAGTACATGAT
GCTGTTGTCCTACTGCTTAGCTCCTTTAGCTTTTTTTCCAAAATGCCTGAGAGTTGTAGC
CATCACAGAATTGTAAGGTTTTTTTAATCAGAGCACTGCTCAGCTCTGACTTATGGTGGT
GCAGGGGATTTTACCTTGCACTTTGGCGCCTCAAAGCATGTAACTTGGCATAGCCATTAT
GCTATCTACCCATGATTGTAAAATTTTAATTCTTCATGCACGAGAATCAACTATGAAAAC
TGGCCAACATTTATTTCTCCCATTTTGCCTACAGTCATAAGTTTTCAAAGTAAAGGATGA
AAGTTTTTATTTATTGGGGGATTAATGTTTTACAGTCAACAGTAAATACAATAGGAAAGT
GTTATTCTTTGTTTTTTGCCACTAGGCTTGTCACTGGGGCACAGTACCTTCAAAATGAAT
AATCCAATTCCTATGATGGCCTTTCTTTTTTCCTTTTCATAGTGAGAGCAGTTGCTACAA
CATTGCTTCACCATTTATAGAGCTCCTCTCCTCTTGCCCCACCCAAGTGGGGACCAAGAG
CTTGAACCGACTTCTTTGCACATTGTAATGTGTGTACACTCTTGTCTTGGTTGATTATAG
AGATAATGGGTAGGGGGCTGGGTGGTGGTGTACCTGGTTGAGTGTACATTTTATAATGCA
CAGGGACCTTGATTTGAGCCCCTGGTCCCCACCTGCAGGGGGAAAGCTTTGCAAGTGGGT
GAAGCAGTGTTGCAGGTGTCTCTGTCTCTCTCCCTATCTCCCCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATTCTTCTGAGGTCATT
AACTTCCACACTCAGTGTCCTTTGAATGAGCTCTTGATAACTTCTAAAGGCAAAACTTTG
TTAAAATGCACTTGTCCTTACTGAATTAATCTTGGAAGTTTTCCTTTAGGAAAACTTGTC
TTTTTGTTGTTTTGTTTTTTTAGTTATTCCCTTTTGTTGCCTTTGTTGTAGTTATTATTG
ATGTCATTCTTACTGGATAGAACACAGAGAAATGGAGGAGGGGGAGAGAAAGATAAGACA
CCTGTAGACCTGCTTCACTGCTTGTGAAGCAACTCCCCTGCAGGTGGGGAGCCCAGGCTA
CCACCCTCAACTTTTTTTTTTTAACAAGAGCACTATTCAGCTCTGGCTTATAGTGCTGCA
GGGGATTGACCTGAGACTTCAGACCCTCAAGCTTAAGGGTCTCTTTGCATAATCATTATG
CTGTCTACCCCGATTTATTTTATTTTATTCATTTATTTTTTGCCTCCGGGGTTATCACCT
GCACTACGAATCTACTGCTCCTGGAGGCTATTTTTCCCATTGTGTTGCCATTGTTGTTAT
TGTTGCCATTGCTGCTGTTGTTGGATAGGACAGTGAGAAATTGAGAGAGAGATAGACAGC
TGCAGACTTAATTCACCGCATGTGGAAACTGACCCCCACCCACAGGCAGGTGGGGAGCTG
GGGGCTGGAACCAGGATCCTTATGCCAAACCTTGTGCAAGTTTCCCCCCCCCCCCTCCAG
TAGAATATCTCTGGATCCAGGTGGTGGTGCGCCTGTTTAAGTGTACACATTACAGTGTGC
AGAGGACCTGCGTTCAAGCCCCCTGTCCCCACTTGCAGGGAAAGCTTCACAAGTGTTGAA
GCAGGTTTGCAGATGTCTTATCTTTCTCCTCCCCCATCTCCTTCAACCCTATAAATGTCT
CTGTCATATCAAACAAAATAAAGGTAAAAAAATATGTAACGGTGGTCCGGGAGGTGGTGC
AGTGGATGAAGCGTTGGATTCTCAAGCGTGAGGTCCTGAGTTCAATCCCCGGCAGCACAT
GTACCAGAGTGATGTCTGGTTCTCTCTCTCTCTCTCTCTTTCTCCTTCTATCTAAGAAAA
AAAAAATACGTAATGAAATTTTTTTAATAGCATTCTTTTAATTTTTATTTAAAGATTTTT
TTAATATTCTTTTTTGTTACCCTTGTTTTTTATTGTTGTTTTTATTGTTGTTACTGATGT
TGTCGTTGTTGGATAGGACAGAAATGGAGAGAGGGGAGGAGACCTGCAGACAGGGAACCA
GGGTCTCAAACCGGGATTCTTACACTGGTCCTTGTGCTTTGCTCCAACTGTCCTTAACCT
GCTGCACTACCACCCGACTCCCTAAAAAATAGCATTATATAGTAAAAGTTAAATAATAAG
TATCAGATAACTGGCTTTTAGGACTTAGCTAAAAGTGGATTCAGGGTTCTTTGTTGACAC
ACACACATTTTTGCCTATAGAAAGGGAGAGGGGAAACATTGGCACTGTTCCACCACTTTG
CAAGCTCTGCCCTGCACTGTGGGGACCACTGGATTGAGGCAAGCTCCCTGCACATTATAA
TGCATATGCTTTGCTGAGTAAGCCACCCAGCCCTCAACCAGTGTCTGTAACTGGAAGTAT
TTCCCTACAAAGTCTCTACATGTTAGGTCACGTGTGGAAAAACTGTCTTGAAACGAGAAT
ATTGTTAGTGGTTCTGTCTGTTTCATCTGACACAGTCCCATGCTTGATCTTCATTCTTCT
TTTTCAGAAAATTACTTAGGTCATACAGCAAAAAATGCTGTGATCACCGTCCCAGCTTAT
TTCAATGACTCACAGAGACAGGTAAGTTCAATAAGTACCTTTTTTTTTACCCCTCCAGGG
TTATTGTTGGGCTCGGTGCCTGCACCATGAAGCCACCGGTCCTGGAGGCCATTTTTCCCC
CCTTTTTGTTGCCCTTGTTGTAGCCTCATCGTGGTTATTATTATTGCCATTGTTGATGTT
GTTCGTTGTTGGATAGGACAGAGAAATGGAGAGAGGGGAGGAAGACGAGGGGGGGGGGGA
ATAGATACCTGCAGACCTGCTTCACTGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCC
GGGGGCTCGAACTGAGATCCTTACTCCGGTCCCTGCGCTTCGTGCTACATGTGCTTAACC
CACTGCGCCACCGCCCAACCCCCAATAAGTACTCTTCTTAAGGAATTTTTATTTTCTCTA
GCCACTAAGGATGCTGGTCAGATAGCTGGATTAAATGTTCTCCGAGTGATTAATGAGCCC
CACCGCTGCTGCTCTGCCCTATGGTCTAGACAAATCAGAAGACAAAATGTAAGTCTGTGC
ATTAAACTCCTCTCTAGATTTATAAGAACTTGGAATTATCATTTAAGTTTCTTAGTGCCA
CATTAAGCCAGAGCAGAGTAGTGCTGTGGTGAGGAAAAAACATATGTACTGCTTTGATTC
TTTTTTACCTCATTTTAAGTTCATTTTATTAATGTATTTTCATGAGTTTATAATTTGGGT
GTATGCTATTATATCCCCCCCCATGTTTGTGCACACACCCCAGGAGAGGGGCTTGGTGCT
AGCACTATAAATCTACCTATCAAGGTGGGGTTTGTTTGTTTTCTTATATTTGGTAGGACA
GAGAAATTGAGGAGGGACAATGTCTTACTGTTAAGCACACATAATACAAAGCCCAAGGAA
CTGGGTTCAAACCCCTGGCTCCCCATCTGCAGGGGAGTCACTTAACAACCGGTGAAGCAG
GTGTTTCTCTGTCTCCCTATCTCCCCTTCCCCTCTCAATTTCTGTCCTACCCAGTAAAAA
TGAAAAATGGCCCCCAGGAGCAGTGGATTCATAGTGCCAACACCAAGCCCCAGCAGTAAC
CCTGGAGGGGAAAAAAACAACCCTAAAAGCAACTGAATGGTCAGATGTTTATACACAAAA
AGAGGAGAATAGAGAGAGACCAATACCTTCAGGCCTGCTTCATGAAGTTTTCCCCCTTTC
AGTTGTGGAGTGGGGTCTTTAACTTGGGTCCTTGCACATGGTAATGTGTGTGCTCAACCA
AGCAAGCCACCACCCAGCCCTGCTATTTCTTTTACACCCATTTACTTTTCTCTTTAGTTT
GTCTTGGGATACTGTGTTCTCCAGACCTCCTGATTATTTTTAATAATTTTATTGGACCTC
CTGATTATTTTTTTAATAATTTTATATGACAGGACAGAGAGGCAGGGGAGCTAAAATAGA
TACCTACAGAATTGCATAAACTGCTCATGATGCTTGAGGGGAAGGAACAAGGCCTTGAAC
CCAGACCTTGCACATGGTAATGTGTGCACTCTGCAAGGTGTGCTACCGAAGTTTTTAAAG
TTTTTTTTTTTTTTTATTGTTACTTTATTTTTGAGAGAGATACAGACACACACACAAGCA
CCAGAGCACTACTCAGCTCTGGCTTATGATGGTGCAGGGGATTGAACCTGGGACTTAAGA
GCCTCAGGTATGAGAGTCTGTTTGCATAACCATTATGCTATCTCCCCCAACCTTAAAATA
GGATTTTATTGGGGATCGGGCAATAGCGCAGCAGGTTAAGCGCATGTGGCGCAAAGCGCA
AGGATCGGTGTAAGGATCCCGGTTTGAGCCCACAGCTCCCCACCTGCAGGGGAGTCCCTT
CACAGGCAGTGAAGCAGGTCTGCAGGTGTCTTCCTCTCTCCCCCACCCCCCGTCTTCCCC
TCCTCTCCATTTCTCTCTGTCCTATCCAACAATGACATCAATAACAATAATAGCTACAAC
AACAATAAAAAAGATGACAAGGGCATCAAAAGGGGCAATAAATAGGGTTTTATTGGGGTG
GTGTTGTGGCTCACTCAGTAGAGTGCATACATTACCATACATGGGGACTTTGAGCATGAG
CACAAGTGGGTAACTTGAACAATCGATGCTGTTGTTTGCTTTGATACAGAAAGAAAAGTA
GAAAGATGCTGACAGTACTACTTCACCAATTGTGAGGCTTCCCCTCCTGCATGTGGGGAC
TGAGAGCTTAAACCCAATTCCATCTCTTCCTCTCCATTTCATCCTCATTTTGTTTTTGTT
TTGTGTGGTTGTTTTTTTTTTTTTTTTTTTTTTGTATTTTATTTACTTTATTTTTGAGAG
AGATGCAGAGAGAGAAAGACACAGAGGCAAATATCAGAGCACTGCACAGCTCTGGCTTAT
TGTGGTGTGGGGGATTGAACCTGGAACTATCTACCCCCACCCCTCTTTTTTTTTTTTTAC
CAGAAACCAGAGGAGAGATAAGTTACCCAAGAAATAGAATATATTTTATCGCATTCAGTG
ACCTTGTCTTGAACCCCAGCACCACATAGGAGATGGAAGCACCATGCACAGGGAAAGCTT
ACCAGTCATTCTGTTGTGATGTCTCTCTTCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGAATTA
TGTTTTGTGAAAAGCTGTCTGACTGAGGTGCAGTAGAGTTTGGGATAAGTGGGGGCAGGT
ATCTGTGGTAAGTGCAACCAGAGTAAAGTGGCAAAATGTTGGTAGTAGATCTTGGAATAA
ATGGTGGAAAGATAACTGGTTGGACTTGAGGGAAGAGACAAGTTTATGAACTGACTTTGG
AGGATTCAGAGTCCTGCGGTTTTTGAGATTACCATTAACTCTGCAGTATACAGAACTACA
ATAACACAGTAGTCACATATGCATATTTAAAATTAAATTTAAACCCATTCCCTGTTTGTA
CCAGCCATAATTTCAAGAGCCTGACTATATGTGGTTAGTAGCTGCGGAATTGAATAGCAC
ATATAAACCACAACACTGGCTACTGGTGCCAGGGAGTAAAACAAGGCATGCGTCCTGCAT
ACATCTGCCACCACACTGTTTCCACTATCCAACCATGTTATTTAAACAATACCCGGTATC
ACAGTTTATAAGGAAGGTTGTGTTAACTTTCACTATTAAGTATTTAAATGTCATGAGTAC
CTGAAGAAGAGTGTCTAAGGACATTCTTGCCATAGTCTTTGTTCTCTACAGATCTTGACT
AAGTTATCACTGGTAACTAAACTCAGGGTACCACCACACCATCTACTTGCAGTGCTGCTT
AGCCGCTGCCTCCACCAGAACCTCACATGTGCACTTTCACCATTCCAAAGAGTTTTAAAA
TGCCAGTGGGGGCAAGCATTGTGTATCTCACATAAAATTAGTTTAATTCATGGGGATGAT
GGAATGTGTAGAGCTTAACACTGACCCTCTCTGTTTCTTTCAAAGTCTTCCTATCATAGA
ATATAGTCTTAACTGAAGAACTTTCCCTGCTTCCTTTGCAGACTGACATCAACTTGCCAT
ATCTTACAATGGATGCTTCTGGACCTAAGCATTTGAATATGAAGCTTACCCGTGCTCAAT
TTGAGGGAATTGTCACTGATCTTATCAGGAGGACCATTGCCCCATGCCAAAAAGCCATGC
AAGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTTGTTGGTGGCATGACTA
GGATGCCCAAGGTATGAACTTGGGGGAATTCTTGGCATACGTGGAGAGCCAAGAGGGTGG
CAAATTCTGTTTTCTTGGGAAATTTCTTACGTTGTACAGAGGGATGGTATGCTGTATTTT
TTTACACCATCTTTGGGGGTAGGGGAGAGTGAAGATAGCCCTCTAAAGAGTTATTTTCAG
TCTCTTTAAGTCTAAGAAAAAGAATTAGGAAGGGTAGAATGTCTTTGAAATATTAACAAG
AAACTTGCATTTCATTCTCAAATTTTAAGTTCAGGGTCAGAGATAGTTTAAAAAATCTTA
GTTTGTGTGGAGTTGTACCCCTCCTACCCTATGGTTTTGTTAATTAATAAAAAAAAAAAA
AAGAAAAAAAAAATCTTAGTACTGGGAGTCGGCGTGGTAGCACAGCAGGTTAAGCACAGG
TGGCGCCAAGCACAAGGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGAACCTGGAACTATCTACCCCCACCCCTCTTTTTTTTTTTTTACCAGAAACCAGAGGAG
AGATAAGTTACCCAAGAAATAGAATATATTTTATCGCATTCAGTGACCTTGTCTTGAACC
CCAGCACCACATAGGAGATGGAAGCACCATGCACAGGGAAAGCTTACCAGTCATTCTGTT
GTGATGTCTCTCTTCAGTCTCTTGATATTGAAAGGGAAGGGAGGGAATGGGGAAGCAGTG
CTGGGAGCAGCAGAATCATGTAGATAGAAAAAGCCCTTGTGCATCAATAACTACATCAAT
AAAACAGCATGGGCAACAAAAGAGATTTTTTTTTTTTTTAAGAAGCTCCTGCAGTGAACA
AAAGTTTGGTTTTAATTGTGTTTTGTAACTGGATTGTATGTTAACCCACATCACCTAGTA
TGTTGCCATATTTCATAATTATACTTTAGAAGAAATGCCAAATAATGGTTGTTTAAGTTA
AACCCCCTCCCTTTTTTTCCCCCTAGCATTGCTGTATATGATTTAGGTGGTGGAACTTTT
GATATTTCTGTCCTGGAAATTCAGAAAGGAGTTTTTGAAGTGAAGTCTACCAATGGAGAC
ACTTTCTTAGGTGGTGAAGACTTTGACCAGGCTTTATTACAACACATTGTAAAGGAGTTC
AAGAGAGAGGTTAGTTACCAGTGTGGTTAACATGTAGACTTTGAGATATTTTAACATTGT
TAATTCAAATTACTATTAGATTTGTTTAGATTTTTCCTTCTTTAATAAGACTGATGTAAT
TACATTTTTGTCTCATGAATAGAATGATTCTAATGTAGTTTCAGGTCAGGAACAAGCAGA
TCAGAGGAATATAACATTTCTGCAGTTTAGGAAGGAACTCCATTATTTGAGCGAAAGTCT
TTTGCCTTCCGTAGCTGAAATCTATAGATAGGTAAAATGACATTTCAGCCATGTGACTCA
AAGCACAGATATCTTTTTTCATAATGAGCATTTTCTGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGCACTTCTGTTTAAGTGCACACACTAC
AGTGTGCAAGGACCCAGGTTCAATCCCCTAGTCCCCAACTGCAGGGAGAAAGCTTCACAA
GTGAAGTTGAACTGCAGGTGTCTATACTTGCCTTAAAGATGCTGGTATTCAAATCTAGCC
TAGCATTAGGAATATTAGAGGAGCTGTTGCTTCCATATAATTCAAGACATCTATTATTAA
TCTTTTGTTTAATTATTTGGATGACCAATCTAGAAAGTGAACAATGAAACCAGAATACTC
ACTGGGGCTTTATGCCTTTGCAGTTTTTCCTCTAGAAGCCATACATGTAGGATTTGATGT
TTTCCCTGAAATAAATGGATACAAATTATTTAAGAAAGTCATAGTTACCATGGCAGGAAT
TATGTTTGTGAAAAGCTGTCTGACTGAGGTGCAGTAGAGTTTGGGATAAGTGGGGCAGGT
ATCTTGTGGTAAGTGCAACCAGAGTAAAGTGGCAAAATGTTGGTAGTAGATCTTGGAATA
AATGGTGGAAAGATAACTGGTTGGACTTGAGGGAAGAGACAAGTTTATGAACTGACTTTG
GAGGATTCAGAGTCCTGCGGTTTTTGAGATTACCATTAACTCTGCAGTATACAGAACTAC
AATAACACAGTAGTCACATATGCATATTTAAAATTAAATTTAAACCCATTCCCTGTTTGT
ACCAGCCATAATTTCAAGAGCCTGACTATATGTGGTTAGTAGCTGCGGAATTGAATAGCA
CATATAAACCACAACACTGGCTACTGGTGCCAGGGAGTAAAACAAGGCATGCGTCCTGCA
TACATCTGCCACCACACTGTTTCCACTATCCAACCATGTTATTTAAACAATACCCGGTAT
CACAGTTTATAAGGAAGGTTGTGTTAACTTTCACTATTAAGTATTTAAATGTCATGAGTA
CCTGAAGAAGAGTGTCTAAGGACATTCTTGCCATAGTCTTTGTTCTCTACAGATCTTGAC
TAAGTTATCACTGGTAACTAAACTCAGGGTACCACCACACCATCTACTTGCAGTGCTGCT
TAGCCGCTGCCTCCACCAGAACCTCACATGTGCACTTTCACCATTCCAAAGAGTTTTAAA
ATGCCAGTGGGGGCAAGCATTGTGTATCTCACATAAAATTAGTTTAATTCATGGGGATGA
TGGAATGTGTAGAGCTTAACACTGACCCTCTCTGTTTCTTTCAAAGTCTTCCTATCATAG
AATATAGTCTTAACTGAAGAACTTTCCCTGCTTCCTTTGCAGACTGACATCAACTTGCCA
TATCTTACAATGGATGCTTCTGGACCTAAGCATTTGAATATGAAGCTTACCCGTGCTCAA
TTTGAGGGAATTGTCACTGATCTTATCAGGAGGACCATTGCCCCATGCCAAAAAGCCATG
CAAGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTTGTTGGTGGCATGACT
AGGATGCCCAAGGTATGAACTTGGGGGGAATTCTTGGCATACGTGGAGAGCCAAGAGGGT
GGCAAATTCTGTTTTCTTGGGAAATTTCTTACGTTGTACAGAGGGATGGTATGCTGTATT
TTTTTACACCATCTTTGGGGGTAGGGGGAGAGTGGAAGATAGCCCGACTAAAGAGTTATT
TTCAGTCTCTTTAAGTGGAAGAAAAAGAATTAGGAAGGGTAGAATGTCTTTGAAATATTA
ACAAGAAACATGTCTTTCTTTCTCAAATTTTAACATCAGGGGCAGAGAAAGTTTAAAAAA
TCTCAGTTTGTGTGGAGTTTTACCCCTCCTACCCTATACATTGTTAATTAATAAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCTTCTCTGTC
TCCCTCTCCTCTCCATTTCTCTGTCCTATCCAACAATAACAACATCAATAAAAACAAGGG
CAACAAAAGGGAAAATAAATATTTTTTTAAATCTTTTTTTTTTTTTTTTTCCAGTGCTTT
ATCCACTGCGCCACCTCCCAGACCACTTGAACCAGGCCCTTTACGCTGGTCCTTGGGCTT
TGCACCACCTTGCGCTTAACTGGCTGCGCTACCACCCAACTCCCGAGGGATTTTTTAAAT
TTTTTATGACAGAAGTTTAATTTGTTATGACCCCCCAACAGGACTTTGGGACTGTTAGCA
TATGAATGATGTCAGCCTGAGGAGGTGTGGCAGAGAAGGGAATGTATTAAAAGCACTGAC
TTGGAGCAGGTCTCTCTCTCTTATTTTTTTAAATCTTAGTACTAGTGGTCTGGGAGGTGG
CGGCAGTGATAACGTTTTGGACTCTCAAGTATGAGGTCCTGAGTTCGATCCCCAGCAGTA
CCTGTGTCAGTGATGTCTGATACTTTCTCTCTCCTATATTCCTCATTAGTAAATAAAATC
TTTTTTTTATCTTAGTACTGGGGAGTCGGGTGGTAGCACAGCAGGTTAAGTATATGTGGC
GCAAAGCGCAAGGACCAACCTAAAACTTGTGACCCCCAAGGGGGGGGTCACTTTACAGGC
GGTGAAGCAGGTCTGCGGGTGTCTATCTTTCTCTGTCTTCCCCACCTCTCTCCATTTTCT
CTCTGTCCTATCCAACAACGACAACATCAACAACAATAATGGCTACAACAATAAAACAAG
GGCAACAAAAGGGAATACATGTTTTTAAGTCTTAATATTAGCACCTATGAGCGATTTTTG
ACACGTCTGCAGCATACTGTTGGAAGTTTCTGCTTGTGTATCTTCAATGAAGATTTGTGC
AGTGATGCATTTTATTCATCAACACATCATTCTGAAAATACAGATGTGTGGAAAATTAGT
ACTGAGCACAGATCTGTTGAAGATGTTTTTGTTGTTTTGCCACCTGAGTAGAATTACATT
GGACCTTGATATTTCCTTGGTTTCTTCCTTTTGAGTATATGAGCTTAGAAAATAAACACA
GAGGGGGAGTCGGGCGGTAGCGCAGCGGGTTAAGCGCAGGTGGCGCAAAGCACAAGGACC
GGCATAAGGATCCTGGTTCGAACCCCGGCTCCCCACCTGCAGGGCAGTCGCTTTACAGGT
GGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCCTCTCTGTCTTCCCCTTCTCTC
TCCGTTTCTCTCTGTCCTATCCAACAACGACGACAATAATAACCACAGCAATAAAACAAC
AAGGGCAACAAAAGGGAATAAATAAATAAAATAAAATATTAAAAAAAAAAAAAGAAAAAG
AAAATAAACACAGAGCAAACTTGAGGGGGGGGAGGCTTTAGGTTAGGAGGGACATCCTTC
TGATAAGATAATCTCAGGTACTTTTGATATTAAAGTAGCATTTTTTTTTTTCGTGGTACT
GTAAAAAATTTAAAACTTGGGCTGGGCCAGGTAAGTCTCAGGCAGTAGCACAGCAGGTTA
AGCACAGAAGGCACGAAGCAAAAGGACTAGCATAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTAGAGGATCACTTCCCAAGCAGTGAAAGCAAGTCAGCAGGTATC
TTTCCCTCTCCCCATTTCTTTTTCCTGTTGTAGTTATGTCGTCGTTGTTGGATAGGACAG
AGAGAAATGGAGACAGGTGGGGAGAGAGACACCTGCAGACCTGCTTTCACCACTTGTGAA
GCAACTCCCCTGCAGGTGGGGAGCACAGGGGCTCAAACCGGGATCCTTAATGCTGGTCCT
TGCTCTTTGCACCACCTGTGCTTAATCCCATGTGCTACAGCCCGACTCCTCCTCCCCATT
TCTTTCTGTCCTATCCAACCGACGACATCAATAATAACTGCAATAAAAAGGGGGACAAAG
AAAGGGAATAAATATTTTTTTAAATTGGGCTGGGCGTAGTGCAGCGGGTTAAGCACACAT
GGCGCAAAGCACAAGGACCAGCTTAAACTTCTACCATCTTTTGTTCGGGTTTATCAACAC
CACAGATTTACTAAGTACATAAAAACCAAGGCACCAAAATAAGCACAAAGGGGAAGGTTG
GCTAGCCGTGTGGCATGCACCACAGCATTGTTGCCCAATGTCTATGTCTCATGGTCCATC
TTGCTTACCAAGTAAGACAGGTCCCCCAACACCTCCCCACTTTTAGTATAAAAATGGACA
AAGATGCGTAGAGTCTTGAGTGTCAAGAAGAAGCAAATCTTCACACTTCTGGGATTTACT
CTGTAAGCCCTGACCCTGTCTCCAAGAGTGTAGGCACAATACCTGGGTATCACATAAAGG
TTTCTTGTTCACCTAAGAGACCTGTTGGTCTGTCTACCTGTGTCTAACCCAGATAAGGCC
CAACACCCCTGGAAACTTAGAATAGAAACCAGCAGGGGTGGCCCTGGATTCAGTTGGTCT
CTGGGTGGTGATCATGGTGTTGAAGTATTGCATTAAGGCTTCAGCTTATTGTGAGGAGAT
TGCATAGGAGAGGCTTAACTGCTTTGGTATGGGTCCAAATAAGGCCTGTGAATGACAAAA
CTAAAAAAGGAGTAATCTTAACAAGCTTCAGTCACAAAAAATAGCTAGACAAATCAAGAA
CTCTAAAGTTACATCCACAGAAAACATTATTTTATTGAAAATGGGATTATTGCTGGACTT
GGTGCCAGTACTATGAATCCACCATTCCCTGGGGCTTTTATTCCCGTAATTGTCTTATTA
GATAGGACAGAGAAATTGGGAGTATGGATGGAGATAGAGAAGGGGGAAATAAAGATACCA
CTGGATAAGCATCAGCCCTGCAGGTGGGAAGCAGGGGTTTGAACCCAGGTCCTTGTGCTT
GGTAATCCAAGTACTTAACCAGGTGCACCACCACCTGGGCACTGTTTTAACACAATACAT
TTTTAGGTTTTTTTCTCATGGAAAGATTTCAGTAATCACAATAGTAGTGCACCAGCTAGA
GCAAGAATAGAAGCTCTGAAGAAAAGTGATGTTCAGCAGTTGTCTGATTGAAATTGCAAT
ACAAAAAGTTAAAATATATAAAGTTCTCTGTATTTTGTTTCTCTTTAAGAATTAGCATTT
TTGTGGCTAGGTGGTAGCACACCTGCTTAAGCACAGGACCCAGGTTTAAGTCCCTGGTCC
CCTGTATGCAGGGAGAAAACTTCACAAGTAGTGGAGCAGCGCTGCAGGCTTCTCTCTTTC
CTTCTCTCACCCCCTCCTCCCTTCTCAATTTCTATCTCTGTCCAAGAAAAAAAAATTTTT
TTTTAAAGAAAAAAAAATTACCCTTTTATGGTTGTATGACAACCTTCCACAATTATTTGT
CCAGTGGGGTTGTAAGGTATGCCAGTTTTCATTAGCTAGTAAGCTAGTAAACTAAAGAAA
GGGAAAAGTGCCAAGTTAATAGCTGGACAAAGCAACGCAATGCTATAATAACCCCATTGG
CCTTCTTTCAAATGAATGAGCTAAGAGACTTAAGCACCTGCTGGTTTTAGTACACTAATT
CCCTTGGAGTTGCTAGAATTTATACATTAATAATAGTTACCGTAAGTGCTACATAAAAGT
CAACATTGGATACTAGAGCAACTTAAAATGCAAAAAGCTGCTTTTTCTAGGAAATAAACA
TTAGGAATAGGAGACCAGTCTTAACTGAATTACCACTGCTGCTGATCAATTAGTCATGTA
TAGACTACAACTTCCAGGTTCCTTTGACTTGTACACTATTTCTAAAAGTTTAATTTAAGG
AACTTTGTTGGACCAGAAGCCTTGACATTTACTGTAGTTTTAGAATAAGAATAGACATGT
TCTCTCAGGCAGTTGTCCTAAGTAGTGTCTGACAGTTTTTGTTTTTTGTTTTTTTCCCCT
TCTTGGTGTTCAGGTTCAGCAGACTGTGCAGGAGCTCTTCGGCAGAGCCCCAAGTAAAGC
TGTTAACCCCGATGAAGCTGTGGCCATTGGTGCTGCCATTCAGGGAGGTGTATTGGCTGG
TGATGTCACAGATGTCCTGCTCTTAGATGTCACTCCTCTCTCTCTTGGTATTGAGACTCT
GGGAGGTGTCTTTACCAAACTTATTAACAGAAACACCACTATTCCAACCAAGAAAAGCCA
GGTAAGAGCCACCTCCTCACTATTTTGTCAGAGATGTTGGCTATATTTTGAGTGATGGGA
CTATATCCGTTTCTCTGAGCCTTTCTTAAAAGTTTCCTTTTTGTAATCCATACTGACTAT
GGGTAGTAAGAAACTTGTCTCAGGGCCAGGCAGTAGTGCAGCAGATTAAGCACACATGGC
ACAAAGCTCAAGGACCGGCATACAGGTCTTGGTTAGAGCCCCCAGCTCCCCACCTGCAGG
GGGGTCGCTTCACAAGCGGTGAAGCAGGTCTGCAGGTGTCTTTCTGTCTTCCCCTCCTCT
CGATTTCTCTCTGTCCTATCCAACAACAGCTATAACAGCAACAATGGTGAACAAAGGCAA
CCAAAGGAAAAAAATAGCCTCCAGGAGCAGTAGATTCATAGTACAGGCACCAAGTCCCAA
CGATAACCCTAGAGATAATTAATTAAATAAATAAATAATCTGTTAAAAAATGTTTTCTAT
TGGTTTTTTTTTCCTTGTCATTCTGGAAAAGTGTCTTACCTGTCGGCCAACAATTCTTCT
AGCGTTTGCCTCGGCCAACAATGATTTTTAAAGGTCTCCATTATTTTCTGACTTTTCCAA
TTGTGAGATCTTTCTGATAAACATTTGTGCAGTGATGTATTGTCAACACATCATTCTGAA
GTATGTGATGACTTCCTGTGACTGAGCACAAAATATATGTCCTATCAGACTCATTTCCCT
AATATAAGCATCATTCACTTTTTAGCTTCTCATGGTGGGGGGGGGGGCGGCTTTTCTGAG
CTAATGATATATCTTTATACTGTGCTGATGTTAATTTTTTCATTCCGTGGTCCGGGAGGT
GGTGTAATGCAAGCATGAGGTCCTGAGTTTGGTCCCCAGCAGCACATGTACCAGAGTGAT
GTCTGGTTCTTTCTCTCTATCTCCTATCTTTCTCATAAATAAAAATCTTTTTAAAAAAAT
AATAATAAATAAAACTTTTTTCTTTGCAAAAATTCAAGTCTTTGTTCTGAACATAGTGTA
CATTAAGACAGTTCTAATGTTAAGATGTAAATTTTTGTTTGGGTAACAGTATATAATCAG
ACTGCTATTTCAGAAAGTATCCTTTTTAGGTGTTTTCTACAGCTGCTGATGGACAGACAC
AAGTGGAGATTAAAGTGTGTCAGGGTGAGAGAGAGATGGCTGGAGATAACAAACTTCTTG
GACAGTTTACTTTGGTAGGTATCAGAAATCTTTAATATTGTTCTCCCATTCCCCCTTTTT
TTTATGCCTCTTGCAAGGGTTCTAGCAGCGACCTATCAAGTCTTCTGTGGAACTTCAGGC
TGACAGAAACTACTAACACACTTAATTAAACAAATTAAATTATAAATATTTTTATTTATA
AAATGGAAATATTGACAGGATAAGAGGGGTACAGTTCCCACCACCAGAACTCAGTATCCC
ATTCCCTCCCTTGATAACTTTGCTATTCTTTATCCCTCTGGTGGGAGTATTGGACCCAGA
GGAGTCAGGTTGGCATCATGATAACATCTGGAACCTGGTGGCTGAAAAAGAGTTAATATA
TAAAGCATAAAAAATTGTTGACTAATCATAAACCTAAAGGCAAGAATATTGCAAATGAAG
ATTTGGGGTCTCTGTTATGGGAAAAGCTAGTAGGTCTATTTTAGATATGTTCTAGGGGCC
CGTGATTTTACTAGTTTTTGCCTGAGCCTGACGTCTAACATGCAGGTGGACCCAGGTTAC
TGTCTGGGGAGATGCTGTCATAACTGGAATAATTTTGTTAATGAGAAAGATGAGAGAGAG
AACCAGATATCACTCTGGCACATGTGCTGCCAGGGATCAAACTCAGGACCTCCTGCTTGG
GAGTCCAAAGCTTTATCGCTGCGCCACCTCCCAGACCACAGTTGGACTAAATTTTATAAA
GAATTGTACTTTATCTAATTGCTGCCTAAAATTTTTTAAGCACATATCAAAGTTTGCTCT
AGCAAGTAACTAACAGTTGTATATAGGTGGGGATGTAAGTGAATGAGAGGAAATCTAATT
TATTCTACTTGGTGAACTCCTATGGTACAGGCAAAGCTTTCAGGTAAAACTATTCAAATG
CAGGTACCACCTGTATACTACATTAATACAAAACAGGCATTTACTCTGGACATTTATCTA
TTTTAGGTTGGAATTCCCCCAGCCCCTCGTGGAGTCCCTCAGATTGAAGTTACATTTGAC
ATTGATGCCAATGGGATTGTACATGTTTCTGCCAAAGATAAGGGCACGGGACGTGAGCAA
CAGAGTAAGTACTTAAATTACTTTAAGGAACCTTGAACATGCCTCTTGGAAGCTAGACCT
ATCTGGGCTGTTCTTATCTTTTACCCAGCCTGAGGAAAAAGCAACTCTTATGCCACCTTT
CTCCTCAGTTATTCACACAAAGTATTTATTATCAGAACAGGCAAGTACTAAGTCTGGATG
CTGACATTTGAGTAGCTGTGTAATGGGCTTTTTTTGTTTTATTTTGGTGTTGCTGGGGCT
TTGCTGCTCCAGGTCCACAACAATCCTATGTACCACAGAGGCAAAATTTTACTGCACCCC
TAATGCTGTGGGGGCTGGCTATAACCTGAGTCATGTGCATGACAAAGCAGGCACACTATT
CAGGTGAGCTGTCTAGCTGGTGCCTTCAAATTTTCATAACTGCTATCAATATTGGCTGTT
CTGAGCAGATAACAGGGAGTGCTATATTAATATGCTTCCTTTTCTTTGTAGTTGTGATCC
AGTCTTCTGGTGGTTTAAGCAAAGATGATATTGAAAATATGGTTAAAAATGCAGAGAAAT
ATGCTGAGGAAGACAGGCGAAAGAAGGTAATTTTTTACTTTTCAGCTGGGAGATAATTTA
TATGTGAATTGCCTTTCTTTTTCTTTATCTCTCCACATCAAAACTCATGTTTCAGAATCT
AGCTGGAAGCCTGCCTCAAACCAGTTTTTTCCTTATACTCTACCCATATGATTGAGAAGT
TTTATTTTGATATCACATTTCTGATTTCTTAGGAACGAGTTGAAGCAGTTAATATGGCTG
AAGGAATCATTCATGACACAGAAACCAAGATGGAGGAGTTCAAGGACCAACTGCCTGCTG
ATGAGGTAAATACATCTTTTAATTACCTCTCAGAAAGTTGAGAGGTAATTACCAATGTAA
TATTAATTTTAAAAAAAAATTATTGGATAGGGAGCCTGGCGGTAACATAGCGGGTTAAGC
GCACATGGCGCAAAGCGCAAGGACTGGCGTAAGGATCCCGGTTTGAGCCCCCAGCTCCCC
ACTTGTAGAGGAGTAGCTTAACAGGTGGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCCCC
TTCTCTGTCTTCCCCTCTCCATTTCTCTCTGTCCTAACAACGACATCAAGAACAACAACA
ATAAAACAAGGGCAACAAAAGGGAATAAATAAATCCTAAAAAATAAATTAATAAATAATA
AAATTTAAAAAATTGTATTCGATAGAGACCGCCAGAAATACAGAAGAAAGGGGGAGACAG
AGGAGAGAATCTGTTGCTTCATGTACTGAATGAAACCTGGAGGGTTAATGATTTTGTTTT
TTATTTTAACCAGAGCACTATTCAGCTCTGGCTTATGGTGGTGCGGGGGATTTAACCTGG
GACTTTGGAGCCTCAGGCATGACTCTTTTTGCATAACCTCCGCCCAAATGATTTTGTCTT
GTCTTAAAGTGCAACAAACTAAAAGAAGAGATTTCCAAAATGAGGGAGCTTCTGGCTCGA
AAAGATAGTGAAACAGGAGAAAGCATAAGACAAGCAGCATCTTCCCTTCAGCAAGCATCA
TTGAAACTCTTTGAAATGGCATACAAAAAGGTACGTGGGCATATGGATACATCACTCCTA
ACTTGATCTTGGTGAAACTTTTGATTATTGTCATTAGTGAATTTCTGCATAGCCATTTTT
ATAGCTTAAAGATAATGGAATTGGAAATCCCCCTTCTTTACTTTGGAAGAATGTAAAAGA
CCATTAAAAAAAAAAAAAAACCACTAGTGATGAGTGTAATGCACCAAAGCAGAGGACACC
TGAGGGAGGAGCAGCTTTGGAGGTCCTGGTGCATGATGGTAGAAGAGGACCTAAGTTGGG
TGTGAGAATGTTTTGTTTGTAGACTTCATCATGGTAAAGTAAATTCTGAAAGGGAAGAGG
GGGTATGGCATAGTGGTTGTGCAAAGAGACTTCCATGCCTGAGGCTCAAATCCCAGGTTC
AGTCCCCCACAGTGCCATAAGCCAGAGCTGAACAGTGTTCTGGTAAAAAGAAAAGAAACT
CTACCAGTGTGTCAACTATACTGTAAACCATTAACCTCTCAGTAAATGAATAGAAGAAAC
CATCAGTAATGTAAGAGTGGTGGGGGTAGGGAGATGGAATAGACAGCACGTCTTTCATTT
TTACTTATTTAGAATACAAAATGTCAGCCTTAACACTGAATCTGGGTGGTTCTCAAATAT
TTTCTTAATAGATGGCATCTGAACGAGAAGGCGCTGGAAGTTCTGGCTCTGGGGAACAAA
AGGAGGATCAAAAGGAAGAGAAACAGTAAAAGCTGTAAATTTTGAAGCAGAAAGGAGAAC
ACAACTATGATGCTTGGGAGTGAAGGGACTTCTGAGCAAAGATGGGCAAACTTGAGTCTT
TTACTGTGTTTTTGCAGTATTCTATATATAATTTCCTTAATGTGTAAATTTAGTGACTGT
TAGCTAATGATCATTTATTGAGAAATTCCAACAGTACAAAGTTCACAATGTTTTGTCTCT
AGCTTGTCGTTTTTTCAACTGCATGTAAAAAGGAAAGATGATTTATTAATCACTATGAAG
ACTTAACATTGCTTTGTGCCAGAGGTAGTTATATTTTCAAGGGTGAGTCCATCTTAAACA
TTACGATGAAGGTAGTTAGCCATAGATCTGAAACAAGACTAAAGATGAGCTCCTGATTAG
TTGAGTACTACAGTACTAGCCTATGTCTACATGGGATTCTTAACCTGAGGCCTTGCAAGG
CAAGCCAGCTGTGCCATGTTAAGAGTAGAGCAATGGAAGTTAGATCAGTGTACAATGTAA
ACATCTATTTATGTTAAGTATAGCTTTGAAAAAAAGAAAGGTAATATGGCTGCCTAACTT
GCCTAAGGCATACTTAGCTATCTTCTTGCCTGTCAGGCACCTGTATCCTTAATTCTCTTG
ATTCATTCTGGATTTTTTTAAGAAAAAATAAACATTTAAAATATTTTGATCGCTTTTTTT
CTTCTTTGAGATTGATTTTCATGAATTATACTCTTAATTCTCATCAATCTCTAGATCTAA
CATGAAAAGAAAGGTTATTATTCTTGGTTCCAGGTAGCCAAAAATCCAACCAGAATTGGC
TTGTAAGAAACATGTCTAGTAGTGAATTCCGAACTTGATTCAGATGGTTTTCTCACAAAT
TTTCTTTCTGATGTGGTTTTAGCTGCCACATACTGAGAAGCCAGGAGGGTGATTGCATAT
TTCTTGTGACCTCGTTTAAGTATTAATAGTTACTTCCTGAACTATTTGCCCTGTTTTGTT
CATTCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 3591..3649, 4389..4476, 6438..6619, 6720..6844, 9127..9200, 9600..9656, 9658..9707, 15626..15788, 16516..16608, 18282..18491, 22993..23220, 24329..24433, 25386..25503, 25971..26065, 26252..26344, 26949..27089, 27731..27808
1001..1081, 3591..3649, 4389..4476, 6438..6619, 6720..6844, 9127..9200, 9600..9656, 9658..9707, 15626..15788, 16516..16608, 18282..18491, 22993..23220, 24329..24433, 25386..25503, 25971..26065, 26252..26344, 26949..27089, 27731..27805
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved