Erinaceus_europaeus Locus WDR43
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus WDR43
Erinaceus_europaeus
WDR43
GeneScaffold_6964
SNORA70, SNORD92, SNORD53, SNORD53
10190..10311, 20946..21032, 27592..27671, 29407..29481
51490
ATATAAAGAAATGAGCACATTTTGGCTTTTGTTTCCGCTGTTCAAGTCACATGTTCTCA
GTGGGATGAGCTGCCCAAACTGGAACCCACTATTATATGGGAAGAGGAATTGCAGTCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCACGTTTTTCTTCC
TAGTCTCAGCTAAAACCAACTCCCCAACCCGAAAGGGCACCTCTGTGGAAGTTGGCCGGG
TCTGGGTCTGGGCCAGGGCGGGCGGCGAGGGGCCATGCTCCCGAGGGGGTGGCCCGTCCG
GCAGCTGCGGCGGCCCGAGGACCCCGGGGTCCGGCAGGTGCGGGGGGAGAGAAGGCGGTG
ATTCTGGTCCGGGCGGCAGACTGGGTGCAGCCTCGCACGTTCCTTCTCCCGCCTCTCTGG
ACGCGGAAGACTGTCCACCCAGTGACTGCGCTCCCTCAAAAGGCTCGTGCCCAAAGTCAC
GCAGAGGAGAGCGGATCCCCACCGCCAAGCGACTCCGAAGACGCAGCAGTCGCTGCAGCA
AGAGGGAGCGGCAGCAGACAGCCGGCAGCATGGTATCCCGCGCGTCGCGGGCGACTGACG
TCACTGGCTCGCGACACCCGACGCTCTGACGCAGCGCCCTCAGGGGCGCGGACCTCGTGG
GGGCGGGGCTCCGCTGCTGCGGCTGCGCAGGCGGGCGGCGCTGACCGGGTTCCAGTTCGG
AGGTTCAGTTCGGAAGCTGCGGCGGGCTGTCGGCTACAGGAGAAAGTCCTTTGGGGGTCG
GGCTGGAGGAGGGAGTCCGAGCGCCGTGTGGACCCTGAGGCCGGGACTCCCGGGTTCACG
GCTGTGACTGCATTCTCGGTGTGCTTATCTGAAAAAAGAAACAAGGGGGGAGTCGGGCGG
GAGCGCAAGGACCGGCCTAAGGATCCCGGTTGGAGCCCCGGCTCCCCACCTGCAGGTGTG
CCGGGCTAGCTAGGCGGGCGGGAGAGAGAGAGACGATCAGGGACTCATGGCTGAGTGGCA
GTAAGTTCAGTCTTTATTCATGTGGGAGGCAGCGCAATCTAAGCTGTCTCTAATGGCAAT
CCTGTCCTTGGCCGAAGTGTCAGGTCTGAAGAGGATGTAGATGGGAAAGGGGGTGGGGAG
AAGGAAAAAGCGTGCAAAACAGTGGGGATTAAACCAGTGCCCTGGAGGCAGGGCGGTGCT
TAGTTAACAGTGGTTATGTCAATAGAATACAGTGTTAAGCAGGGGGGATTAAACCAATGA
AACAGAAGGGGTCTTAGGAGCAGAATTTAGAAGCAGACCAACACAGGTGTCTGTCTGTCT
TTCTCTCCCCCACTCTGTCTTCCCCTCCTCTCTCCATTTCTGTCTGTCCTATCCAACAAC
AACGACATCAATAACAACAACTACAACAATAAAATGAGGGCAACAAAAGGGAATATAAGT
AAATATTAAAAAAAAAAAGAAGAAGGGCACCGGGTGGTGGCGCACCGGATTGAGTGCACA
TAGTGTGAAGCGTGAGGACTGGCCCAAAGGATCTGGGTTCGAGCCCCCGGGTCCCCACCT
GAAGGGGGCGGGGTCTCTTCACAAGCGGTGAAGCAGGTCTGCAGGTGTCTGTGTATCTCC
CACGCCTCAATTTCTCTCTGTCCAGTCCAATAAAATGGGAAGAAATGGCCGGCGGGAGCA
GTGGGATTCGTAGTGCCAGCATCGAGTCTCCAGTGATAACTCTGGAGGCAAGAAGAAAAG
AAATTTTAAATAATAAATAGGGGCCGGGTGGTGGCGCACTTGGGTGAGCGCACATGTCAC
AGCGCTCAAGGACCGGGCTTGAGCCCCCCCGTCTCCACCTGCAGGGAAAAAGCTCTGCGA
GTGGACGGCAGCAGGTGTCTCCCTCCCTCTTCCTTCTCTACCACCCCCGTCCCTCTCGAT
TTCTGGCAACCTCTCCAATAAATAAAGATAATTAAAAAATTAAAATAATAATATAGATTT
AAACTATTAGCCATTGTGAGGGGAAGGGAGTATAATGGTTATGCAAACAGACGCTCATGC
CTGAGCCTCTGAGGTTCCAGGTTCAGTCCCCCACACCACCATAAGCCAGAACTGAGTAGC
GCTCTGGTGTAAAACAAAAACAGAAACAAGATATTAGTAATTGTGGCCGGGAAGGTGGTA
CAGTTCATAAAGCTTTAGACACTGAAGCGTCAAGTCCAAGTTCTGCCCTTAACATCACAG
GAGCTGGAGATGCTCTGCTTCTCTCAGACTTTTTTTTTTTTTTAATATTATTGGATAGAG
ACAGGAATTTGAGGGATGGAGGAGATAGGAAAAGAGAGAGAGACACCTACAGTCCTGCAT
CACTACTCCTGAGGCTTGCCCCCTGCAGGTGGGGACCAAGGGCTTGAACCCCAGTCCTTG
CACACTGTGATGTCAGTGCTTAACCATCTGCCCCCCCTCAAAGACTTAAGTCAGTCTTAC
TTCCCCATCCCCTCCACCTCATCCTTCCATAAATAAATGTTTATGTATTTGAGAGAAGGA
TGCAGAGTATCACCTTAGCACATGGAGTGCCTGGGATGGAACTCAGGACCTCCTGCTTGA
GAGTCTGATGCTCCGTAGGTGGTGGAGCAGTATTGTGGTATCGCTCCCTTCCTGAAATAA
GAGGAATAAAAAAGTTGACCCAGAAGCTGTGGCCTCATGCATATTTGCAGGTGTGGGGTG
GGTGGAGGGAGAGCGAGCGTACCAATATTATCTAAGAGAGTATTTCACACTCCCTGCAAC
TCAACAGAAGCCCGTGAAAATGGACAAAGCGTTTTCTTTGGAGTTCAAAAATCTCATTTT
ATTTTTCTTCTATTTCATTCAATAGGACAGAGAAGAATTGAGAAGGAAGATAGGGAGAGA
GAAAGACACCTGCAGACCTGCTTCACTGCTTTTGAAGCTTCCCCACTGCAAGTGAGGAGC
AGGGGCTTGAACCCAAGTTCTTTGGTGGGTCCTTGCACTTAGGACTATGTGTTCTTAAGC
AGCTGTGCCATTGCCTGACCTTTCCAAAACCTCTTTTTTTTTTTTTTTTTTTTTTTTTTT
ACCAGAGTACTGCTCAACTCTGGCTGATGGTGGTGCAGAGGATTGAACTTGGAACCTTAG
AGCCTCAAGCTTTTGCATAACCATTATGCTGTCTCCCCAATCCTCACTCTGTTTCCCCCT
TCCCTCTTGATTTTTGTCTCCATTCAAAACAAGTAAATAAAATCTTTGGGAAAAAAGCAT
TAGATATAACCTGCTTGCTTCCCATCACTTTGCTGTCAGTTGAAACAGTGCCAGGCATGG
TAGGTGCTTATTTAAGTTTGCAGCCACCTTCATGAGGGACTAGCCCAGAGTGGCTGGGGA
GGCAGCTCTACTGCAAGTGCCTTTCTCTCTCTGTTTCTCCCTATTGCTGTCTCTCACCCT
CTATCAAAAAGAAAATGGCGAGGAAGGGAGACAGAGAGACATCTGCAGACCTGCTTCACC
ACCTGTGAAGCTACTCCTCTACAGTTTTAAAAGACAAATAGGGAGGCGGAGCTACGAGCA
GCAGATCGCTTTCTCTCCTCTCCTCTCTTCTCCTCTCCTCTCCTCTCCCGGATCAACTAA
GAATACCAAAGGAGACCACCCAGACCGAAACAAAACAGGACTAGAATGACCACAGGAACC
CAGTAAATCACCCGTGAGTACAAACACGTGTGGCTGGTGACAGAGAGGAGAGAGGGGCCT
AAGGAGAGATTAAGTGACTGCTAACTGTTCAACAGTTTATCAGTGGACACACCACCTCCA
GTCTGCTCCACAACAAGGGGACAGCTGAAGGGAGGAAAGGACTCCGCAGAGACTCACCAA
GTGCAACTCTGAGTCTCCATTGCTACTATCCTCAGAATCTGGAGCAGCAACAGGGAGGGA
CACCAGGGGACAGAGATCTAACCGGGAAACTCAGGGGAAGATCTATACCTCGGTGGCATA
GCTGAGGGGCTGTGAAAGTCTCTTTGCATAACCACTGGATTATCTCTGCCACACCCTGCT
TTATCTCTTGGTCAGGAGTCAGTGATTAAGCTAAAAAGCCTATTGATAGTTTAAAAGCCC
TCAGGCTCCCATAGCCTAAAGGGAAGAAAAAAAAAAGAGGCTTTTACACCACTGAGCTCC
AACTCAGGGATTGAAAAAACTGTTAACTTCCACCACGGTAAACCCCTTTAATTAAATTAC
TTAGACACAAGTCAATCCAGGCATTAGTGATCAATAATTTGAAAAGTACTGATAAAGGGA
ACTCATAACATAATATATAAAATGGTTAAAACAACAAGAAAAAATATTGGAGACTCGAAA
CAGGACAAGAGTCCAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TCAAGGCACCAGTCTGACACATACACCAGGAATTGAACATAGGACCTCATGCTTGAAAGC
CCAACCCACAATCCACTGCATCACCCAGCCATTGGTCTTGTTAGGGATTGTGGAGAAAGC
TAGGAGAGGAGGACTCTTGGAAGGTTGGTGTTAGGGGAGGTCATGCATTTGAGGTTAGGA
CAGCAGTACACCTCTTCTGGGACAACATGACCCTAAATAGGAATGAGCTTTGTGTTAAGG
CAACTAATTCAAGTGTTTCCTACATGAAAAGCATACACTTTAGATTTAAAATGTTCCCAA
ACATATTGCTTTCATTATTGATCATTAAGTATTCTAGAACTGCTTAATCAAAGTTCCCAA
ACAGACCATCACTCACATTTAATTCTTGATCCCTATCTATAATTATTGCTAAAGGTACAA
GGACACTGCATACAGAAGAGGGTATTGTGGGAACTTGATGAGAGAAAGGTAGAAGGTAAC
ATGAGATGGTCTCTTTCCTTTAGATGACTACTTTAAAACTCAGATAAGCCTACCTTTTAA
TTTCCTCAGGTCATTCTCTCTTTTGATCATTTTTGTTCTGTTTTTCTTCATTCCCCCTTT
TGGTTTGCAAAACAGCACAATTTACACAGAGCCTAAATTGCTGAAAATTTGGAGTATACT
TAATAATGATTTGACTTGCTTTTTATTCTTCCTTGTGTATTAACAGAAAACAATTTTTAT
TAAAATAAATTTTTCTCCTATAAACAACCAGACCACCACAAATAGGACATATATCAAAAC
ACTCTAAAACTCTACAAGAATGGCGTTAAAATATCTTCAATCTTTGATATCAATAAATGT
CAATGGCCTGAATTCACCTATTGAAAGACACAGAGTAGGAAGATGGATCAGAAAACACCA
CCCAACAATACGTTGTCTACAGGAAACTCACCTAACTCAACAAGACAAACACAGACTTAA
AGTGAAAGGATGGAAAACTATCATACAAGCCAATGGCCCACAAAAAAGGGCAGGAACAGC
TATTCTCATATCTGACATGATAGACTTTAAAATAGATAAGATTAAAAAAGATAGGAATGG
ACACTACTTAATGCTCAGAGGATCAGTCAATCAAGAGGACTTAACAATTATTAATATCTA
TGCACCCAATGAGAAGCCATCTAAATACATCAAACTTCTACTGAAAGAGCTACAGCAATA
TATTAACAGTAACACAATCATAGTAGGGGACTTCAACACCCCACTATCTCAACTTGACAG
ATCATCCAGGAAGAAAATCAGTAAAGACATAAGGGAGTTAAATGAAGAGATAGATAAACT
AGAACTATTGGGCATTTTCAGAGTCATTCATCCCAAGAAACTGGAATACACATTTTACTC
AAATCCACATGGATCATTCTCAAGGATAGACCATATGTTAGGCCACAAAGACAGCATCAG
CCAATTCAAGAGCATTGAAATCATCCCAAGCATCTTCTCAGACCACAGTGGAATTAAACT
AACACTTAACAATCAACAAAAGATTAGTAACAGTGCCAAAATGTGGAAGCTCAACAGTAC
ACTTCTTAACAACTTCTGGGTCAAAGAGGAAATCAAGGAAGAAATCAAAATGTTTCAAGA
GTTCAATGAAAATGAAGACAAGCTATCAAAATATTTGGGACACAGCTAAAGCAGTCCTAA
GAGGGAAGTTCATAGCTATACAAGCACACATTAGGAAACAAGAAAAGGCACAAATAAACA
GCCTGATGGCACATCTTAAGAAGAAGAACAACAAAGGAATCCTAAAGCAACCAGAAGGAC
AGAAATTTATTTTATTTATTTTATTTTATTTATTTTATTTTATTTATTTTATTTTATTTA
TTTTATTTATTTTATTTTATTAAATTTAAATTTATTTTAACTAAAGTTAGGGCAGAAATA
AATAACATTGAGAATAGGAAAACCATACAAAAGATCAATGAAAGTAAATGTTGGTTCTTC
GAAAGAGTAAACAAAATCGACAAAACTTTAGCCAGACTCACATAACAAAAAAGGGAGAAG
ACCCAAATAAATCGGATAGTAAATGAAAGAGGAGATATCACAACAGACACTGCAGAAATT
CAACATATCATGCGAGGCTTCTATGAACAACTATATGCCACCAAGCTAGAGAATCTGGAA
GAAATGAATGATTTCCTAGATACCTACCAACTTCCAAAACTAAGTAAAGAGGAAGTGGAT
AACATGAACAGGCCCATCACAGCTAATGAAATTGAAACAGTTATCAAAAATCTTCCCAAA
AATAAAAGTCCGGGACCAGATGGTTTTACAAATGAATTCTACAAAACTTTCAAAGAAGAA
CTAATACCTCTACTTTTAAAAGTCTTCCAGAAGATTGAAGACACTGGAATACTCCCTGCC
AGCTTCTATGAAGCCAACATCACCCTGATACCAAAAGCAGACAGGGACACAACCAAAAAA
GAAAACTACAGACCAATATCTCGGATGAACATAGATGCAAAAATATTGAACAAAATTCTA
GCCAACCGGATACAGCAGTATATCAAAAAGATTGTTCATCATGACCAAGTGGGGTTTATC
CCAGGCATGCAAGGTTGGTTTAATATACGTAAATCAATCAATGTGATCCACCACATCAAC
AAAAGCAAGACCAAAAACCACATGGTCATATCAATAGATGCAGAGAAAGCCTTTGACAAA
ATACAACATCCCTTTATGATTAAAACACTACAAAAAATGGGAATAGATGGAAAATTCCTG
AAGATAGTGGAGTCTATATATAGCAAACCTACAGCCAACATCATACTCAATGGTGAAAAA
CTGGAAGCATTTCCCCTCAGGTCAGGTACTAGACAGGGCTGCCCACTATCACCATTACTA
TTCAACATAGTGTTGGAAGTTCTTGCCATAGCAATCAGGCAGGAGCAAGGAATTAAAGGA
ATACAGATTGGAAGAGAAGAAGTCAAACTCTCCTTATTTGCAGATGACATGATAGTATAC
ATGGAAAAACCTAAGGAATCCAGCAAGAAGCTTTTGGAAATCATCAGGCAATACAGTAAT
GTGTCAGGCTATAAAATTAACATTCAAAAGTCAGTGGCATTCCTCTATGCAAACACTAAG
TTAGAAGAAATTGAAATCCAGAAATCAGTTCCTTTTTCTATAGCAACAAAAACAATAAAA
TATCTAGGAGTAAACCTAACCAAAGAAGTGAAAGACATGTATACTGAAAATTATGAGTCA
CTACTCAAAGAAATTGAAAAAGACACAAAGAAGTGGAAAGATATCCCATGTTCATGGGTT
GGAAGAATTAACATCATCATAATGATTATATTACCCCAGAGCCATCTACAAATTTAATGC
TATTCCCATCAAGATCCCAAGCACATTTTTTAGGAGAATAGAACAAATGCTACAAATGTT
TATCTGGAACCAGAAAAGACCTAGAATTGCCAAAACAATCTTGAGGAAAAAGAACAGAAC
CGGAGGCATCACACTCCCAGATCTCAAACTGTATTATAGGGCCATTGTCATCAAAACTGC
TTGGTACTGGAACATGAACAGACACACTGACCAGTGGAATAGAATTGAGAGCCCAGAAAT
GAGGCCCCACACGTATGGACATCTAATCTTTGACAAAGGGGCCCAGACTATTACATGGGG
AAAGCAGAGTCTCTTCAACAAATGGTGTTGGAAACAATGGGTTGAAACATGCAGAAGAAT
GAAACTGAATCACTGTATTTCACCAAATACAAAAGTAAATTCCAAGTGGATCAAGGACTT
GGATGTTAGACCAGAAACTATCAGATACTTAGAGGAAAATATTGGCAGAACTTTTTTCCG
CATAAATTTTAAAGACATCTTCAATGAAACGAATCCAATTACAAGGAAGACTAAGGCAAG
TATAAACCTATGGGACTACATCAAATTAAAAAGCTTCTTCACAGCAAAAGAAACCACTAC
CCAAACCAAGACACCCCTCACAGAATGGGAGAAGATCTTTACATGCCATACATCAGGTAA
GAGTTTAATAACCAATATATATAAAGAGCTTGCCAGACTCAACAAGACAACAAATAACCC
CATCCAAAAATGGGGGGAGGACTTGGACAGAATATTCACCACAGAAAAGATCCAAAAGGC
CAAGAAACACATGAAAAAATGCTCCAAGTCTCTGATTGTCAGAGAAATGCAAATCAAGAC
AACAATGAGATATCACTTCACTCCTGTGAGAATGTCATACATCAGAAAAGGTAACAGCAG
CAAATGCTGGAGAGGGTGTGGGGTCAAAGGAACCCTCCTGCACTGTTGGTGGGAATGTCA
ATTGGTCCAACCTCTGTGGAGAACAGTCTGGAGAACTCTCAGAAGGCTAGAAATGGACCT
ACCCTATGACCCTGCAATTCCCCTCCTGGGGATATATCCTAAGGAACCCAACACATCCAT
CCAAAAAGATCTGTGTACACATATGTTCTTGGCAGCACAATTTGTAATAGCCAAATCCTG
GAAGCAACCCAGGTGTCCCACAACAGATGAGTGGCTGAGCAAGTTGTGGTATATATACAC
AATGGAATACTACTCAGCTGTAAAAAATGGTGACTTCACCGTTTTCAGCCACTCTTGGAT
GGACCTTGAAAAATCATGTTGAGTGAAATAAGTCAGAAAAAGAAGGATGAATATGGGATG
ATTGCACTCTCAGTCCGAAGTTGAAAAACAAGATTAGAAAAGAAAACACAAGTCGAACCT
GAAATGGATTGGAGTATTACACCAAAGTAAAAGACTCTGGGGTAGGCGGGTGGGTGGGGA
GAATACAGGTCCATGAAAGATGATAAATGACATAGTCGGGGTTGTATTGTTAAATGGGAA
TCTGGGGAATGTTATGCATGTACAAACTATTGTATTTACTGTTGAATGTAAAGCATTAAT
TCCCCAATAAAGAAATAAATTATTTTTAAAAAATTAAATAAAGTAATAAAAGATAGGCAA
GGACATTACATAATGATTAGAGGATCAATCAGCCAAGAATAGTTAACAATTATTAACACC
TATGCACCCAATGAGGGACCATCTAAATAAATCAAGCAACTACTGAAAGAATTGCAAAAA
TACATCAATAGTAATACAATAATAGTGGGATACTTCAATACCCCACTCTCACACTTAGAC
AGATCAACAAAGCAGAGAACCAATAAAGATACAAGAGAATTGAATGAGGAGATTGACAGA
CTAGACCTGTTGGACATTTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCTTAAGCAGTGCGCCTGGCTAAAAAAAAAAACCAAAAAAAAAAAACACTGCAGCCAA
TTAAGCCAACTGTGTTGCCTTCCCCATGGTATCCAGTGTGCTTTGCAGCCTCCTGGGTAG
TGTAGCAGCCTGTTGTTTGTACAGGCTGCCCTAAGGGGCCCTGGAGACAGCCCTTCCTGC
TCTGTATTCATTTTATGCCTGACCTCCTGCTGTCCCTAACCCTAGGCTCCAGACAGGGAT
GCAAAGTGCTTTTGGGAAGCCCCAGGGCACCTTGGCCAAAGTCCACATTGGCCAGGTCAC
CATGTCCATCCACACCAAGCTGTAGAACAAAGAGCATGTGATCGAGACCCTGCGCAGGGC
CAAGTTCAAGTTCCCTGGATGCCAGAAGATCCACATCTCCAAGAAAAGGGGCTTCACCAA
GTTTAACGCAGATGAATTTGAAGACACGGTGACTGAAAAGCGCCTCGTCCCAGACAGCTG
TGGAGTCAAATACATCCCCAAGCGTGGTCCCCTCAACAAGTGGCGGGCCCTACACTCCTT
GAGAGCCTTAGAGATGCCCCTTAATCAATTACAACAGAGAAGCCTCATATCTGTGATACA
TGAGAATCTGATTTCAATCTCCTGTGGAAAAATAATACTAATCAGACAACTCTGGAGGTT
ATATTTTTCTCTTTTTTAAATCTTTTTAAAATCTATTTTTTATCGGATAGTGATAGAAAG
AAATTGAGAGGGAGAAGGAGATAGAGAGAGACAGAGAGACACCTCCAGTTCACCATTTGT
GAAGCTTTCTGCCTGCAGATGGGGACCAGGGTCTTGAACCCAGGTCCCTGCTTACTGGAG
TGTGTGAATTTAACAAGGTGTGCCATCTCCTGTCCCCTGAGGTTGTGTTTTTTTTTCTAC
GTATATTTTAAGTTGTTTTCATTATTTAAATGTACCCTACTAACACCAATGATGAATTTG
TCCTAAAAATGCATTGCCAACTCTGTAGATTCCTTACTTTCTCTATGCTACATTTTATCA
ATAAACCAGGGGTAATGCAAAGGGCTATATGAACATCTGTTGTCATTAGCAATGTTGTAG
TTATTTTCAGATTTAATCTCATTCTAGTCACTATTTTTATGCTCAATGATAAATAATTTT
TGCTTAACAGGAAAGTATACCCAAATGTTGTGTTACAAGTGATTTAGGAAAGCTCAAAAC
TGTACCTATCATTGTGTCATGGTAGAGTGCACGAACTACTATGCTAAAAGACCCATGTTC
AAGGCTCTAGTTCCCTCCTTCAGAGGGGAAGCTTCACAAGCAAGTGATGGAGCAGTGTTA
CAAGTATCTCTCCTCTTTGTATCTTCCTCTTCCTCTCTCTCTTTATGTCTACTCCATTAA
AAAAAGGGGGGGCTGCCAGGAATGATGGAATCCTGCAGGCACCGAGCCCCAGGGAGAAAC
TTAGTGATAGCAGTAAACAAATAACTTATCCAACATATTTTTTCATCAGTTGGAATATTT
GTTATTCAACTAGACAAATTGAAAGATGTGTCTCTATGAAAGGTGTTTGTAGTAGAGAAG
GGATGAGAAACTGTACAAAGCATTTCCCAAAGGAATTCAGACTACTGTATGTTAAAAACA
GTTAATAATATTAATGAGTTTTTACCACTCTTGGAAAGCTAACTTAATTGACACACACTC
CTGAGGGAATGAAGTGCAGTGTGAGAGTGGAGTCGTGGCTTTATTATGAGTCAACTTTTG
TAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCC
TGAAGTCCAGAATCCTAAACAGGTCACTCCTTTTAATCTCTGGTCTCTTAGTAATGGAAT
GCTGTTCAGAGACACATGCAAAGACAGAGATGCAGCATGACTGGGACCACATTGTGGTTA
ACAGATCTAGAGGTTAGTTAGTCAAAAGTTATGCACCAGAGAATGCTGTTAGCTATTTAA
ACTGATACCCTCTTTTGTTCCTTGGTATTGAGACTTTTCACAAAACCTCAAAAATCTTTG
AGGCAAAAAAAAAAAAAATCTTTGAGGCAAATGACATTTGTTTGCTAAAGAATAGAGTCA
AAATACCATCTAATGCAGGTCTCTTTCTTGAAAGTGAACAGTTAGACTCCGCCCCGCTCC
CGTGCGCCTGCGCACGAGCGAACACGTGGCTACCGCGAAGCCAGAGCAGCAATGGCGGCG
GGCAGCGGCGGTCCCGCGGACCCCCTGTCTCCGGCGGGGGTCCCCTGCGCCTTCTCCCCG
CAGGGCCAGACCTACTTCGCTTTGGCGTCTTCCGACGGTCACTTGCGAGTGTGGGAGACG
TCCAACAACCGGCTGCACCAGGAATACGTGCCTTCCGCGCACCTCAGCGGTACCTGCACC
TGCCTGGCCTGGGCGCCAGTTCGGCTGCAGGCCAAGAATTTATTTATCTATTCATGAGAG
AAGAGGAAAGAACCACACATCACTCTGGTACATGTGCTGCCCAGGATCGAACTTGGGACC
TCATGGTTGAGCATCCAATGATTTATTCATTGTGCCACCTCCTGGACCACAAAAGATATT
TATTGGGGGCGGAGGGTAGATAACATAAGGATTACGCAAACACTCTCATGCCTGAGACTC
CATAAAGTCCCAGGTTCAATCCCCTGCACCACCATAAGCCAGAGCTGAACAGTGCTCTTG
CTAAAAAATAATAAAAAAATAAGAAAATAAAAAAAAAAAAAAAAAAAAAAAAGAAAGTGA
ACAGTTGGCTAAAGAAAGCATTCCTGAGGACTATTGAAATAGTCATTTGGTAGCTGTTTT
CCTTTTTTTCCTTTTTTTTTTTTTTTTTTACTAGATAGTACAAAGAGGAACTGAGATGGG
AAGGGACAGAAAGGGAGAGAGAGAAAGACATCTGCAGACCTACTTCACCATTTGTGAAGC
TTCCCCCTCACAGGTGGGGAACTGGGGGTCAAACCCCAGTCCTTGCACATAGGAGTATGT
ACACTCAACCAGGCACACCATCACCCTGCCCCTATATCAGTGTTCTCATATGTATTTCCT
TTCTAACCCAATTATCTAATATTTGTGTTAAACATTTGAAAACAGACTTTTCCCTCTTGT
GAAACATGACAAAATGCTTTTGATAGTCTGTTCTGTTTACTTAAAATTGACTCAATATCT
CTATGATTTTGTTGTTTTTGTTGTTGTCACTGGGACTTTACCATTTCAGACTGACTTTCT
TTCTTCCTTCCTTTTTTTTATCCAACTTTTAAAACCTTTTTTTATTATCCTTATTTATTT
ACTGGGTAGAGACAGTCAGAGATCGAGAGAGAAAGGGGAGATACAGAGACAGAGAGACAC
CTGCAGCCCTGCTTCACCACTTGCAAAGCTTTCCCATGCAGGTGGGCACCAGGGGCTCGA
ACCTAGGTCCTTGTGCACTGTAATACGTGCACTCAACCAGGTGCAACACCGCCCGGCCCC
TCTTTTCTTCCTTCCTTTCTTTCTTCCTTTCTTTCTTTCTTTCTTTCTTTTTTGGTTGTT
TCTGTTCTTCCTGATAGAGACAGAGAGAAAGATCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGA
GAGTCCTTATGGGGGGGTGGTGGAGAGTGTGATAAGCCGCTTTGCGGGCACATACACGGG
TGATGATGGACAGAGTATATGTTGGCAATGTTTAAGACTCGAAGTGCTGTTGGTACAAGT
CCCAGGCCACTCTTGTAGTTCACACACCAGGTCTGTGACAGGCTGTAGAGCGGATGGTCA
GGAAAGCCTTGACTCCATGTAGATGAGCCAAAGGAGGGCCACGGTGCTTTAGTCCTAACA
GCCGCCACAGCAGAGGAGGGCCGTGCTTTTCTAATGGACTAAAACTGTTTGAAGCTTAAG
GTTCTGTCTTGTAAGTTTGAAAGGCAGTGTCTTGGGCACAAAGTAACCAAGATAATGCTT
TATGAAGAAGCAGTTTGCCAGCACTGATTCAAATACTATAATGCTATATAACATTTGTGA
AGGAGCCAGCTGAGGAGCTGGGGTAGATAGCATAATGGGTATGCAGAGATTCTCATGTCT
GAGGATCCAAAGTCCCAGGGATCAATCCCCCCACACTACCATAAGCCAGAGCTGAACAGT
GCTCTGGTTAAAAAGGAAAAAAAAAGCCAGCTGACAGGTAGAGAAAGAAGCTAATTGGTG
GGGGTCAGGTGGTAGTGCAGTGAGTTGAGCGCACATGGTGCAAAGTGCAAGGACCATCAT
AAGGATCCCAGTTTGAGGCCCCTGGCTCCCCACCTGCGGGGGCTCGCTTCACAGGCAGTG
AAGCAGGTCTGCAGGTGTCTTTCTCTTCCCCTCTGCCTCCCCTTTCTCAGTTTCTGTCCT
GTTCAATGACAGCAGCAATGGCAACAACAACAATAATAACACGGGGAACAAAATGGGAAA
AGTGTGGCAGGGGTAGATAGGTTATGCAATGAGACTCTCATGCCTGAAGTTCCAAAGTCC
CAGGTTCAGTCCCCTGCTCCACCATAAGCCAGAGCTGAGCAGTGCTCTGATAACAAAAAA
AAAAAAGGGAAAAATGGCCTCCAGGAACAGTGGATTCATAGTATAGGCACAGAGCCCCAG
CAGTAACTCTAAAGGCAGAGGGGGAAAAAAAACAGAGGCTAATGGGCACAAGGTTGTTAC
CCTCCTCTGGGAGTAAGATGGTAGCGTGGGAAGTCGGAATGGAAAGGCACTAGCCAAGAA
GAATTAGTCGTGCTTGGGCAGAAAGACATGAGTATTGAGTACTGAGTCACTGACAGGGAC
TTTATTTTACTTTTTATCCCCCCAGAGCATTGCTCAGCTCTGGCTTATGGTGTTATTGGG
ATTTGAACATGGGACTTTATAGCTTCATGTGTGAGAATCTCTTTGCGTAGCCATTATGCT
ATCTACCCCTGCCCTTGGTTATTTTTAATTGACACCAGGGTTATTGCTGGAGCTCAGTGT
CTGCACGACAATTCCATTTTCGGCGCCACCTCCCTCTTTCTCTCTTTATTTGATAGGACA
GAGAAATTGAGAAGGAAGGGGGAGGCAGACAATTGTAGTACTTGATCCATCGCACCTGAA
GTTCTCCCTGCAAGTGTGGAGTGAGGCTTGAACCCTGGTCCTTGCTTATGGTAACAAGCG
CTTGACCAGGTGCGCTACCACTCGGCTGGCTCCAAGAGGAGTTAAATTGAAGGTGACTCC
TAATTAATTGTTCAGCTTTGTGAACACTTTTAGGGGGGAGTAAGGGACAGTTAAGAGAAA
CTACTGCGGGGGTCGGGCGGTGGCGCAGTGGGTTAAGCGCATGTGGCGCAAAGCGCAGGG
ACCGGTGTAAGAATCCCAGTTCGAGCCCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCAC
GGGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCTTCTCTGTCTTCCCCTCC
TCTCTCCATTTCTCTCTGTCCTATCCAACAACGAATTGCATCAACAAGGGCAATAATAAT
AACCACAACGAAGCTACAACAAGGGCAACAAAAGGGGGGAAAAATGGCCTCCAGGAGCGG
TGGATTCATGGTGCAGGCACCGAGCCCAGCAATAACCCTGGAGGAGGAAAAAAAAAAAAA
AGAGAAACTACTGCTAGGAATGCAAACTAACTCAGTGTCCCCCTTCTCCCATCTTCCCCC
AATCGACTTCCCCTTTCACACAAGTCTCAACCATAAACAAAATAACGAAAAGCAGAGAGG
GAAACAGTTCTGGAGTTTTAGATAAGAGAATTAAACTTTTAGGCAAGTTGAGTTTGAAAT
GACGCATGCCAGGCAACACCTTGTACAGGTGGGACTGGCAGGGCCTTGTGGGGGGGAGGG
TGGGCGCAGTTGAGCCAGCCTTGCCCCAGCCTTCTGCACCGAGGATGCCTGTCAGAACAG
CAGGAGATTCTCTGTGGTTTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAACC
CTTTGTGCTACTCCCAAGCTTCCATGTTTTATCTGTGTAAGTTAGGTAAAACCCAAGCTT
CCAAAAGAAGTCCTACCTCATTCATTTCCTAGTACTTTCTGAGAATGTCTTGTTATCAAC
TTGTCAGGGATTGGTATGGTATGGTATGGTAAGGGCCGAGGTTAAAAGCTTCCTGACACA
AACTTTTAGAAGGTTCAGTTTGGGGTGGAGGGTAGATAGCATAATGGTTATGCAAAACAG
ACTCATGCCTGAGGTTCCAAAAAAGTGTATTTGGGGAGTTGGGCGGAAGCGCAGTGGGTT
AAGCGCACGTGGCACAAAGCACAGGGACCAGCGTAAGGATCCTGGTTTGAGCCCTTGGCC
CCCCACCTACAGGGGAGTCACTTCACAGGCAGTGAAACATGTCTGCAGGTGTCTATCTGT
CTTCTCCTCCTCTGTCCATTTCTCTCTGTCCTATCCGACAACAAAGACAGACAACAATAA
TTACAACAGTAAAACTAGGGCAGCAAAAATGGAATAAACAAACACATAAATTAAAAAAAA
GTTTTAAAAAGTGCAATTTGGAATAGAAACTGAGTTATTTGTAATGCTGGAGTTTTTTAA
ATTATCACTAAAAGATTTTTTAAAAAATTTCTACTCTTAAGCAGTTTTCTCCTCATTCAC
CGCACTGTTTTGTTTTTCCTCACAATACAGCAAGTGGAAAGGTGATAACAGCAGTGTCAG
TTCCCTGTGTATCAGCCCAGATGGAAAGATGTTACTTTCAGCTGGTCGAACAATCAAGCT
GTGGGCTTTGGAGACCAAAGAAATCTACAGAGTGAGTGAATTAAGTTCATCATGAAGCAC
AACAGTTACCTAGAGCAATCATGGAGAAGGGGAGAAATGGCTGAGCTACTCTGTATTGCT
TTAAGGGTACAATTTGTTTTAGACACAGTGAAAAATAGAATTAACAGGTATGAGTTAACT
TCAGGTCTGGTTTGATGATGTGAAACAAATCAGGTCTGCTCACGTCTGCAGACATTAGTG
GAATTTGAATTAAAATCCTTTATTATGCAGGTATAGTAGTTTTGAATGATACAGCATTGT
GTACACTTAGAGTATGTAAATGGGGATTTGAAATGACTTGAGTGTGCTTGGGGACTACTG
AACTTCTGGTGCAGTGATGATGCCTTAAGATTGTGGTTTCTACTCACTGAGAGTAAATGA
AGACCTACAATTCCTTGGCTGTGTCTGAGCACTGAACACCCCTTTAACAGTGGTAGATGG
GAAGAACTAACGGTTGTGTGTCCCACAGACTTGAAAGGACAGGACAATCTTAATTTTCAA
AAGGTTTTAAGAACTGAGACTAGCATACACTAGTTACACATAATTGAATTTAACTGTTAC
CGTTAGAGCTCTGAATTCAGGTATGTGTCAGTTCTTGTTCATGATGCATATGACTCTTAA
TTCTTATGACCACTTTGTTTTCATCTGTTCCTAAATGAGATTGAACTCTTTCTAGCATTT
CACCGGACATGCGACACCAACTTCATCGCTTAGGTTCACTACTCTCAGGCCTCCTAATGA
GAGCCAGCCCTTTGATGGAATTACAGGTCTTTACTTCCTATCTGGAGCAGTACATGACCG
GTTAATTAATGTCTGGTATGTATTTCTTTGGATTTGAAAGAATTTGTCATAGTTTTAGGT
ACTTGATATAAATGATTAAGCTGACACCTGACTTTGGAAAAAAATTTTTTTTTAATCTTC
ATTGGATAGAGACAGAAACTGAGGGGTGACAAGGAGAGAGACAGAGGCACCTGCAGCACT
GCTTCACCACTTGTGAAGCTTTCCTCCTGCAGGTGGAGACCGGGGGCTTGAACCTGGGTC
CTTGCACACTGTAACATGTGCACTCAACCAGATGTGCCACCACCTGTCCCGGACACCTGA
CAACTGACTTTTTGTTGTTGTTGTTGGTCGTGGTTATTTTTGTTGTTGTTATTGATGAGA
TATCAGCGCTTGAGCCCAAGACTTCATGTATGTATGTTAAGGGGCTGAGCTAGCCTTCAT
CCCATAGAAGCCCCCCCCCCCCTTTTAACTTGGGAAAATGATAATTCTTTGGACTTCTGC
CAGTGTGTACAGTTTCTTACCTCCCCAGGACAGCTGTCAGCATATGTCACCACCCTCCAC
TGTAAGACACCAGGTTCCAAACTCTACAGAAGTCAATTCTAAAACCCCCCCCCCCCAGTT
TGTTTATTATGAGAGAGCAGGACACACGACAGAACCATAGTACTACTCAGTGCAGCCAGG
GTTTAACCTTTAGCTTCTGTGGCCTCACACAATATAATTGGTGCTCTCTCTTTTTAAAAA
ATACTTATTTATGTGGTCCAGGAGGTGGCACAGTGAATAAAGCACTGGACTTCCAAGCAT
GAGGTCCTGAGTTCAATCCCTGGCAGCACATGTACCAGAGTGATGCCTGGTTCTTTCTTC
ACCTATCTTCCTAATAAATAATTAAAATTAATTTATAAATTAAATAAAATTAATTTCCTT
TTGTTGCCCTTGTTTTTTTGTTATTGTTATTGATGTCATCCTTGGATAGGACAGAGAGAA
ATGGGAAGACGGGGAGAGACAGACACCTGCAGACCTGCCTCACCACCTGTTAAGAGACCC
TCCTGCAGGTGGGGAACCGGGGCTTGAACTGGGATCCTTATGCCAGTCCTTATGCTTTAC
ATCACGTCTGCTTAACCCGCTGGCCTACTGCCCGACTCCCCATGGTTCTATTTCTGTAGT
ATTTTTCTCAGTATTGACTAATCTGTATTTTAGTGCAAGGTCACTCAAAATTCTAGCAGT
TTTTTTTTTTTTTTAATAGAAAAATATTAAACCAAGGGGTCAGGAGATAGGTCATTTACA
TGCCCTGTGCAAGAGCCATGGGTAGTATTTGGGGGAGCCTTGTGGATGATGGTGCAGTGC
TGTGGTATCTGAGAAAACTGCTCTGAGGAAGGTCTTAGTGGTGGTTTTGTATACCAGTGA
GGCTCTGACATTCACTAAGGAAGAAAGAAGACAAATTGACAGTCTGGTTTTAAAATTCAA
GTGACCTACAGAGGACAGAGTAGTGACAGTGAGTTAAAAAGAAACACATTTAGGGAATGA
GAGAGACAGGTTGGGAGTATGGATCAACCTACCAATATGCATGGTCAGCAGGGAAGCAAT
TACAGAAGCCAGACCTTCCACCTTCTGCACCCCATAATGAAGGAAAACTATCGGGAGGGG
ATGGAATACAGAGTTCTGGTGGTGGGAATTGTGTGCAGTTGTACCCCTCTCATCCTATGG
TTTTTTGTTAGTGTTTACTTTTTTATAAATTAAAACAAAACAAAAAAACAATTTAGGGCA
ACAAAGGGGGGAAAATGGCCCCCAGGAGCAGTGGATTTGCAGTGTAGACATTGAGCCCCA
GCTATAACCCTAGAGGCAAAAACAAAACAAAACAAAAAACCATTTTGCCAGGCTGTGGTG
CAGCGAGTGAAGCACAAGGACTGGAACAAGGATCCCGGTTTGAGCCCTGCTTCCCCACCT
GCGAGGGGTGGGAGTCACTTCATGGGCATTGAAGCAGGTCTGCAGGTGTCTGTGTCGTCT
CCCCCCCCCCCCCCCCCGGCCTTTCCCTCTTCTCTCCATTTCTGTCTGGCCTATGGAACA
CCCATAACAGCAACGGGTAACCACAGGGGCCACAAAAGGAAAAAGCCTCCCGGAAGCCGT
GGGTTTGTAGAGCAGGCACTGAGCCCCAGTGATAACCCTGGAGGCAAAAAAAAAAAATGG
AGAGAGAATAAAAAACATTGACGTACTAGCATTGTCTGATTTTAGAAGCTACTCTTCGGC
TTACAGTGGTATTGGCCCTGAAGTAATAGAGAATGTTACTGTGTTTACATCTCCACAAAG
GCATCCTGCTTTCTTCCTCCCAAGCAGCTACATCTTTGATAGAGACACAGTTTTTACCTT
ATTTTGAAGATGAAAAAGCTACTGAATATCTCTCCTGAGACTAAGAGTGTGATCCCCTTA
CCATTCCCTCTTTTTTAATAACTATCTTAATGTGCAATTGTTGATTTACTAATCTAGGCA
GATCCGGTCAGAAAACAAAGAAAAGAATGCAGTGATGTCTTTCACAGTTACAGATGAGCC
TGTCTACATCGACTTGGCTGTATCAGAAAACAGAGAAGAGGTAAGTGGCTTGTTTTTGAT
TTTCATAAATAGTAAGTGTCCCTCCCCCAATTGTGAGAGGGGGAGAGACCCCACAGAATC
TCTGCCATTCGTAGTGTTCTGTTTGCCTCTTTCCTGTTGTGGGGAGGGAGGGGGTAGTTG
GTGCGGGCACTACAAATACACTGCTCCTGGTTGCCATTGTTTTTGCTTTTTTTGGTTAGG
ACAGAGAAATTGAGAAAGGAGTGAGAAAGATAGACACCTGCAGACCTGCTTCACTGCTTA
TGACGCAACTCCCTTGCAGGTGGGGAGCCAGGGGCTCGAACCGGGTCCCTTGAGCTGGTC
CTTGTGCTTAGTACTAAGTAAGTACTTAATAGTACTTAATCCAGTGTACCACCGCCTGAC
CCGTTTGCCTCTTTTTGTCGTGAAGCTAGGAATGGAATCCAGAGTTTTCTTACATATGTC
CCCCACTACTGAGCTACATATTTGGCTCTCATAAATATTTTAGTCTCAGGGCTTTGATAA
TGTAATGACTTGGGAATGATGGGGTGTGTGGCAGAGAGAACCAGGAATAGCTTAAACCCC
AGATTGCTTGAACTCACCACCACACTCCTGGGGTGAGTGCTATAGAAAGGTATGGGCTGG
GTTGGTGCTGGTGCTCTGAAGAGGCCTGTGGAGTCTGTCCTGTGAGCTCTCTCATACCCC
GTCCAGGCTGCGTCCTCTCCATGTCTTTTTCTAGGCCTAAACTTCATTTTATAAGCCCGG
CAACAGCAATGGTTATTTTGATGACATTCTCCAATACATCTTTGTTCTAATCTCTTTTTT
TGGCTACAGTAATTTAAGGTACATCTCCCAGTAGAGTGACCAGTCATTTTTCTCTTCCAG
CCTGTCAAGCTAGCTGTTGTTTGCAGAGATGGTCAGCTTCATCTTTTTGAACACATATTG
AATGGGTAAGAAATTTTTCAAATCAGAAATGTATTTTCCTTGTTATTTCTTCCACTTCCA
CTTCTGTGTTTTGCATTAACTTTAAGTTTGTTTGAAGATCATTGTTAATTAGTGGTATGA
CTACACACATACCCAGTGATGACCCAAGTTTTTGGAGTTAATGAACCATTTCTTCATAAT
TGTGTTTAGGAGAATGACTTTATGACGGGTGCTTTGCAAACAGCCGTGGTAGTGGTAGTG
GTAACTGTTTTTGCCTCCTGTCTCTGATCTGCTTTATACGTGGGCCAGTGCTTGTGGCCT
AGCTCAGTGTCTTGGTGTTCAGAGGGAGCACTGCTGCTAGGATACACAGTAGTTAAAACC
AGGGCCAGTAAATTATGGCTTACAACCCAAGCCCAGTAGTGAGCATATATGCCCCATCAA
AACTAAAACAGTAGATTGTTGGCAAAGTCATGTCATTTTATTTTTTCTGTGTTTTATTTA
TTTTCCCTTTTGTTGCCCTTGTTCTTTTTCATTGTTGTTGTAGTTATTATTGTTGTTATT
AATGTTGTCGTTGTATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACGGGGAGAGAA
AGATAAAGACACCTGCAGACCTGCTTCACCGCCTATGAAGCGACTCCCATGCAGGTGGGG
AGTGGGGGGTGGGAAGGAGGCGTTAGAACCAGGATCTTCACTCCAGTCCCTGTGCTTGGA
ACCATGTGCGCTTAATCTACTGCACTATTTTGTCCCCTGATGCAGTCTTAAGAGCAGCAG
CAGTGCTCTGGAGATCCTAATCTCCCTTGATGGGAGTGTGGAGGTGTAGGGGAAGGCTAC
ATTTCATGAGATGTATTTCTGTCTGAGATCTTTCAACTTTTCTGATTTTATTTTTCATGC
CTAGGTACTGTAAAAAGCCTTTGACTTCCAATTGCACAATCCAGGTAACAGCACCTGGCA
AGGGCAAGAAATCAACGCCAAAGCCTATCCCGATTCTAGCAGCTGGATTTTGCGCAGACA
AAATGTCATTGCTGGTCGTATACGGCACTTGGTTTCAGCCTACCATTGAGCGAGTGGTAC
GTGGACGCTACTTGGAAGTAAAACTGTGATGTCCGAGGAAAGAAAGATTTTGAAGTGATC
CATCGATTTGCTTACTGGAGTGTTTGAGAATAAATCACCTGTATTTCCTTTAATTGAAGG
GTCTTTCACTAGCTACTTGAGTTTGTGAAAACTGTAATTGTACTTAACCCATATGAAAAA
TGTGATTCAGCCCTTAGTGACTATAAACTAGCGTGCACACCGGAGTTAGATGCAGTGCAG
CAGGACACAGTGTAGGGAAGCTGCTGCCGATGGGCGTGCTGGGTCTGGTGCAGGTTTCAC
TTTGTGAAACCAAACCGTCAGTGAGTTTTTTTAAAACTGCTGTGTCTGCAGAGCTAAGCA
AGGCATAGGCACGCCTTTCCTAGGCACTGCCCGCCTCAGTTTGCACTGGCCACATTTCCA
GAGTTTAGTTGGCACATGTGGTCAGCATAGGTATTGAGTGAATTTTCCCCAGTTGCCATA
GAGATTAGTCTTAATAAAAAGAAACCTTAGCAATAATACCTATTGAATTTACTTTCTCCT
CCCCTAGGTCTCCCATTGAATTTCCTTTCTTTTAAAATTTTTTTATATTTATTTATTTTC
CCTTTTGTTGCCCTTGTTTTATTGTTGCAGTTATTATTGTTGTTATTGATGTCAGTGTTG
GATATAACAGAGAAATTGAGAGAGGAGGGAAAGATGGGAGAGAGAAAGATAGATACCTGC
AGACCCACTTCACCGCTTGTAAAGCGACTTCCCTGCAGGTGGAGAGACGGGACTCAAACT
GGGATCCTTATGCCGATCCTTCCGCTTCGTGCCACATGCGCTTAACCCACTGCACTACTG
CCCGACTCCCCCCATTGAATTTTCTAAGTGGGAAGTACTTACAGTCATACAGTGTTTAAT
ATTCTGAATGCAGACATTATCTTTAGAGCTTTCTGGTGAGAAAGATGAAGGAAGTGTGTC
CTCTAGGCCCTTTTTTAAGCCTAGATTCATATCATCCTATTTAGTGAGGCCCCCAGAAGA
CATGAGTGGAAAGAACTGGTGGGGTGCAGTAGGCACTTATTGTCCCTATGCTCACTGCCC
CCCCCCCACGCTACATTGAAATAATAAGCGAATCAGATTTCTTTATCATTATAAACATTA
TGCTAAGCATCCTACTTACCTTTTAAAACTGTTTTCCCAGGCTTTAAATTCCAAAGAACC
TCATATGTGTTTAATAAGAGATATTTCAAACTGCTGGGCCCCAAAAGTAGAAACAGCTAT
AACAAAGGTGAGTGCATTTTATTTTAGAAGTCATGAAAAAATATTTGGGTGAATTGCTGT
TGAATATTTATGTTCTGGCCCTTTTTGTGTGCCCTCTTTGCTGCCTTCCTCCGACTGCAT
TGTTACCCGAGTGAGGAATTATGTACGAATCAACATCAGATTTGTTAATACTTTCTCTTA
AAAGCATTGATACTTATGCAAGTATTATTTGCCCAGAAATGTTAAACTGTAGATGATTGG
GCTGGGATTTAATGTTACTTGGAAGCAGTGTTGTGTTGTAACTCTGATGTGGCTTCTCCA
TGTAAACATCAGTTGCTTGGTGGCATTTTGATGAGAAAGGGGAGGCCAAGACCTGCTATG
ATGACACCCACATATGGTTTCGCTTCTGGCTGAGCTTCAGAGATGACACCTTTCTCTTGG
CTGTCTGAGCATTTCTGGCAAAGATTGATGTTTGGGGATGATTATGTGTAAGTTTGGAGC
CTCAGGCATGAAAGTCTTTTTGCACAGCCATTAATGGCTCTCCCACTTAACCCACACCAT
TGTAAAAGCAGTGTCTCCAGATTTTTATTTTGATACTGTATTGCAAACTTTGTAACTTGT
TTATATTTTCATTTGTATTTTATTTATATTTGTTTATATTTATTTATATTTTATATTTTC
ATTTGTCATTTAATAGTGGTTTACAAGTTGATGTCACGGTAAAGTTCTCCACTGCACCTA
CCACCAGTTTTGCATCCCCATCTTGCCAAAGATAACTACTTAGCTGTGGTTAAGATGTAT
CATTTAAAAACTACATTTGCCAATATTCAGTTAAGCTTTATCTTTAGGACCTGGGAGATA
AGTCAGTTGGTGGAGCACGTGCCTCCCCATACTTGAGGCTCTGGCTTCAATCCTGTGCCA
CTTGGGAACACAGGACGGCACCAGGGGGGTTGCATAGATGGCGGCCTTGTGCTTTGGTGC
CCTCTTTCTTCCTCTTCTTCCTTTCCTGTCTCTGCCCCCAGCCCCCATTCAAATTAATAA
AATAAAAATCAGGTCAGGGAGCTATCTAACTGGCCATGCCCATAGACAAGTTACTGGGTT
TATACTCCATCACCACATTAAAGGTGCTAAATAAATAGCTTATGTTGAATTTTATAATAG
AAAGACCACTTTTTAAATTATCTTTATTGATTGGATAGAGACAGTCAGAAATCGAGAGGG
AAGGGAGGGACAGAGAGGGTGAGAGACAGAGAGATGTTGTTAAAATTCGTGGGCTCTAGC
CGGGTTGGCTTCACGGGCGGGTAACAGAGACGACCAGAGAGACATGCGGCTGGGCAGGGA
AGCTGTATTTCTTTATTCAGGAACGATTCATAAACTAAAGCAAACTAATCACCAAACAGA
ACTCTGCTGTCTCTTTGCGGCGGCGCAAGCTCTCTCTCTTACTCTGCAACTCTCCAACTC
TTGAACTCTGGAACTCTCTCACCCTTTCTCCGGGTTCCTAGGGGCGGGGTCAAGCGGGCC
CACGAAACTAACTGGACTGATCCAATTCTCTTGGCGGGGGAGAACTACCCAATGTAAAGC
ATACAACAGAGAGACACCTGCAACACTGCTTCAACACTTGTGAATCTTTCCACCCAGGAG
GTGGGGCCTGGGGTCCTTGCACATTGTAACATGTGCACTCAACCAGGTGCTCCACCGCCA
GGCCCAGAAAGACCACTTAGAAGCTGCCCCATCATCATTGGGTTTTGCATGTTGTAAGGA
CTAGGGTATAATTGATTTCCTGGCTTTACACTTTTGTTGTCCCTGCTTAAACACAGGTGA
GGACACCAGTGATAAATTCTGAAGCAAAAGTTCTGGTGCCTGGGATACCCGGTCATCACG
CAGCCATCAAGCCTGCACATCCCCAGACTGAGGAAGGAGAGAGCAAAAGGAAATTGGGAG
AGAATGAGGTAAGAGGATCAGCGTGGTTGCTTTTGAAGTTTGCCATTACTCGGGAGATGC
TAACTTATTACTGTGTTTTGGAAGGAGTCAAAGTCAATAACAGGAATTCCTGGATTGCCA
TTGTTACCTTTTCCCCAGCAGACTGTGTTCTAAAATCCCCGATTTTCACCTCTTTTGAAT
TTATAAGTCAGTTGGTTATTTGTTAATAGTTAGCCGGGTAAACCCAAGTAAGTGAGTTGT
CCAGGACTCGCTGTGATGACTTCATTTGGTTTCGCTTGTTGCTGAGTTTCAGTGATGCCT
CTTCTCTTGGCTGTCTGAGCAGTCCTGGCTGGGCCAGTCAGTGTCCATTAGTTTCTGACA
GTGGTGCTCCTCACAACCTCTCAAACGATCGCAAACTTCAGAGACCCTTGCTTGGTGACT
GTCCTTGTCTGTGTTCTGCTTGTCTTCTTTCATGTTTATCACTCTAGTCTAAATGTAAGA
TTCTAACTTTAACCACGAGAGAAAGACTTTTTTTTTTAGCCTGATTTTGACTGTCTTTAC
TGGGTAGGGGATAACACATTTAGTCTGTAAAAATTAATCTTCAATTACATGGTATCTGTT
TTAAAATAAGGGGCCAGCTTTTTTTTTGATTTTAATATTGACTTAGAAAATTATGAGCCA
ACAGGTCAGTTTTCTTTACCATGGCCTGTTTGCACCCTTCCGCTTCCTTTTATACATTTA
GTTTTTTCTGTCATGATACCGTAGACAGATTGTCTTTGGTGGTCACAAAGAACATTGTTA
TTTAACTATCAAGGGACTGGCAGAATATGGTTTTTATATTTCTTTGTTTTATATATATAT
ATATATGTTTCAGAGTATGGTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGAGGGGGAAAAAAGAAAGACAC
GGGTAGCCCTGCTTCACTGCCTGGGAAGCTTCCCTGTGGGTGGTACCCTTGGGCATGCAC
GGCTGATATGTGCGTTTTATCTTAGGGCAACTACCACCTGGTACCCAGAATATAGCTCTT
CCAGTGATATTTTAATTTTCCTCCCCTCCTTTTAAAAGATCTTACTCATTTATTTATTTA
TTTATGAGAAAGGAGAGTGAGGGTGGAGGAGATAGCATAATGGTTATGCACAGACACACT
CTTGACTAAGGCTCCAAGGTCTCAGTTTCAATCCACTAAACTACCGTAAGTTGGAGCTGA
GCAGTATTCTGGTAAAAACAAACAAAAAACAAAACACACATAGGAGAGAACCAGACACCA
CTCTGGTTAGTACATGTGCTGCCAGGGATTGAACTTAGGACCTCATGCTTGAGAGACCAA
TGCTTTAACCACTGTGCCACTTCCCAGACTATTTTAATAATTCTTTCTGGCGTTTGATGG
TTACGGATAAAGGTGGAGGTGCTTCAGTGACGCTGCACATCTGTGCTTGAGATGCTACTG
TTGTGCTCTATTTATTTTTTAAAAAAAGATTTTGTTTATTTCTGAGAAAGATAGGAGAGA
GAAAGAAGCAGACATCACTCTGACACACTTGCTGCCAGGGATCGAACTCGGGACCTCATG
CTTGAGAGTCCAAAGCTTTATCACTGCGCCACTTCACAGACCACAACTTTATTATTTTTT
AAATTGCCATCAATAAAAACCTGGGTCTCGGTTTTTATTGCTGGGTCTAGGTGTCAGCAG
TATGAGTTCACCAATCCTGGCAGACTTTTTTCCTTTTTCCATTTATTTATTTTCCTTTTC
TATTTTACTTGATAGGAAAGAAATTGAGAGGGGAGAGAGAGAGAGAGAGACACCTGCAGA
CTTGCTTCACCACTTGTGAAGCTCCCCTTCCCCACCCACATGCACACACACAGTTTGGGA
GCAGGTGCTCGATCTGGGGTCATTGCACACTCATTTATGAATTACTTTTTGTGAATTGTG
GCTGCTTATTTGTTTTTTCACAAGCATCTGGGAACACGGGTTGTGTAAACATTAGCTTTA
TGATAATAAGCCCCTTCTGGAATGTTAAGAGCAGAAGTCGGGCTCTTCAGGGGTGGGTGG
GAAATTGGTAGTGCTCGTTTCCTCTTGAAATGTCACTCCTGGCCTGGTTTAACAGCTCGT
TTTTGTTGTAGACTAGCATTGAAGAACGCCTGGGTGCACTGGATATAGATGCGAAAAAAA
GAAAGGAAGATCTTCCACAGACAAATAGCTTCCCCGTTCTTCTCGCACAGGGCTTAGAAA
GTAATGACTTTGAAATGCTAAATGTAAGTATCAGCAGTTTTTACATTGTGATGGTTAAGT
TTCCTTAGAAAGTGGTTGACATAGCACAGTCATAGGAGGAGGAGCCATGCCGTGGAGCAG
CTGTCCATTTCATAGTTTGAGAGATTAGGCAGGTGTGCTCCTTGGGGGCTCTCTGCAGTC
ACTAACCTACAAAGGGATTGTACTGAGCTATTTTGAACCTGGAATGCATTTTCTCATAGA
AATTCTGTTCTGAATTGTTTTTAGCTTCATGTGAACATAATGTAGCTGAATTACCGTACT
CAGCATTCTAGATCACAATTTATATTTTTTTCTGTAGGAAAATGCGTTCCTGAGTTTTTA
CTCTGGATTCCAGAAACTTATTTCCCCCTGGCCGTGAGAGGGGGCAGTGAGGTGGCACCT
TGGCAATGGGTAGGAGATTTGGTTGAACAATTGAAGAGGGCTGGGGGTTCTGGCATGAAG
TGTTAAGTGGGGAGAGTGCTAGAGCTGGTATGTTTAGGGAGTCACTTATAATTTCTCTGT
ACGTTGGTGACTGTAAAGTTCCTTAATATGATTCATAGAGAAAATGCATAAAATTTGGAC
TTGGACACTGGTCAGATTAAAGCAAAAAACACTTGCCGTTCTTTTATTTCTTGACACATA
TGCCAGTTAGTGTAGGTGTGATGTTACTATATAGTCTGTAAATACTGCCTATTTTTTTCT
TTTTGCTTGTTTCTGAGGTGATTTGACTAAATGAGAGAGTGCTGAAACCTAAACACTTCC
AAACAGTTCCTCCATGTGTTTGGGAGGGGCCGGCTTTGAGTTTAGCATGGCCTCGAAAAA
TAGGATGGGGTTGGTGGAAAATGAAACAAGTGATGGTATTTTGAAGATGTAACATAACCT
GCTGTCCCACCGCTTTGGCCACCCTTTGAAACTTGAAGAACCAGAGCTTTACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCTGCTGATGAACCACTCAGAGTCT
GTATCGAGATGAATGATCTCATACTGATACAAAAGTCGGCACAACAAACAGTGTAAACAC
AAGCCGTAGGGAGACGTATATGTGAATTTGAGTAAAGGCTTCTTGATAGGCCAGAAAAAC
ATGGAGTGTTTGGTTATTTAGAATTTATGGAAATTCCTCCTTTGAAACGATACTTTCAAG
AGAATGGAAAAGACTAACTGCACTCTGGGAAAAAGTATTTGTAACTCATATGCTAGACAG
AGCGTTTATATATCCCAAATATGGTAATGAACCCAGCAAATGGTAACAGTTTGAAAAAAA
TCACAAAAAATTATTTGAATGACATCATGCCCATGCACAGGTAACTGTTTTTCATCATAC
CAAATGCAATTTAAAATCACATGATAACACTCCATAGCCAGCACTGATCAAAGATTTTTA
CTGCTCCCTGCTGGTGAGAATGTGGAATAGCTGCAATGTGCATGTTTAAGCACCCACTCA
GCACAGACCCAGCCAGTGTGATCCTGTTGTGCTGAAGAGAACAGTGAACGTAGGCTGGCA
CAGGACTCGGGTATGAATGGATAGAGCAGTGTTAATTCCAACAGGCAGGATCTGGAAAGA
ACCCACCTGGCTCTCATCAGATGAGAAGTACATTGTTTACCTGGCAGTCACAGGAACAGT
TAGTGATAGTCACTGGAGACCGCACTGCTGAGCCTGTTAGAACTAGAATTCAGTTGCTAA
TTAATTAGTTTGGTCTTTAAAATTTCCATCTGAAATTTATCCCGTTGTGACTTTAGCTCC
TGAATATTATTTTCTTACAGAAAGTACTTCAAACTAGGAACATGAACCTAATAAAGAAGA
CTGTGCTGAGGATGCCCCTGCATGCAGTCATTCCATTGTTGCAAGAGGTAATTGAGCCCT
GACACCACAACTACAAAGCCTAGTATTTAGAGAAAGAGATTTCAGTGTGTACAGAAGCAA
AACATCAGAGGGTAGAAGAGAGATGATTAGGCAGGAATCTTTTGGATGGAGACAGAAAGA
CCGAGAGGGGAGAGGAAATGAGAGAGGCAGAGACCCGTGCAGCCCTGCTTCACTGCTTGT
GAAGTGCTCTCCCTCCAGGGGTGGCTCGGATCCTTGCACACCACCACAGACCAGAGCTGA
GCAGTGCTCTGGTAAATAAGTAAAAACTAAAAATAAATAAAATAGTATAAAGTCAGGCTT
GTTTTCTCAGATTGTGCAGAGATCTAGACCCATCAGGAGCATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGGGAGAGAAAGAGACACC
TGCAGACCTGCTTCACCGCTTGAAAGCAACTCCTCTGCTGGTGGGGAGCCGGGGGCTCGA
ACCGGAATCCTTACACCGGTCCTTGTGCTTTGTGCCACATGCACTTAACCCTCTACGCTA
CTGCCTGACCCCCCTTTTCCTTTTCTTCTCCTCTCCCCTTTTCTGTTCTTCTCTCTCTTT
CTGTCTCTTTCTGTGTCTCTGTATGTCTCTCTCTCTCTTTTAAGATTTTATTTATAAGAA
AGATAGGAGAGAGAAAGAGCCAGACCTTACTCTGGTACATGTGCTGCTGGGGATTGAACT
CAGGACCTCATGCTTGAGAGTCTAATGCTTTATGCACTGCGCCACCTCCCATAACACTTT
TTTTTTTTTCTCTTTTCTCTCTTGAGGATAGGAAAAGTTTATTGGAGAGAATAGTACCCT
CTCCAGAAAGGAACACTGGCCAGGGAGTAGGGTCTGCTTGCTATTTCTTTGTTAATAGGC
AATTTGCTCAGATACCATGAGCATAAAATGTAGTCAGTTGAGATCAGTTCAATGAAAAGG
TAAAACATGAATTTTATTTTAGGATTGTGGGAGAGGGAGGGAGTTTTGTCCTGTTTCCAG
TCTATTCTTTGCCCTTGTCTTCCCTAAGAGGAAATTAGATCACACAGACCTCAGATGGTC
ACGAAGGGGGAAAGATCCTCAGGTCTGCAGTGATTTTAATTATTGTCATTTTCACACAGC
CCAGTTTATAGATCCTTACTTTGTCGACCATGTTTATGATTAAAAAAAAATTTTTTTTTT
CATTTTGTTCCTCTGGTAAATTTATTGTGTCTATAGATTCACTTATTTATTTCCCCCCTT
TCTCCTTGTTTTTTATTTTTGTAGTTACTTATTGTTGTTATTGATGTCATCATTGTTAAG
ACAGAGAAATGGAGAGAGGAGGGGAGGACGGGGGGAGAGAGGAAGATAGACACCTGCAGA
CCTGCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCTGGGGCCTTGAACTGA
GATCCTTGTGCTTTGTACCACCTGCGCTTAACCCGCTGCGCTATCTCCCGACTCCCTTTT
AAAAAATTTTTATTTATAAAAAGGAAACACTGCCAAATCATAGGATAAGAGGAGTACAAT
TCCCATCACCAGAGCTCTGTATCCCATCCCCTCCCCTGATAGCTTTCCTATTCTTTATCC
CTCTAGGAGTATGGACACAGGGTCATACTCAGGGTCATTATGGGGTGCAGAAGGTGGAAG
GTCTGGCTTCTATAATTGCTTCCCCATTGAACATGGGCATTGACAGGTCGATCCATACTC
CCAGCCTGCCTCTCTCTTTCCCTAGTGAGGCAGGGCTTTGGGGAAGTGGAACTCCACATT
GGTGGGGTTGTCTGCCCACCAATGTTTGTTTATTTTAGCATGGCATCATGTTAGCATCTG
GAACTTGGTGGCTGAAAAAGAGTTAACATGTAAAGCCATATTCATTGTTGACTAATCATG
AACCCAAAGGCTAGAATATTGCAGATGAATATTTGGAATCTGCGTTTTGGAAATAGCTAG
TAAGTCTATTTTAGGTATATTTCAAAGGGCCCATGAATTTATTAGTTTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCCTATCTTTCTCATGAATAAATACATTTTTTTTAAAAAAGATTCTTATTAAACACACC
AGGGAATGATAATGTGAAATCACATAGCAAGTAGTTAGTAGTAGTGATACTTGATGGCTA
ACATTACTCTCATAAGTTGAATGATTTCTCTCCCCCCTGCCCCCATACTGTTCAGCTGTG
GCTTATGGTGGTGCAGAGGATTGAACCTGGGACTTTGGAGTCTCAGGCATGAGAGTCTCT
TTGCCATAACGGTTATGCTATCTACTCATGCCTGAATGATTCTTTTAATTTAATTTTTAT
AAACTATTTAATATTTCTTTTTCCCTTTTAATTGCCCTTGTTTTTTATTGTTGTTGTAGT
TATTATTTTTGTTGATATCGTCGTTGTTAAATAGGACAGAGAGAAATGGAGAGAGGAGGG
GAAGACGAAGAGAAAGATACCTGCAGACCTGCTTCACCGCCTGTGAAGTGACTCCCCTGC
AGGTGGGGAGCTGGGGGTCTTGAACCAGGATCCTTATGCTGGCCCTTGTGCTTTGTGCCA
CGTGCACTTAGCCGCCCACTGTGCTACCACCCGACTCCGAAACTTTATTTATTTATTGGA
TAGAGACAGCCAGAAATTGAGAGGGGAGGGACAGATACCTGCAATACTGCTTGACCACTC
ACAGAGCTTTCCCCCTGAAAGTGGGGGCCAGGGGCTCGAACCTGGGTCCTTGAGCACTGT
AACATGTGCGCTCAACCAGGTGCACCACCACCCCTCCCCCTCCTCCCCTTTAAAGACTTT
TTAGAACCTGACATTTTTTTCTCCTTTATTTTAGGAAACATGTAGGTTTTTTGACTTTAT
TATTAGGTCATTTAATAAGTCTAACTTAATGGTTTAATCTATCATGATATTTAAAGCTGC
CTTTTGGGTCTGGGTGGTGTACCTGGTTAAGCACACATGTTACAATGTTCACGGACCCGG
GTTTGAGCCCCTCCATCCCCACCTGCAGGGGGAAAGCTTTGTGAGTGGTGAAGCAGTGCT
GCAGGTGTGTCTCTGTCTCCCTTTTTCTCTCCCCCTTCCCTTGGGCTGTCTCTATCTGAT
AAAAAAGATTAAAAAAAAAAAGTTCTATTAAAAAAAGCTGCCTTTCTGGTGGGCAGATAG
CATAGTGCTGATGCAGAAAACTTTCATGCCTGAGGCTCCAAAGCCCCCCCAGGTCCAGTC
ACTGTCATGACCACAAGCCAGAGCTGAGCAGTGCTCTGAAAAGAAAAGAAAACGTCAAAT
TACCTTTCATAGACTTCCCCCCAACCTCTTGTAGTTGCTAATGTACAAAGAAATGCTTCA
TAAAACTGTTTTGTGGGTCTTTTTTTTTAAACAACTCTATGGTCCATTTAAATAGTAAGT
TGATGCTGTGTAGATCCTTAGCCATATAAACCTATATGGTATGGTCAGTGCCTACAAGGT
TTAATTTTTCTCATTTTAGTTTATGTATTGGATAGAGGCAGGAAATTTGAGAGGAAGGGG
AGATAGTGGAGAGAGACAAACACCTGCAGCACTACCTCACCTGCTTGCCAAGCTTTCTTC
TTGCTTGTGGGAACTGGGCATTTGAACCCCAGGTCTTTGTCCATTGTCACAAAGTGAGCC
ACCAAACACCCCCACTCCTTTCATTGGTCTTTGGAGTTCACACAGGAAAGCTCAGAAACC
CACCAAGTAGACACACACTTGTTGTGTGGCTTTTAATGTTGGCCTGGAGATCTTGCAGCT
TCTTCCACCCCCTCTTCTTCTCCTCCCCTCCCTCGTACGCCTCAAAATACTCAAGCTTTT
GGTCCCTCGGCACTAGGGTTAAACAACACACATTCCCCCCACTTCTTAGTGACAATGTCT
TGTCGAGAGGGGAGAGAGATACCTAATGATGAGTAAGTCGATCTTGATAATTATAATAAT
CACGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGAGAGCGTAGCTTCCAAATATGGGAAGTTG
TATAAATACTGTTAACTGGTTTCTGATTTTCTAACAGTTGTGCTTAGTTTTGCATTCATG
GACATCAGTTGACTTGACTTTCTCTCTCTTTTTTAGTGCTGTTTTGATGATTCAATGGCT
AAAGTGTGTATTAACGGTCCACGCCTCCTACCTGTCTACAGTAAGTCTTTCCAGCACCTG
GTGCTGCTTAGCTCAGCTTTGGTAAAGATTACAGACTGCTGGCTTGACAAAACTATCCTC
CCTTCATCTGTCCTTCACCATCAACTCCTTGTAGAGATTTTGGTTTCTCCAGGTACAATG
GCATAATGTCCATAGCCAACTTTTATAAATCGACCTTTCCCTTGATTTTAAAAGTAACCT
GTAATCTAGCGAGAAGTTTGAGAAATGCAGAAAGGAGAAAAGTTGCACGTGAATCTTTAG
ATGTTTTCTATAAACACAGACTGTTTGGTGAAATTGTGTGTTTGAGAATTTTTTCTGTCC
CCCTTAAATATGGCAGTTTTTTCTGTCCCCCTTAAATATAGCAGTTTGGGGGCTGTTTGG
ATGGTGGCACAACTGTTAGAGCATGTGTGTCACAATGCTCAGGGACCTGGGTTCAATCCT
CTGGCCCTCACCTGCTGGGGAGAAAGCTTCATGAGTGGTGAATCAGTGCTGCAGGTATCT
TTTTTGTTTGTTTATTTTATTTTTTATTTATAAAAAGGAAACACTGACAAAACCATAGGA
AAAGAGGGTTACAACTCCACACAATTCCCACCACTAGCTCTCCGTATCCCATCCTCTCCC
TTGATAGCTTTCCTATTCTTTATTTCTCTGGGAGTGTGTACCCAAGGTCATTGTGGGATG
CAGAAGGTGGAAGGTCTGGCTTCTGTAATTGCTTCCCCACTGAACATGGATATTGACAGG
TGGATTCATACTCCCAGTATGTCTCTTTCTTTCCCTAGTAGGGAGGGGCTTTGGGGAAGT
GGAGCTCCAGGACACACTGGTGGGGTTGTCTGTCCAGGGAAGTCTGGTCGGTATCATGCT
GGCATCTGGAACCTGCTGGCAGAAAAGACAGTTAACATACAAAGCCAAACAAATTGTTTA
ACAATCATGGACCTACAGGCTGGAACAGTGCAGATGAAGAGCTGGGGGAGGGGGGGGTTG
TCCTCCATTCTGTAGATAGCTAGTAGGCATATTTTAGTTATATTCCAAAGGGCCTGTGGC
TATACTAGTTTTTTTTTTTTTTTTTTCTTCCCCTGAGCCTGAAATCTGATATGCCAGTGG
ATCCAAGTTATTATCTGGGGAGATGATGCCATGGCTGGAAAAGGACCAGAAAGCTGGATC
AGGGAGAGAGTAGCCCCCTGATACAGGAAAGGGGCATAAATATTGTTGGCTGTAAAAGAG
TTCAGCAAACTTAGCAACAGAAAAGCAAATGCCCCATTCAAAAATGGGCAGAGGGTATGA
ACAGCAGGCATCTTTTTATCTCCTCTTTCTCTCTCATTTTCTCTGTCTATCCAATTAAAA
AAAAATGAGAATGTAGCAGTTTCCAAAGTTTGTGTGTAGACTGACAGGTGGCCCTGAGGA
TAAAGTAACTTGTGAACTATTTTATGCCTGGCAAATATTTTGCTGGGGTTGTTACTAACT
CTTGATTATGCAGATGGGAGGGAAGAAGCATTTAACCTCTTTGTGAACTGGGTTTGGATG
CCTGTATGACTCCACCATTCCCAGAAGTTTCCTGCTCACCTTCCCCTTTTAGATTTTAGA
GGGAGGAGGGGGGCACCTGCAGCACAGCTCCAGCTTTCTTGAAGCTTTGTAGTGCAGGTG
GGGTCTCGGGCAAGAAGACCTGGGCCATCACCCAGGAGTGTAAAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCATTTAACCTCCTTTGTGAACTTGGGTTTG
GATGCCTGTATGACTCCACCATTCCCAGAAGTTTCCCTGCTCACCCTCCCCTTTTAGATT
TAGAGGGAGGAGGGGGGCACCTGCAGCACAGCTCCAGCTTTCTTGAAGCTTTGTAGTGCA
GGTGGGGTCTCGGGCTGAAACCTGGGCCATCACCCAGGAGTGTAAAATCTCTCATTTATT
TTTACCGTTGCCGTGCTTTTTAAAAAAAAACCCCATAAATCTGGCTTATGGTGGTGTTGG
GGATTGGACCTAGTACCCCCAACATGAAAGGCCCAGGAAAATAATTGTGTTACAGTATGA
GCTGTGTTTTTTGCCACACCATTGAACTAGTTACATTTCAGTCTAGAGATAACTGTACAG
CTTACTTTTCTCCCTTCTATTTGGTAATCTGTCAACTTTTAATAGGTTTTCTTCTAAGTT
TGTAGTGGGTAGTGAACAGAATTGGTTACTGCTCTGGAACAATAGTCTTTTCTTGACAGT
TTGTCCTGGCCGCACACCCTGTCACTATCCCTTGCCCGTCTGTCTTTGGTAGTTTGAATT
AGGGAAGAGTACCGGGTGACTTGTTTTGAGGTCACCAGGCTATTCTTGGAAGGTCTGTGG
TGATTGCTGCCAAATTGTTCGAATGGAGGAAGAGACAAACAGCAGATAACTGACTGGCTT
TTCCCTCTTGGGAGCTGATAGTGGCTGAGCAGGATGGTGACAAACGTAGGCAGGTCACCA
CCAGCCTCAGTTCTGGGGGCTCTGGCCAGTAAACAGCACAGCTGCCATTTTGTGGCCCCA
TTTCCTTGGAACTGACAAGGTCCTGAGTAGGCCCTGTGACGGATGCATTGAGCCCCCTGG
CACCCGCTCCTCACGTAGCTGCTAGTAGTGGTGCGGCCTTCTGGCTGAGACAGCAAACCA
AAGGACCCGTAGAGGGGGATGCCACAGCCCACAGCCACCTTTAGAAAAGTGCTTTTCCTC
CTGCCTTCCCTTCATTTCTCCTCCCGACCTTCTCTCAGCCAGGACTGTGGTAAGCAGAGG
GGCTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAGTGATCCCTTTCTCCTGCAGCTGCCTGACCTCGTACCCCAGT
TGGGTACACTATACCAGTTAATGGAAAGTAGAGTTAAGACTTTCCAGAAGCTGTCCCATC
TTCACGGAAAGCTTATCCTTCTAATCACACAGGTAAGTAAATCAAAATGTTTGTGTTCAC
TTTGGGACGTAATAGGAGTGAAGAGAGGAATACGAATCATTTATGCGAGCATTAAAAGCT
CCCTGTTTTGGCTTTAAATAAAAAAGGCAGTCAGGAAGGATTTAGTCTTTGACTTGGAAA
TGCCATCTGTTCGATAGTGACCAAACTTTGTTGTACCTGTTTGAGTTTCTATTGAATGAA
TCTCAGCTCTTAATTTTAAAAGATCTTTTAAGGGAGTTTGGCGGTAGCGCAGCTGGTTAA
GTGCATGTGGCGCAAAGCGCAAGGACCAGTGGAAGGATCCCGGTTCGAGCCCCCGGCTCC
CCATCTGCAGGGGAGTTGCTTCACAAGCGGTGAAGCAGGTCTGCAAGTGTCTATCTTTCG
CTCCTCCCTTCTGTCTCCCCATCTCTCCATTTCTCTCTGTCCTAGCCGACAACGACAACA
ATAACAACAATAAAAACAAAGGCAAAAAAAGGGAATAAATAAATATTTTTTAAAAAGATC
CTTTACAATACTTGTTTATGGGATAGAGACAGAAATTCGGAGGGATGGGGAGATAGGGTG
AGAGATAGATGCCTGCAGCCCTTCTTCGCTGCTGGTGAATACAGTCAGGATGGTGATGGC
ACCAGGAACAAGTTACAGGATGTGTATGTGGTTTTCATTTTGACACACAGAAATTCAATC
ACCTTAGAGGTTTTGAGCCTCATGAAATAGCTTTCTTCTTGTGTCAGGTGATTTGTCACC
TGCTCCTGACTTGGCCCACATTTTATTTTGGCCTTGTACTGAAGGTGAATACACTCTTTC
TTTCAGGTTACAGCATCAGAGAAAACAAAGGAAACAACTTCTCCCTCGCAAAAGGCCAAA
CTGGTATATGAGGAAGGTGAGCTGGGCTAGCGCAGCAATGTTGGCTTTCACAGTCACGCA
GGTCTGTTCCCACATAGTGGGAAAGTGTCAGTGCCAGCAGAATCATGCTTGGGCCACATG
TTCTCTGATAACGGGCAGGTACTGACAAAACACAAAATATGGCCAAGTAAGAGTGAGCCA
CCTCGCTATACCCCCAAACCCCTCGCTCGCCCGCCCGCCTGCCTGCGTGCGCCCCGCCCA
GCCCGCCCGGCACTGGGGAACAAGTCCAGCACTGCACGCTTGGTCATACAGAGCAATCTT
CCTGGCTGTTAACTACTTTTCCATTCTGTGTCCTGAGAGGGGAGGAGGGAAACACCAGTG
TCCTGCCATTGATGAAGTCCCCCGTGATGGTGCTTTCCATGTGCTGCCAGGGATTGGACT
CAGTGCCCAGGCATGGTGTGATGTGCACTCTGCATGCCTTGAATATAATCTTTCTAAAGT
ATATATGCATGTTTTAGGACTATGCCATCTGCTTTGGCTAAAGTAAAGCTGTTTTTCCTC
CCCTTGTAGAATCTTCTGAAGAGGAGTCTGATGATGAAATAGACGAGCACGATTCTGATG
TGAGTAACTGAGCCATTTGTTTGCCATGACATCATATGCCTTTACATCCTTACACTTGAA
GAGGGAGTCCTTGCTGAGTCCTCTCCTTGTTTAATGTTTCTGTTAGGATGATTGGGATGA
AGATGATGAAAAAGAAAGTGAAAAAGATGAGGATCTTGATGAAGAGGAAGAATGTGCTGA
AGAAAATGGTGAGGACAGAGAGGTGACAAGTGAAAAAGAATTAAATGGAGATTCTGATTT
AGATCCTGAAAATGAGAGTGAAGAAGAATGAAGACAGTAGCCGATGGAACTGTATAAACT
CTGGCTAACCTTAGTCCTGGGAAGGGTTTTTCTCTGACAGGATGCCAATGACTGTCGCTC
GTTTCCAGATTTCTACCAGTGGCTCTGTGCCACCTGCTGTCCTGAGCACCCAGACATAAC
TGTGTAAATAAGAGGGTTTCATTCAAATGTTAATAAACTTTACACAGTAAATAGCGTTTT
CTGCAGTGTACTGACGTGAGCGTTCACATGTTTATTTTTATAATAGCTGAGTGTGGTTGG
TTATACCAAGAATTGATCCGAGTGAAGAGACTTCTCCCACAGGAGGCTGGGCGACTAGAC
TGTGTGAAGGAGTTAGCTCAGGCTGACATCTTTCATAAATTTAAATCCAGTGAAGACCAT
ATTTTAATCTGGCACATTTTCATATAATGGGGATGGCTAAAAACTGGAAGACAAATTGAT
TTAAAAAAAAAATAAATCACCAGTTTCCTTAGCTTTTGCCTGTCCACTGTGGTAATCTGA
TTTGAATCAGATTGAATGTTTTCAAGTCCTTCCGCAGAACAGCCACTTTTAATTTATCAT
GTGAAGTATTAAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 1015..1020, 1022..1045, 1048..1059, 14085..14375, 15614..15751, 15852..15973, 20490..20610, 21295..21438, 23881..23979, 24840..24904, 25804..25975, 27160..27246, 29036..29167, 31691..31822, 33680..33766, 35454..35485, 43236..43299, 48638..48751, 49566..49635, 50169..50218, 50326..50490
1001..1012, 1015..1020, 1022..1045, 1048..1059, 14085..14375, 15614..15751, 15852..15973, 20490..20610, 21295..21438, 23881..23979, 24840..24904, 25804..25975, 27160..27246, 29036..29167, 31691..31822, 33680..33766, 35454..35485, 43236..43299, 48638..48751, 49566..49635, 50169..50218, 50326..50487
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved