Erinaceus_europaeus Locus TFB2M
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus TFB2M
Erinaceus_europaeus
TFB2M
GeneScaffold_5940
SNORA38
7069..7179
13205
CGCTTTAATCTAGATTTTAAAATTTCAGTTTAACCTTTTAACGGGTACAGTACCCGGGC
CCGAGAAGAGTGGGAGGGAGCACTTGCGTTTCAAAACAACAAAGGGCGAGGGGCAACACA
GAGAACGCGGTGTTACACCCTTGCGCCCAGACGGAGATCGTGCGTGGGCCAGCACCCAGG
GGCGCGGGGCGTTGGCGCGGGGCGCGGGGCGCGGGGCGCGGGGCGCGGGGCGCGGGATCC
CGGCAGCCGAGCGAGGACCGACTTCTGGCGCGGCTCCCCGAGGGAGGGCGGAATTGGCGC
GATGCGCAGGAACCAGCCCCAAAGGCTGGAGAAAGGAAAACAGCAGCCGGGAGGGAGGTG
CGGGACCCGGCTCCACCTTGCGCGGCCGGCAGAGGCGGCGCTGCCCGCGGGGGGCAGTGC
CGGGGGAGGAGCGAGGGGGGGATCCGAAAGGCTGTCCGCCCCCGCCGCAAGCCCGCGGGC
CTCCTGCACCTCGCTCTGCTTCTCCTCACCTGGGAATCGGGGGCGAACAGAAGACTACCG
CTGGGCGCCCCGCCGGTTTCCAGCCCCACTCGCTGACATGGCGGCCGACGAGCTGTCACA
GAGCTGGCTCGGGTCTTCCGCGGCACCGGCGGAGGAGACACCTCTTGCCTTCCCGCCCCG
CCTCCCTCTGCGCACCCCTCCCGACTGGCCGGCGGGCTGTCCCCTACCGCGGAGCATAGA
GTGCAAACTGCTAGAGAGGAAGCGCAGAGTGCAGATGACCATAGAGTACGAGTCCAGACG
CAACCCGGAAGGTCCTTCTCTCTGCTCCTCTGTGTAGGGCGGCTGAGTCTGAACGGAAGT
GGAAGTGAGGGTGTAGGAGCAGTCGTTCGCATGCGCAGTTCATAGTGTGTACTTCCGCCT
TTCCTAGCAGAGAGTTACGGAGATGTCACACGTGGGGTGACCTGCAACTGTATAGCAGAA
GAAGCGACCCTGGATTAAATCTGAGTCGAACTTTAAGAAAGATGTGGGTCGCTGTCGGGG
CACTTTCTCCGCGGCTTACTCTGTCAGCCTGGACAGGCGCGAGCCGCTTCTGTCTCCTGC
GATGCGGAAAGACAAAGAGGAAGGACTTGCCTTTGAGGAACTGCCTTGGAGTGTCAGACT
TCAGGCAGTCTTTGTGGTCCGGTGTAGGTTTCGAAGACCAGATAGGCAAAAACCGCTTCG
ACCCCAGGCGTTACATAACCTGTCCGGAATTGGCAAAGAATATGGCGCGTGTAATTGAGA
AACACATAAAACCTAGCCCTGTGGTCCTGGAGTGCAGTCCAGGTAAGGTTGTCGTGAATT
CTATTCTCTCTTCTGAAGACTTTTATGAAACCCTTTGGGTCCCGTCTAAGATATGTCCCT
TTCCTTCAAATAGTAAGATTTGTATGAAACATGACACCCCACAAACAACGTTGCTGTCAG
TTAATGATTTGCGCAGTGCTCTTGTCAAGCATGCGCTTAGATTTAACCGTTTCCCCACAT
TTTTATCATTATTAGCAGAGCATTGCTAATGGTGGTGCTGGGGGATGAACCTGGAAACTC
GGAGCTTAAAGGCATGACAGTTCTTTGCATAATCTTTATGCCGTCTTCCCTGCGCTCTCC
CAAACAGTGGTAAATCCCATAACCAAGCACTTTGCTATCTTTGCTATCTCATATTCTAAA
GGCAGGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTC
ACTACCCATGAAGCAACCCTCTTGCAGGTGGGGAGTCAGGGCCTCAAACCAGGAGCCTAA
TTCTGGTCCTTGTGCTTGGCACCATTTGCGCTTAACCCACTGTGCTACTGTGCTACCGCC
CGACCTCCCACCCCAGAGTCTTTTACTTTGGTGCAATATACCAACTCCAGTTCGGGTTCT
ACTTGTGTTTTCTCTTCTGATCTTGTTTTTTCTACTTCTGCCTGTGAGTGAGATCATCCC
ATATTCATCTTTGTGTTTCTGACTTATTTCACTTAACATGATTTCTTCAAGTTCCACCCA
AAATGGGCTGAAAATGGTGAAATCACTATAATCCTCAGTTTCTTTATGGGTGACTGAGTA
GAACTATATCTATTTTGAATGATATGCAAGTTAAATGTATAAATAGCAGCCTAGAAAGTA
GTGCCGCAGTTAAAACATTGAACTTTCAAATAAGGTGCCAAGTTCCATCCACAGCACCGT
ATTTGCCAGAGTGATGTTCTTGTTCTCTCATTAGTAAGTAGATATATCTAAGAAATCAAG
AAAGGGGGCATCGTGCTGTAGTGCAGCAGGTTAAGTGCACTGGCACAAAAAGCGCAAGGA
CCGGCACAAGGATCCCGGTTTGAGCCCTCCGGCCCCCCTACCTGTAGGGAAGTCGCTTCA
CAAGCGGTGAAGCAGGTCTGCAGGTGTCTTTCTCTCCCCCTCTCTATCTTCCCCTCCTCT
CTCCATTTCTCTCTGTCCTACCTAATAATGACATCAGTAACAACAACTACAACAATAAAA
AATAAATAAATAAGAAAGGGTGGAAAGTGCTTATGCAAAAATACAGAAACAATTCTAAAT
AGGACAGTATATTAAACCATTATAAAAATGTATTCAAAGAAAAAAATTGAATACACTTTT
CATTCTATTACTATTCTAGGTCCTGGAATCTTGACTCAAGAATTAGTTGGACTTAGCAGT
AAAGTGATTGCCCTTGAAAGTGACAATACTTTTATTCCACAATTGAAGGTATGTGTTGAG
TTAGCTATCTTTGAGAAATTTAGAGAAAGAAAATTAAGCACACAATTTATTCTTATAGGC
TCAGCCTTTAGGGACCATGCCTTAAGTATCCTGTTAACTGTCCCCAGTGACTAAAACACA
GTAAGTCCCAGTGCTTGTTGAATGATGAAATATTGGGGGGTCAACAAGGGCAACAAAAGG
AAATAAATAAATTTTTTTTTTTTAAGATTTTAAACATTATATATATTAAAAAAAGAAATA
TTGGGGGTTCTGGTCTTAATGCTAGACTAGTTTGGTAGCGTTGAGCAAAATGTATATATG
GCATCTAGACTTGTTTCTTCGACTCAGAAATAGACTCTGATGTGCTCTTTGTGAGTCTAG
CATCTCCAGTTAAGAGCACTAAGATTAAACTGTGGAATTAGAGTTACATAGTCAAGAACA
GTTTTAGTTTTCTTTTTGTTTTGTTTTTTTTTTACTATATTTGATAGAGACAGCCAAAAA
TTGAGAGGAAAGGGGGAGATACAGAGAGACACCGACAACACTGCTTCATCACTTGCAAAG
CTTTTTCCCTGCAGACAGAGACGAGGGGCTTGAACCTGGGTCTATGCATATTGTAACATG
TGCGTTCAACCAGATGTGCTACCACCAGGCCCCCAAGAACAGTTTAGGCAGCTACAAATG
CATGGGATTAAAGTGTTATCCAAATGGATTTTTCAGTGACTTCTGCATCTTATATACCAA
ATGAGTTATCAATACAATGGAAAGTCCTTGCATCACTGGTTAGTTGGTTTTTTTGTTTGT
TTTTTTTCCCATTTTTTATAAATCTCTAGATTCATTTTAAGAAACATCTAAGGTAGCGGC
ACACCAGGTTGAATGCACATGTTATCATATACAAGGCCCTTGGTCCCCACCTATGGAGGA
AAGCTTCACAAGTGGTGAAGCTGTGCTGCACGTGTCTTTCTCTCACTTTGTCTCTTCCTG
TCTTGATTTCTCTGTCTCTATTCAATTAGTAATTTTTTTTTTTTTTGACAAAAAGAAAGG
ATCTTAAGAAATATCCAGCTGGGAGTCAGCCGGTAGTGGAGCGGGCTAAAGTGTAGGTGG
TACAAAGTGCAAGGACCGGCATAAGGATCCTGGTTCGAGCCCCCGGCTCCCCACCTGCAG
GGGAAGTCGCTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCCTC
TCTGTATTCCCCTCCTCTCTCCATTTCTCTCTGTCCTGTCCAACAACGATGACATCAATA
ACAACAATAACTACAACAATAAAACAACAAGGGCAACAAAAGGGAATAAATAAATATTTT
TTAAACTATATATATAAAAAAGAAAGAAAGAAAATAGTTCCTGTGGTTGGGGGGGAGTTT
CCAGGTGGTGGTTCACCAGGTTAAACGCACATAGTACAAAGTGCAAGGACCAGCACAAGG
ATCCTGGTTCAGGCCCCCGGCTCCCCGCCTGCAGGGGAGTCGCTTCACAGGTGGTGAAGC
AGGTCTGCAGGTGTCTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTC
TCTCTTTCCTATCCAGCAACGAGGACAACAATAACAACAACAACAATAATAACTACAACA
ATAATAAAAAAATAAGGGCAGCAAAAGGGAAATAAATAAATATAAATTTTTTTTAATTAA
AAAAAAAGAATAAATACAAAAGAAGACCGGACACAGTTCAGCAGCCGACGCTTCCCACTC
AAATAAGGGGCCACACTGGTCACGGACAGTTGACACCAACAACGGGACAGAGACCAGGGG
CCCTTTGCACAGGCCTCTGAGCAACTATTTAATGGGCCTGACTTGGGGCTGAGGTCAGCT
GGAAGCCTTGCTCGGGCCTCTCCGGATGCCGCCAGCGCCAGATCACCGCATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCAAGCCTCAGTAATAACCTTGTGGGCGGATGAAAA
GAAAGAAAGAAAAAAAATCCTTCTGCTATCGTCTCTGATATATCCTAATAAGCTATGGCC
AATACAATAAGAGCTAAGGTCATTTGGTGAAAGACTAAACTCTTGGAGTCAAAGGGCAAT
ATTCTCTTGATTATATCTGCCTTCTACTCTAATATTTTTAGTGCTTTTCTCTGCTATGAA
GCACCTTCTCATGACTATCAAAATGGGTTGCAACTCTTTGCCCAGATGTGGTCTCAAAAA
TCTGCTCACTGCTACTGAGTTCTTAGAGATGAACAAGAAGCTTTTTGAACAACTGAAGCA
CTGAGATAAAGTAAAGCAAAAGGATAAATCAAGCTTTATTGTATCTGCCTACAAAGGTGT
GTGTATGGTTCCATGTCTTTGGATAAATGAGAAATATGGAATTGGAGAAATCTTAGGCCA
GCTTGCTCCCTGCAGGCTAAAGATCCACCTTTCCACAAAAGCATGTGGCATTTAGTGTAT
CTCAGTCTTCCCAGTAGGATTTCAGAGATCAAGGGCAAAGAAAAAGATGGTTTCAAAGAG
AAGCTTAGTAATAAGACATAGAAGTTGTCTAAATGAAGTCTACAGTAGGCAACTATCAGG
TCTTCAATATGACATGTTTTTTCACCTCCCCACATTAAAGAAGAAAGAATCTGAAGGATT
TGTGATCTTTATAAACTGTTTAGATTTGAGGTATCTTTCTGGAGGTAATAGTTGTTTATG
TAGGAATAACTCTTTGGGGCCAGCGAGATAGCATAATGGTTCTGCAAAAAGTCTTTTATT
TATTTTTTATTATCTCTTTATTGGACAGAGACAGGAATTAAGAAGGAAGGGAGAGATAGA
AACGAAGTGAGACAGAGACACCTGCAGTACTGCATCACCACTTGCAAAACTTTCCCCCTG
CAGGATCTCTTTTTTGCCCTTTCTCCCTCTTAATTTTTGTCTATCAAATTTTTAAAAATA
TTTATTATTTATTCCCTTTTGTTGCCCTTGTTTTATTGTTGTAGTTATGATTGATGTCGT
TGTTGTTGGATAGGACAGAAATAAATGGAGAGAGGAGGGAAAGACAGAGGGGGAGAGAAA
GACACCTGCCAACCTTCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGGG
GCTCGAACAGGGATCCTTACTCCGGTCGTTGCGCTTCGTGCCGCGTGTGCTTAACCCACT
GTACTACCGCTAACTCCCTATCAAATTTTAATAAAATTACTTTGTAATTACTTTAAAAAG
ATTCGTAAGTATATATATTTAAAATAATTATTCTGGGGCGGGGTGGTGGTGCACCTGCTT
GAGCACACATGCTACAATGCACTAGGGCTCAGGTTCGAGCCCCCAAGTGGGGACCTACAG
AGGGAAAGCTTTGCAAATGGTGAAGCAGTGTTGCAGGTGTCTCTCTGTCTCACACTCTCC
CTTTCTCACCCTTCCCTCTCGATTTCTGTCTCTATCCAATAAATAAAATAATAGTAAAAT
AATAACTTTCAATTGTTACAAGCTTTTGCAGCACTGAAGTCTCTTAACATATTGCTTCTT
GTCTCTCTTTAGTCCCTACAAAAAAAACTGGATGGACAACTACAGGTGGTCTACTGTGAC
TTTTTTAAACTGGATCCTGCCAGTGGTGGAACAGTAAGACCTCCCATTATGTATACAGAC
ACACTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACTGTCTATGCATTGAAGACTGCAAAGGATATACTACTAAGAAAATAA
ATTTATTTCAAGCTTTTCATTTGTCAGCAACTCTGCAACTGATGTAACAGGATGAATAGC
CTATAAATAAATTTACACAGAAAATTGGGAACTTGATATTTGCTAGTGATGACAGAAGGA
AGAGGCCAATTTAATAAATGTTTAAAATGTAGAGCTGATGCAATTAAGTTGCAAGAGGAA
AGAACAATTCCATCTTCACACTACTTATAGGAAACAAACACCAGAGGGTTTGAAAACCCC
AGAAAGTAAAAATGTATAATTTACAAGCCCTTAGAGGAGAGCAAGTTTTTGATTTCATTC
TAGGGTAGAGAATATATTCTTAAATAAGCTGCAAGCTGCGCTGTTCTGTTCTTTTCTTTT
TTCTTGCAAAATATCTCTCAGTGAGTACTGCACTGCTTTGCCATGTGCATCCCAGGTTCA
AATCTGGCCCCCACTACAACTGAAGGAAGCTCACTCCCCGTCTCTGCCTGTATGTGCAGT
TGTATACACGTATAGTAGACTATTGTATACACATATAGTAGACTGTTGTATACGTGTATA
GTAGACTGTTGTATACGTGTATAGTAGACTGTTGTATACGTGTATAGTAGACTGTTGTAT
ACATGTATAGTAGACTGTTGGAAAAGCCGTGACTTATTTTTTTCTCTGTTCTTCTGTGCA
AAACAATGTCATCAGTTTTCTGATAGCTCAATTGACTCTATATTCTATATCATACCTATA
GCTCGCTCTCTCTCTCTCATATATATAGCATTTTACAAATAAAAACTTAGGTACATTTGA
ATATGCCCATAGTCAGATATCCTTATTGCCCAGTCTCTAGTCAATCAGTATTTAAAAAAA
TTTTTTTATTATCTTTATTTATTTATTGGATAGAGACATCCAGAAATCAAGAGGGAAGGG
GGGAGATAGAAAGGAAGGGAGTCAGAGAGATACCTGCAGCACTGTTTCACCGCTCAGGAA
GCTTTCCCCCTGCAGGTAGGGACAGGGGACTTGAACTTGGGTCCTTGTGCACTGTAACAT
GTGCGCTCAGCCAGGTGTGTCACCACCCAGCCCATCAATCAATATTTTTAACTAACTGCA
ATTGTGATATGGTATGAGAAAACAAACCAGGCATTCTGTAAGTGCTGAACAGATTGTTGA
TGGTGTCTTGAAAGGGAATATTACTTAGCCCTTTCCCGGAACTGCATAAAGAGAAGTATA
GTCGCAGAACAACCGGGCGGAAGTGTTAGCAGACCCCATATGTGGGCAGATACTGTACGT
GCAGACTCAGTATGTGTCCCAACCTCCTAAGGTTCCTTCTGGTACTGCAGAGAACAAAAC
CTGAACGAAGGAAAATAAAATCCTTGCCTCCCTTGCAGCTCGATTATGAACACACTGCAG
GTACCCCCCCCCCCCCCCCACTTAACTTAAATCACTGAAGACAGAAATCAGAACTGAGTG
GATCAGGGGGATGGAGGAACAAGTCATCATTCTGGCTGGAGAGGGTCCAGAGGGGATGGA
GGGCAGGCATGGCCCAGCCAGTCACTGCAGCAGCGTCTGCTTGAGCTGCTGAGCAAGACC
ACAGGACTGAGGGTGAAACATGCAAAATAAACACTACAATATCATTCCATGCCCATACGC
TTGGCAAAATAAAAATTTCTGCCAATAAGCAAGTGTTGGCGAAGGGTGTGAGAAGAGAAC
ACTTGCATACCATGCTGGTGATTTCTAGATCACTGCAACCACCTTAAACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTGTCTATCTTTCTCCCCTCCTCTCTGT
CATCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACGACAACAACAGTAATAAC
TACAACAATAAAACAACAAGGGCAACAAAAGGGAATAAATAAATAAAATAAATATTTTAA
AAAAAAAAAAAGAACAGGGGAAATGGGTAACATAATAGTTACACAAAAGAAACTTCTACA
TGAGGCTCAAGCTCAAACCTAGCCATTGCCATAAACCAGAACAGTATGTTTTCTAATTAA
AAGAAAGAGAGAAAGAGAGAAGGTAAGGGAGGTGGACATTGTTAAACTGGAGCTTTGTGT
GAGAATTTACTAGAACATGTTAAAGTGTTCCATTACACATAAATCTTGAACTTTTAGGAA
TAAACATAGAAAGTCATACAGTATACTCAAGCTCTTAAGTTTAACAAGATTAGTACAGTA
TGGTAAGTTAGGCACTTTAAGTTGGACCTAGCTGTCGTCATCTCTATCAATATTAACCAA
GAGGGGCCCAGGCGGTGGCACACCAGGCTATGTGCACACATTACAGTGCACAAGGACCTG
GGTTCAAGCCCCTGGTTCCCATCTACAGGGGGAAAGCTTCAGAAGTGGTGAGGTAGGACT
GCAGGTATCTCTTTCTCTTTCCCTATCTTCCCCTCCTCTCTCAATTTCTGTCTGTCTCTT
ATCCAATAAGTAAAAATGCTAAAAAAATAATAATAAAATACTAGCCAAGAAGTTTTATGA
AAAATGTTTAATAAACTTTGTGGGTTTTTTTGTTTGTTTGCAGTTCTTTGAGTCCAGTTG
ACGTGGTGGATATATTGAAGCACATACATACTTTAAACCAATCAAAAATAACAGATATAT
ACCCTGAAGAATTTAAGCGCCTTTTTGAAATTATAGATAGCTCCAAAGAGTATACTCACA
GATGGCTTTATGATGAGTACATGGAAGAGGTAATCTTGTAGAGAACTGTGCTACTCAGGA
AGCTAGAGCCATTTATTTGGAAACAATGGCAGATGAAAAGGGACTCCATTTGAAAACGCA
TCTTTTAAGAGAAGATATTTTTGTCCTATCAACAGAAGATAAACTGTTCATGATTTGTAT
GGGTGAGGCAAATCGTTCCTTTTAAAGTTATTACCATTTCATCATCTTAGATGAAACTAT
GGGTGCTATTCATTCACAACTGAATAAAATGAAAATACAAACTATTTATGACTTTTATGA
GATTGAATTTGTGTTGTTTCAGATTCCTATTTACTGTAAATATAGACGGGATAGTTGCAG
GATGCTACTACATGAAATTTGACTTGACTGAAAGCTTAACAGTTATACAGAAAGTCTTTT
CCCAGGGCACCAGTGTCCCAGGTTTAATTTCTGGCTGTACCATAAGGCAGAACTGAGCAG
TCCTCTGATTCGCTTAACCCTTATGTCCACCCCCCACCCAAATAAATAAACAAATCCAGC
CTAAACTGGGATTATGGATTTATAAGTTTACCATGCATGAAACCCAGGGTTCGAACCCTG
GCACATGAGAGCACCAAGGGCACTGTCTAAGCCAGTATTGTATTTCTCTCTCTCTCTCTG
TTTCTGTCTTTTAAAAATGTTTTTCTAATGGTCCAAGAGTTGGCGCAGTGGATAAAGCAT
TGGGCTCTCAAGCAGGAGAGATGGAGTTGCAGGGTACATTGGTGAGGTCATCTTCTCAGG
GAAGTCAGGTTGCTGTCATGGTAGCATCTGCAACTTGGTGACTAAAAAAGCATTAAGATA
TAAAGAAGAACAAATTATTTAATAACTAGGACTTTTCTAAAGGCAAAAATATAGCAGATG
AGATTTGGGGTTTCCATTTTGGGAAAAGCTAGTAGGTCTATTTTAGGTATATTCCAAGGG
CCCATGACTTTACTAATTTTTGCCTGAGCCTGACAGCTTGTTGGGTAGTATGCCAGCTCC
CCTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 1179..1181, 1187..1246, 1248..1250, 1254..1265, 1268..1301, 3739..3827, 8292..8391, 8509..8657, 8758..8847, 8948..9010, 9111..9271, 12043..12205
1001..1177, 1179..1181, 1187..1246, 1248..1250, 1254..1265, 1268..1301, 3739..3827, 8292..8391, 8509..8657, 8758..8847, 8948..9010, 9111..9271, 12043..12205
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved