Erinaceus_europaeus Locus ENSEEUG00000010907
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000010907
Erinaceus_europaeus
ENSEEUG00000010907
GeneScaffold_2307
SNORD101, SNORD100, SNORA33
1586..1659, 2559..2635, 2922..3050
4206
GAGAGGGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCCGTGAAGCGACTCC
CCTGCAGGTGGGGAGCCGGGGGATTGAACCGGGATCCTTGCGCCGGTCCCTGCGCTTTGC
GCCACGTGCGCTTAACCCACTGCGCCACCGCCCGACTCCCCCTTTTTTTTTTTTTTAAAG
ATTTTATTTATTTAATAGTGAGAAAGGAGAGCGGGAAAGAAGCCAGGTATCGCTCTGGTA
CGTGTGCTGCCTGGGATTGAGCTCAGGACCTCTAGCTTGAGAATCTTAATACTTTATCCA
CGTGCCACCTCCCGGACCACTCGTGTTCTTTTCAAGACACATACAGGTGAGGATGACCCA
CACAAGGACGGAAAGTGAGTTAAAAGAGATTTAGAAAGTGTGTGCCGCTCCAGAGGGGTC
AACAGGCACCGACAGAACAACAGTCACGATTAAAAACTGGTTTTAGCAGGAAACTACTAC
TTGAACGAGAGCATACAAGCCGCGAATGGCACTTCCCGAGCTCCGTAGGATGAGCTCTAT
GGGTCTTTCTAGCCCATGCCCCCGGCAGAGAGGGTCAGTGCAAGGCTGCCCGATTACATG
CCTGTTGCGCGGGCTCAAGACGCAAAGCAGTCATTCGCCGTTTCCTAGTCTCATGACCAC
GGCTATCCTGAAACAGAAATTGTTCAGGCCCGGCAGTGCTAAAGCCACCTCTGTAGTGGG
AAGGCGTGCACATGCGCCTAGGGGTCCTGGGAGCCACTTAAATACCGTCATGCAGGCGCA
CAAGGCCTCTTTCCCTGCCGCCGCCACGACGCGCGGAGGCGGAGACTCGGGGTGAGTTCA
AGTGTGGTTGTGCTGCTGGTTCTGGCGTGCGCGGGTGGGTGCATTGTTGGCGGGAGTTGG
GGACGAATATGTGCCTTTACATGGGCCGTTAACAAAGGCATCCGATCTTTTCTGTGTGTT
ACAGTGTATTCAAGATTCGGCTCCACCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
TTCGGGACGGGGGTGGTTCGTGCGAGTTGCGGGAATCCCGCAAGCAGACGATCGCGGCAT
CAGAATTAACAGATGCTTTTAATCCCCTGCGATTTCAGCATTGCTGCTGGAGGTGTAATG
GACGTGAATACCGCTCTCCAAGAGGTGCTGAAGACCGCCCTCATTCACGATGGCCTAGCA
CGCGGCATTCGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTAGCACTCTCGGTACTGT
GGGGTTGTTGCAGCCGGAGCAATACCGCAGCCAAGGGAAGCAAGCGTGAGAAGGAAGTTG
GTGATGATGTTAGTACAAAAGTTCTGAGTGGCACCCGGTCTACAGGAAATCTAGGAAAAG
GTATAAACTCAGTCATGTTTAGCTCGTTGAGTGGGTTTTCGTTTTGAGATGGGGGTGAGG
ACAGGATCTATAAGGCAACGGGCTTTAAAATTTTTTTCCTCTTTTTTTTTTTTTAATGGA
AACACTGTTCAGCCCTGCTCGTGCAGGAGATTGAGCCTGGGACTTGGGAGCCACGGGCAT
GGGAGTTTCTTAGCATAATCTACAGCGTTTGAGTGATGACTTTTTATTGTCGGATACCCC
TTCACTCCTTCCTGAGTGAAACATGCACAGTCTGACAAACCTGTAGGTTGTGGGACTTAA
TTTCACAGAGGAAGGAGGTAGACGGGAACCCCCCGTTGGCGTTTGCAAAGCAAACTTGTG
CATAGGTTGATGTGAGATTGGGCCAGTGTTGCAAAGTGTCCTATTAAGATGACGCTAGAA
GGAACCGAAGTTGCGGTAAGAATCTGTAAAAGAGGAAGGTTTTATCTGTTTAAAGTTTAA
AAGTCCACATTGGTAGAACATGGGGAGTGGAGTATGTCCTGGTCTGTTTAAATTCAGGTC
TTTCATCTGGCAAGGATTCTCGTACTGGGTCAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAAAAATTAACCCC
CTGCCTGCAGTTTTAGGAGTGGGAGAAACATTTCTTCGTGATCTTAGGAGCTAATTATGT
GTATAACAAGCTTAAGGTATAGGAGTAGTTTATCTTGGCGCTGTACATGATGACAACTGG
CTCCCTCTACTGAACTGTCATGAGGAAAATGCCATGTCACCCAATCTGACTGCAGCTCCC
ATTGGTGTTTAATGGTCACCATTGTGTTAAAATGTCTGCCAGTAATGTTTTTTGCTTAAT
CCCATAGGTTGATGACAACAAGAAGCTTGGAGAATGGGTAGGCCTCTGTAAAATTGACAG
AGAGGGCAAACCTCGTAAGGTCGTGGGTTGCAGTTGTGTAGTAGTTAAGGTGAGTAATCT
GGGGCAGGGCATGGTTCAAGTCTGGGTGAATCAGTTTAACTTCTGAGGAACAGGAAGGGT
CATTTTAAAAAATGGTTTTGGCTTTTCAGGAAAGGAGAAATGAAGCCAGTCAATGAATCT
GCTTACCTGATTGTGTTTCTGCAGAAATTTTTTATAACTGGCGATAGCAATGCCATGTTA
CGAGCCTTAATGACATTAGGGTCTTTAAGGTCCCTGAAAGTGGCTATATAAAATTTTAAT
AAAAGGAAAAATTTTAATAAAAGTGAAATTATATGACATTTTTAATTTTGTGTAACTTAC
GGTGATAATTGCACTTTTTTTTAGGACTATGGCAAAGAATCTCAGGCCAAAGATGTCATC
GAGGAATACTTCAAATGCAAGAAATAAATAAATAAAATTGGTTTTTAACACGTGGGTTTT
TTTTTAATGAGTGCTGCTGAATTAGTCTCAAGTTTGGATTTCAAGTAGGGTAACAGTGAA
ATGTAGAAATTTATGGAAAGGCCCAAAGATAGGCGGAATGTAATTTGGTCTTGGACATAG
TTAATGTAATGTATAGGATTAGTAATGGTTTGTTCCTGTAAGGGATCCACTAATATACTA
GTGTGATAACATAGGGAAACCTTTCTCATTGGGACTCCTGGTTCGCAGGTAAGCCTCTAC
TATCTTACTGAGGATGATAAGGGTTCTACCTAGCTGTTGGGCAAGATTAGTTTGGTTCCC
ATATTAAGCAATGCTGGGAGAAAGGTTTTAACATGGTAATATTAATGCTGGAATATACCC
ATTTCCTTTTTTTTTTGGTAGCACAAGGTAAAATCAGCCTCGTGTACATGGGATGCTGGA
AAACATGAAGTCTTAGTGGGTTTATAAATGTTTTTTTTTCTATTAAATGCTTGGGTTTTA
TTACTGCTATAATGGGGATTTTGTAGCCAGCTGCTTTTCTAATCCAGGAAGACACCACAG
CCTCTTAAGGTTTTTCTCTTAATTTCCCATGTGCTAGGTCTAGACAGCTTTGCAGGGTAT
TGCTACCAGGCTTTGGTTGCATATATTATACTCCATTTTTTTTTCTTTAGATGCATATAC
AGTCGCTGGGTTTGAACCTGGCTTGTGCATATGGCAAAGCATACAGGTTCAATCTGTTCT
TAACCATAAGCCCTAACTGAGGCTTTAGCTGTGGCTGAAAAAGATTCTTAGGTAACAACC
TTTTTGTTTCTGGTGTATAGGTCTATCAGCCATAAAGCAACAGTGAGTTTTCCAACTAAA
TTGAGAACCATAGCTGGATTATATAAGTCTCTGAGGGCACTTACAATTTTCCCAGCCTGC
CATAGAGACCTGGTTGAAACGAATGTGAACTTGAATACACAACCATTAACACATTTTGGT
TTCAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1118..1234, 2148..2250, 2707..2808, 3144..3206
1001..1014, 1118..1234, 2148..2250, 2707..2808, 3144..3203
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved