Erinaceus_europaeus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus CWF19L1
Erinaceus_europaeus
CWF19L1
GeneScaffold_1948
SNORA12
44689..44843
47998
TTGCCTTAAGGATTCCAACTAAAGAAGCCACAGGAGAGATTTCTGTCCCTCGGCGCTCT
CCGTAGAGAATTGAATCCTCATTGGTTGGAATGAACTGACGTCAAACTATCGCAGTCACT
TTTGCTGGAGGAGCCTGGTTTCCGAGTTCCTGTTTGTGTCCCAACCTGGCTTATTGGATC
GATGGCTCAGAAACCGCTGCGACTGTGAGTGACCGTGGATCGAATGTAATTGTGTGGTTG
GTAGGTGGGTGGGTGGGTGAGTGAGTGGACACTTGCGGCCTCTTCTCAGGACTTAAATGA
GGAAAGGGCGGCTGTAGAGTGGAAAAGTGTAGGCTGATGAATCCACGCTTCTTTGTCTGA
CTCAGTCTGGCGTATTTTCCTCGCCCTTTTCGGCTGAGAGAAAGCGTTTTCTTGACTACA
GAAGATGGAAGAAGCGGAGCCTCCTACAGCCAGGCCTCTTCCATCTTAGGCCGTTTAGGC
CTTTGTCACAATTTTCCTTTTATGTCTCCCCCGCACCCTACACACACTAGCAAGGAATCA
TTCTTGGCAGTGGAACAGGGTAGATACATAGGGTTCTTGATCTGGTGTAATTTTTTAGGG
AGGCGGGACAGATGCGAAGACGCTGGGTTAGTTAGATGACACCTGTCATTCACTCATTCA
ACGAATAGTCTTTGAACAATCATAGCGCGTCAGGCTTCTGGGCTAGGTGTGCACAGATAG
TTTCTGCATTAGTGGAGTACAGGCTAGAGAAGCAAAGATGAATAGAAGGACCTCGATAAA
AATATATATGGTAGTGATAAATGTCAGAAAGAAAGTTCTGGGAGAGTGTAGAAGAGGGAT
GTTTGACTTGGAAGTCAGGGGAATAAGGATTATCTTTGTCTTTTAAGATTCAGAAGTATT
TAAGAGTACTTGAATACTTGGAATCATCATATTTTTTTTGTAAGTGATTCTGGCTGTGAT
AAGTGTGGGGAGGGGACTCAGAGTAGCTAGAATTAAGTAATGTAAGTAGGGAGAAGAGAA
GTTTTACGATTCAGTTTATTAAGACCTTGAAGTGCAATGAATGGGACTTGGAGATAGTTT
GCTTATGAGATGGAGTCCACATTGTCAGACCTTAGATTTTGTCTTTTTTTTTTTTTAATA
CTTTATTTATTTATTAGTGAGAAACATAGGAAGAGAGAGAAAGAGCCAGACATCACTCTG
GTACATGTGCTGCTGGGGATTAAACTCAGGACCTCGTGCTTGAGAGTCCGACGCGTTATC
CACTGCGCCACCTCCCAGACCATGACTTTGTCTTTTTTTAGTCGGATAAGAAATAAAGAA
AACAGACCCAGGGAATTTGGGCGGGTAGCGCGGGTTAAGGGGTTAAGCACAGGTGGGTGC
AAAAGCGCAAGGACTGGCATAAAGGATCCCTGTTTGAGCTCCCGGCTCCCCACCTGCAGG
GAAAGTCGCTTCACAGGCGTTGAAGCAGGTCTGCAGGTGTCTTTTCTCTTCCCCTCTCTG
TCTTCCCTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATCTAT
TTATTTATTATGCCTCCAGGGTTATTGCTGGGGCTCGGTGCCTGCACCACGAATCTATTG
CTCCTGGAGGCCATTTTTTCCCTTTTGTTACCCTGGTTGTTTTTATTGTTGTTGTGGTTA
TTATTAGCATTGCTATTGATGTCGTTGTTGTTGGATAGGACAAAGAAATGGAGAGAGGAG
GGGAAGACAGAGAGGGGGAGAGAAAGACACCTGCAGACCTGCTTCACTGCCTGTGAAGCG
ACTCCCCTGCAGGTGGGGCCTCAAACCAAGATCCTTATGCCAGTCCTTGCATATTTTTTA
AATACTTATTTATTTATTTATTTATTCCCTTTTGTTGCCTTTGTTGTTTTATTGTTGTAG
TTATCGTTGTTACCGCCCGACCCCCATCTCTTTTATTTTTAAAAGGCTTATTGGGGCTGG
GTGGTGGCGTACCTGGTCGAGGGCACATGTGACAATGTGCAAGGACCCAGGTTCGAGCCC
CTGTCCCCACCTGCAGGGGGAAAGCTTTTTGAGTGGTGACACAGTGCTGCAGGTGTCTTT
CTCACTCCCTCCTTTCCCTCTCAACTTCTGGCTGTCTCTATCTAATACGTAAATAAAGAT
AATAAAATATATGAAAAAAAAGGCTTATGTATTAATGAGAGAAAATAAGATTGAAGTCTC
ATCCTTATGCATGCAGGTCCTGTGCCACTACCATGGCTGCATGAATCTGTTTGTGAATTT
CTATCACTCAGCTACCTGTATTGCCTTAATATTTTTCTCTTCTTTTCAGCTTGGCTTGTG
GCGATGTTGAAGGAAAGTTTGATGCTTTATTCAATAGAGTTCAAGCCATTCAGAAAAAAA
GTGGAGATTTTGATGTAAGATGTTTCTTTTTACTAAATTTCGTTGTACTGTTGTAACCAA
ATATACTAGAAAAAAGTTTGGACTCTTGTATTCATCTTTCTCAATGAACACATACTCTAC
TGTATTTATTTTTCCACTGTTGATGTGACTTCACCACTCTGAGCCAGCTTTTTTAGATAG
AAAAAAGACAGAGGGAGAAAGGAAAAAATACCACTTTAGAAAAAATACCCTTTAGAGCCC
AGAACAGTGTGGGCTTAAACCAGCTGGCCCCCTATCTAGGTGAGCTGTCTTGCAGAACTC
CCTACAGTCTATTCTTTTTTGTTAGATTGAAGTTTTTTGTGCTCAGGGGACCTTAGTTGT
TAGAGAACAGTGGTGGTAGGTAGATCTACTTACCTATCTGTACTCTTAAAATTTGACTTC
TCTAATTTTTCTGTGCACAAAACTGAACACAGACTAGTGAAACCTTCCTGAGTGATTCTG
GTCACTGTGTTTGAGAAGCACAGGTCGATTTCATAAATATAGATTATGAATTAAGTCAGC
TAATATGTAAATCATCACAAGCTCAAAGGTCTACACAAAGGTTATATGTAGCTGCTAGTT
AGGCTATAAACCCCTAGATATAGAAGATGTTCAAGGTATGGAGTAATTTGTTCATTGTTC
AGTGACTTAAGACAATGGGTAGGAAATGTGCCTTTTATGTCCTGTAGCTTTCAGGATATT
TAATATTTAGAGTTTTAGATTTCACAGAGACTTTTCAGGTCTGTCTCTATTTTCCTTGAC
CCCCACTTCTCTACCCCAAACTTGAATTTGATAGCCAGTGGGAGAAGATTTAGTAATTTA
TATAATCTGAGTGGCAAACGCTAGAAGAAGAAGATATAATCTGAGTAATTCTAAAGTTGC
GACTAAAGAATTAGGTATTGAGATTCTGCAGGTTGGTTAAGGAAAGTCTGGTTTGTGCCT
CTTTGTTGCATAAATAGATGAGTGTTTTTCTTGATTATCTAATGTAAAAAAAAATCTCAT
ATATCTGTTTAAAAAACTCATTTTAGCTGCTGTTGTGTGTAGGAAATTTCTTTGGCTCCA
CTCCAGAGGCTGAATGGGAGCAGTATAAAACTGGCATCAAAAAAGTATAGAATTTTATTT
ATTTATTTTTGCCTCCAGGGTATTGCTGGGGCTCGGTGCCTGCACCATGAAACCAACTGC
TCCTACAGGCTATTTTTCCCCCTTAGCTGCCCGTGTTGGAGCCCTTGTTGGAGGTTATTG
TTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTATGTTGTGCTTCAGGTGAAAAAT
TATGGTTTAAAAATCATTATATGTTTCTTTCATATAATTGTTGTTACGTATATGCAATGT
ACTTGTTAGGTTGTTTTACTGCAATAGTTATAGCTTTAGATTCCACTAACTTGGTTTGTT
TCGTTTGTATAACTTTTAGTTCCCACTAATTTGGTTTGTTTGTTTGTTTGTAGATAGAGG
AGAGACAGAGACTGAGACCATAACATCAGAGTTTCTTTCAGTTCTGTGGGAGCTGAGTTC
AAACCTGGGTTGCACACATGGCAAAGCAGCATACTTTCCAAGTATTCCCAGGTCCCATTA
ACTTGAAAACTCAGGTTTTTAGTGCCAATCTTGAATTTTCCACTGCCTTTCTCCTTTTAT
GGTTAACTTTATTATTATTATTATTATTATTATTATTATTATTATTATTACTGGTTAATT
CTTCAGTTTCCAAATAACTATTGGACTTGAATTAAGACCACTACTATAGATATTTGACAG
ACTTTTTTGCCATATGAAATAGTGTTAGGAGTAGAAAGAGCAGTGGTCTGGGAGGTGGCG
CACTGGATAAAGCATTGGATTCTCAACCATGAGGTCTTGAGTTCAACCCCTGGCAGCATA
TGTACCAGAGTGATGTCTGGTTCTTTCTCTGTCTGTCTCCTTTCTCATGAATAAATAAAT
AAATTCTTTAAAAATTAAAAAAAAAGCTACAAGAACAATAAAAACAACAAGGGCAACAAA
AAGGAAATAAATATTTTTTAAAAAGTGAAAAACACTTAAAAATTTTTTTAAAAGGAGTAG
AAAGAGCAGCTAAAGCATTTGGGCAATTTTCTCTGAGTTTTTTTTTTTTTTTTTTTTTTT
TTTTGAGGTCTAGCCAGTAAACCATCTGCTACTGAACTTCCAGTTAAGGGAGTGGTCACT
GATGTAGTCATCCAACATGTGAGATCCAGCTGAGAAGGGGAACTTAAGGGGAGTTTATAC
TCATTCAGATGTGTGGGAAGGCAGGAAGGAAGGAGAATCACGTTGTTTTATTTTCCAATT
TTGACTTAACACTTGCCCATTTTCTTTTGAATCTAGGTCGCAAGGGTATCTTCACTGGAA
GCTCAGGGCTTCAGATTGTGTACCTCAGTGGAACAGAGTCCTTAAATGAGCCAGCCCCAG
GTTACAGTTTTAGTCCCAAGGACGTGTCTTCCCTGAGAACAATGCTATGCTCGGCATCCC
AGTTTAAGGGTGTTGATATCTTGCTCACATCCCCATGGCCCAAGCATGTGGGGAACTTTG
GGAACTCTTCTGTAAGTAATGCTTGCTCAGTTGGAATATCTAAAGGCAAATTGTACTGAC
TTGAGTTTTGTTATTGTTCTTTACATTGATTATTTTAGCTCTAAGTAGTGGAAACTTTTT
GCTAACTTTTTTCGGGATACTTAAAGCTATGTCAGCTGACTAAAGTGAAAGCTAATTTTA
TGAAAAGAACAAGTCACAGATGAGATTATTGATGTCTTAATTACAAATGAGTGTTTTTTT
TATATTTTAGTCTCTGCATCAAGTGCCCTTTTTCAAATTTCTTTTTAATATGTTTTGAAG
TCTCACTGGTTTTTCAATAAAAAAAAGCTTTTATAGGGCCCAGGTGGTGGCACATCTGGT
TGAGCGCACATATTACAATACACAAGGACCCATGTTCAAGCCCCTGGTCCCCACCTGCAG
GAGGAAAGCTTCACAAGTGGTGAAGCAGGGCTGCTGGTGTCTCTCCATCTCTCTCCCTCT
CTATCTCCTCTTCTCAATTTCTGGCTGTTTCTATCCAAAAAAAAAAAAAAAAAAGATTAA
AAAAAAAAAGCTTTTATAGCTAGTGACAGCTCTGCATTTACATATACCACCCATTCCAGA
TTTTACCTTTTGGTTCAAATAGCATTTTTTTCTCAAATTTTTTAAAATATTTATTTATTT
ATTTATTTATTCCCTTTTGTTGCCCTTGTTGTTTTATTGTTGTAGTTATTATTGTTGTTA
TTTCTGTCACCGTTGTTGGATAGGACAGAGAGAAATAGAGAGAGGAGGGGAAGACAGAGG
GGGAGAGAAAGGTAGACACTTGCAGACCTGCTTCACTGCTTGTGAAGTGACTCCCCTGCA
GGTGGGGAGCTGGGGGCTCAAACCAGGATCCTTACGCTGGTCCTTGTACTTTGCGCCACC
TGCACTTTACCCTGCTGCGCTACCGCCCAACTCCCTTAAAATAACATTTTTAGGTTCTAG
AAGATAGCTCACCCAGTAGGGCTCACACTACCATGTGCAAGGTCCTAGGCTCAAGTCCCT
GGGACTAGATGGCTGTAGTACCATACATGGCATCGAGGAGAAACTCCTTGTGTGGTGGAG
TGGCATGAGGTCTCCCTTCTGTCTTCCTCTCTGCTGCTTTCTGTCTATCTGTATAGTGTA
GTTGAACAGGCACAATGTTACGGCAGCAAAAAATAAAATAAAATAAAATAATTTATGGAG
CCAAGGTGACACACATGCATGATTTCTCTGCTGCAGGCCACTTTCCATTCAGATGGAGGG
CTGGAGGGAGCGATACCCCAGCTCTGAAGCTTCCTTTTGTGCCATTATAATCCCATGCCT
TTCTGAGGCCCAAACCCTAGACCTCTGAGCTATAGGTTCCAGCCAAGTGTGTGTCTGTGT
GTAGTGTGTGTGTGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
AGGTTCTGGTTTCCATCTCTGGCACCACATGGGCATCTGTGAGCATTATGGTACCAAGGG
GAACTCCATGGGTGGTGATCGAGTGTTACAGTAGTGCCTCTCCCTCTCTCTTCCTCTTCT
CTTTCTTTAACATAAAAGGAACGAAAAGTTGGCCTGCGACTGGTGGTATCATGTGTGCGC
TAAACCCTAGCACCATATAAAAAGAATAGAGTAGGGGGCTGGGTGGCAGCCACCTGGTTG
AGCACACATGTTAAAATGTGCAAAGACATGGATTTGACTCCCCAGTTCCCACCTGCATGG
GAAAAGCTTTGTGAGTGCTGAAGCAGTGCTGCAGGTGTCTCTCTCCCTTTTTTTAAACTA
TTATCTTTATTTATTTATTGAGTAGAGACAGAAAATGAGAGAAAGAGGGAGATAGAGAAG
AAGAGAGACACCTGCAGCACTGCTTCACCACTCACAAAGCTTCCCCCTGCAGGTGGGGAC
TGGGTGCTTGAACCTGGGTCCTTGCACACTGTAACATGTGTGCTCAACCAGGTGCACCAC
CACCCAGCCCCTCTCTCTCCCTTTCTATCACCCCCTCCCCTCTCTATTTCTGACTGTCTC
TATCTAATAAATAAATATAATACAATTACAAAAAGGAATAGAATAGACCTCACAGATGTC
ATAGATGTGCAAAAACAATCTGTTGTTGATGCAGGTGAGGGGTAGGTAAACAAGCCCAAC
TTCTGACAGATTTTATTAAGATTTTTTGTGGCAGGGATATAGTGCCCTTCCACAAATTGT
ACTTTCCTTAACTGAAGCAGAATAAAGGATTATATATTTATGTGTTGAAGTCTTTGAATA
TTCCATACCAAATATTCTCCAGATTCTATGAGCCCTGAAAACTAACTTTTGATTTTTACT
TTTTGCACCATCTATGATTATCTTTTTATTTTTATTAATTTATTAGTAGATAGAGGCAGA
ACTTGAGGGGGGAGAAGTAGATAGAGAGGAAGAGGAGGCAGAGAGATACCTGCAGCCATG
CTTCACCACTTGGGAAGCTTTTCCCATGCAGGTGGGGACCAGGGGTTTGAACCAAGTTCG
TGTGCATTATAATGTGTGTACTTAATCAGGTGTGCCACTGCCTGGCCCCCATCTATGATT
ATCTGTCTGACTAGATCTATACTAGTGTAACCAAGCAAATTATAAATGCACGTGTGTGTG
GGCTTCAAAGTGAGTTGATTAACCAAAACATAAACCCAGTTTTGGGTACTAAACAGATTT
TTCACCTCCTTGGTTATTCCTAAGTTTGGCTTGTTTGTTTTTTACTATTTATTTATTTAT
TTATTTATTTGTTTTTTATGAAAGAGAGCTTCAGGGAAACATGTACACACACAGTACTAT
TCAGCTCTGGCTTATGGTAGTGCTCAAGATTGAGCCTGGGACCTTTGATGGCTCAGGCAT
GGAAGGCTTTTTTGCATAATCATAATGCTGTGGGAGTCAGACTGTAGCACAGCAGGTTAA
GTGCAGGTGGCGCGAAGTGCAAGGACTGGTGTAAGGATCCCGGTTCAAGCCCCTGGCTCC
CCACCTGCAGGGGAGTCGCTTCACAGGCGGTGAAACAGGTCTGCAGGTGTCTGTCTTTCT
CTTCTCCTCTCTGTCTTCCCCTCCTCTCTCAATTTCTCTGTGTCCTAACAACGACGGCAT
CACTAACAACAACAATAACTACAACAACAATTAAAAAAACAAGTACAACCAAAAGGGAAA
ATAATATAAAAAACCATAATGCTGTATGCCTAGCCCTGTTATCTTACCTTTTAAGCTCTG
ACTTCCAATCCTTCTGTTTCAGCATTCATAATAACCTAGATCCCCTTAAGTGTTTGAGAT
TTCTAACTGCCTTAAGTAAGGAATTCATGATACAAGTCCTTCTTCCTGTATTTGTATCTA
TGCTAGTATTTCAAAGTGCTTTGCTATTTATTTTTATTTTTGTGATAACTCTTAAGTTTG
TTATGATGACTGAATTTCTGTTTGCTAGGGAGAGGTGGATACCAAAAAATGTGGCTCTGC
TTTGGTCTCCAGTCTAGCCACAGACCTGAAACCAAGATACCATTTTGCTGCTTTGGAGAG
ACTTACTATGGAGACTTTTATATCGATAAAGAAATATTTTATTCCACAGATGTTTTGAAG
AGAAAGAAGGTGATAACACTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCCCTGGC
AGCACATGTACCAAAGTGATATCTGGTTCTTTCTCTCTCTCTCCACCTGTTCCTATCATA
AATAAATAAAATAAAATTTAGGAAAAAAAGTAAATAAAAGGCAGACCCAGAGAAGTACTG
CTAAAGATAATAGAGAAAGACACATGTGAAGGCCCATGGGGAAAGCTGAGAAGAGTAGGC
CTTTTATTTCAGGGATGTTAACAAGGTGGGGGGAAAAAAGATTTGTTTGTCTCTTGAGTT
TCACTGTTCCTGGATGACTTTTTCAGATACAGAGGGAGAGGTGGAAAGAAGCTATAGTAC
CAAAGTTTCTGTCAGTGTCATGGGATTTGGGCTTGAACATGGGTTGCACTTATGGAAAAG
CAGTGGACTAAGTGAACTGTTTTATCAGGTGTGTGTGTCTGTGTGTGTGTCTGTGTCTGT
GTCTGCAGTACTTCACCTGTGTAATTTTTCACTGCTCTTTTCTGTTCAGATAGGTAGACA
GACAGACAGACCATGACACTGGAGCTTCCACTAGTGCCATTATAATATAGCCTAAGTGCT
TAGCAGTGATCATGAGACGGCAGAAGCCCCATATAGCATATAGCATAGTCCCATATACCA
TATAGCATAGTCCCATATAGCATATAGCATAGTCCCATATAGCAGATAGCATAGCCCCAT
ATAGCAGATAGCGTATAGCATAGCCCCATATAGCAGATAGCATAGCCCCATATAGCAGAT
AGCATAGCCCCATATAGCAGATAGCATAGCCCCATATAGCAGATAGCATAGCCCCATATA
GCAGATAGCATAGCCCCATATAGCAGATAGCGTATAGCATAGCCCCATATAGCATATAGC
CCCCAAACTTAGGATTTTTTGCCTCCTCCTAGGGTTATCATTGGGCTCAGTACCTGCATG
ATAAGACTACTGCTCTCAGCAGTTCCCCACCCCCCTTTTTAAAAATTTGACAGGGTAGAG
GGAAATTGAGAGGAGAAGGGAGACACAGAGGGAGAAAGAGAGACACCTGCAGCAGTGCTT
CATTGCTCATGAAGCTCCTTCCCCTGCAGGTGCGGACTGGGGACTTGAACCTGGGTTCTT
GCATATAATGTGTGCTCAGCCGGGTGCACCACCACTTGGTCCCTATACATTTTTTTAAAA
TTAAATTTGCTTTGTACTAGAGTTTGTAAAGAGCTGCACTAGAGACATAAGAAAGCAATA
TAGCTGTCACTATACTAGATACTGTCACCTCAGTGCCGGTTCTCTATCCTTCAACATAAA
TCTGGAGGCAAGCATATAATGAAGTTACTGCTTTACTTAGTGGAAAATTAACTTTAATAA
CTTAATTTCAGGGGGCCGGGTGGTGGCGCACCTGGTTGAGTTCACATGTTACAGTGCCCA
AGGACCCTGGTTCGAGCCCCCGGTCCCCACCTGCAGGGGGAAGGCTTCACGAGTGGTGAA
GCAGGACTGCAGGCATCTCTCTATCTCTTTCTCCCCTATCCAATAAATAAAGATAATTAA
AAAAATTTTTTTTAAATAACTTAATGTCTGGTTGTATGGGGGTACTGGGTTCCTGTCTGG
CACCACCATGGGCCTCCTGTGAGCCCTATCGTACCCAAGGGGACACCATAGGGGGGGGAT
CGGAGTGTGCAGGAGAGAGACGTCCCCTATCTTCCTCTTCTCTTCTTTACCTAAAAGGAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATAGCACCAAAGCTTCCTTCACTGCAG
TGGGGCGCGTTAGTTAAGACCTGGGTTGGTGGGAGTCAGGCAGTAGTGCGGTGAGTTAAG
CACACATGGCGCAAAGCGCAAGGACTAGCGTAAGGATCCCAGTTCGAGCCCCCAGTTCCC
CACCTGTACTTGTGAAGCAGGTATACAGGTGTCTGTCTTTCTCTCCTCTCTGTCTTCTCC
TGCTGTCTCCATTTCTCTTTGTCCTATACAAGAATGACAACATCAATAATAATAATATCT
ACAACAAGAAAACAACAAGGGCAACGAAAGGGAATAAATAAATAAATATTAAAATTAAAA
AAGACAGTTTAAAAAAAAAACCTGGGTTGGGCATATGGCAAAACAGTGCACTATCCAGGT
GAGCTATTTCACCAGCCCCAAGAAACCAATGTTTTATCCACTACTCTACCTCCCAGGCCA
CAACTTTCTAGTTCCTAAATCCCAAAATGTTGAGTTTATGTGCTTTAGATATGTGATCCC
TCCCCCCCACCAAATAAAAGCTGTTCTGTAAGAAAGTGATTATCTTATACATAGATAGGT
AACATCTATAATTATGTTATTGATGGTAGTGGACTCAGGAAATGAGTCTAGATATTTCAT
AATTGTAAATCAAAACTAAAATTTGTTGCTAACCCATTATGTCTCAAATATGTTATAGAA
ATCACATTGTTCTTCAGGAAAATGCACAGCATGCCACCAGGTTCATAGCTCTGGCAAATG
TTGGGAACCCAGAAAAGAAAAAGGTAAACATTTGAACATTATAGTATTTGTCTAATATGT
TTCTTTTGCCTAGTTCCATATTCAGAGCCTCTCTCTCTCTTTTTAATATTTGTTTATTCC
CTTTTTTTGCCCTTGTTTTTATTTATTTATTTATTATTGTAGTTATTATTGTTGTCATCA
TTGTTGGATAGAACAGAGAGAAATAGAGGAGGGGAAGAAAGTTAAGGGAAAGAGAATGAT
AGACTCTTGTATGAGCCGGATGGTAAGGCAACATGAGAAGGCTAGGTTTCAACTGGTACG
GAAGAAAGGATAGAGAACCGGGGGCGTGGCGGATTGGTCCCAGGAGAGGACGATAAGTGA
CTAGGCCATGTGGGGTGAGTTTCAGGTAAAAAGTTATAAAATATGTAGACAAGAGTGGAA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGCTTCATCACTTGTGAAGCGACTCCCTTG
TAGGTGGGGAGCCAGGGGCTTGAACTGGGATCCTTAGGCTGGTCCTTGCACTTTGTGCTA
CCTGTGCTTAACCCAGAGCTTCTCTCTTTCTGTAACTCCAAATTCCTTACATCTCAGTGA
CTCTTTTCTAAAAATATGGTAATGAAAAGTCAGATTTCCTTGTGTCCTTTGTAAAGTTTA
AAGAAGTGTTTGGAAACATAGTCTCAGTGGAATAAAACTAAACTTTCGAATGTGTGACAT
TTCTTTCTTCTATTCCCATCTGATTTTTTTCAACAGGTATTAGTGAGCCTATACTCAGAT
AGTCCTACCAGATTCATTTAGCCAAACTAGTAAATTTATTCTAAGGATTTACTTATTCTT
TTTTTGCTTTGAGAAATCTTAGTGATCTAAAATCTAACTTTGTGTTGGAAAGTAGTGTAG
GTGAATGATAGAGTTTACCACAAAAGTATACTTTCCTTTCTTCCCTGAGAATATGTCTGA
TACCCTAGAGCCAAAAGCAGTATGTTGTGGGCTGAAACAACAGAGATCAGAATGATCAGT
TAACTAGGAAATTGGCAAGTAAATATCTGAAGATTATTCTACCACAATATGTCATAAACA
AATATACACACAAAAAATAGGTAAATGTACGTGTGTTTTCATAATCTTTTAAGCTTTTTT
TGTTTGAAATATTTTATTTATTCATGACGAAGATAGGTAGAGAGAGAGAAAAAAGCAAGA
CACTCTGGTACATGTGCTGCCAGGTATTGAACTCAGGACCTCATACTTTATGCACTACAC
CACCTCCTGGACCACAGTCTGTTAAGCTTTTGAAAGCCTGATGCTACAAGTATAGGTTTG
TAACACCCTCACCCCCCAGACACACACTGTTCTTTCAAGCCCAAATAACACAGTATTTTC
ATTTTGTTGCTTTACTATCAGGCATGCATTAGCCTCAGCAATAAGCAACTTATACCTCAA
AAGTACACGTCTTTAAATTGGCAAGCATTATTAAAAGCATCTTTTAAAGTATTTATTTAT
TTATATTTATTTTTTCCCTTTTTGTTGCCCTTGTTTTTCTATTGTTGTATTTATTGTTGT
TGATGTCTTCGTTGTTAGATAGGACAGAGAGAATGGAGAGAGGAGGGGAAGACAGAGAGG
GGGAGAGAAAGAGACACCTGCAGACCTGCTTCATCGCCTGTGAAGCGACACCCCTGCAGG
TGGGAAGACGGGGGCTCAAACCAGGATCCTTACGCTTTGCGCCACCTGCGCTTAACCCAC
TGCAATACTGCCCGACTCACTACCACAGTTTTTTTATGAGGTGCAGAAGGTGGGAGTTCT
AGCTTCTGTAACTGCTTCTCTGCTGGACTTGGGCGTTGCCAGGTCAATCCATACCCCCAG
CCTGTTCCTGTTGTTCCCTAGTGGTGTAGGGCTCTGGAGAAGTGAGGTTCTGGGACACAT
TGGTGAGATCGTCTGCCCAGGGAAATCAGGATGGAGTCATGATAGTGTCTGCGATGCCCC
TGCAGGTGGGGAGCCAGGGCTCAAACCAGGATCCTTACACTGGTCCTTGCGCTTTGCACC
ACATGTGCTTAACCCGCTGCGCTACTGCCGACTCCCTATTAAAAGCATCTTAAAATTTAA
TACTTTATACTCACAAAGCTTTGTATTAAAGTGTTTGCCAGTCTGATTAGGTGGTACATC
ATTGTTAATTAGTGTGCTTCTCTGACTAGCAGTGAGGTCAAGCATATCTGATGTACAGTT
TTTAGATTTGTGTTATTAGTCTGAGAGTCTTCATAGTCTGGGTGCCGGTAGCCAACCCCC
TCCGTCTCCCATCCTCCCGTATCTCCAAACTCAGTGGCCAGTCACCTAACTCAAGTTGGA
CGTGCTAAGATCGACCCAGTCTGGAAAAGAGAAATTTCCCATGAGTGGTCATCCCACTTC
CGTTTATCTTGTCCATCTCCAAAACTCTCTCCCTTTACACTGTCTGAACTGGAAGACGCT
TTGAAGACGGTTAAACCGGGAACGGCTGCTGGCTATGATAACATCACCCCAGAACTCATT
CTTAACTTGGGCCCTGCGGCAAAGAAGTGGCTCACTTCATTCCCGTCCCACATCTTGGAA
TCTGAGTCTATGCCCAAAATTTGGAGTCGTGCGAAGATAATAGCAGTTTTGAAACCAAAG
ACCCAACACTGGCCGCCAGCTATAGACCAATTTCTCTCCTCTCCGTGTGTTACAAACTCC
TTGAGAGGCTGCTTCTGTCACGTATTTCTCCTCTTACAGAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNATTCACCATTTTAATAGCTGAATAAATAGTTTAAGTAGTTCGATCGATGAAGA
TACACATTATTATATTACGTTGACATTATTATATCTTCATTGACATATTATATTATATTG
ACATCCTCGAGGAAACACTCACGAAAGACATGTCTCTGATATCTGATTACTGTAAAAAAT
GGCGACTAATCCCTAGCACTGCAAAAACGGTATCATCTGTTTTCCATCTACACCATGCCT
CGGCCTCGCATGAGCTTAATGTGCAGCTTGGTGGTACGAGAATCTGGCATGAAGCCCAGC
CAGTCTATCTTGGCGTTACTCTCGATCGCACTCTGTCATTTCACAAACATCTCATAAAAA
CTGCAGCAAAGGTGGGCGCGAGGAATCACATCATTGCAAGACTGGCCAGCTCCGCATGGA
TCATCCTCTCTGGCATTATGCTATTCCACTGCAGAATACTGTGCCCCAGTATGGTTCCGT
AGCCCCCATGTCCACTTGGTCGATTCCAAATTATATTCCTCCATGAGGATAATTTCTGGA
ACCATCCGTTCCACCCCGGTTCCATGGCTGCCAGTTCTTAGCAACATCGCCCCGCCAGAT
ATTCGGCAGGATGCGGCATCATCTAAGTTCATTTCCCACGTCTACGCTCGACCGGACCTG
CCAATATACGCGGATATCTTTGCCCACCCTGTCCAACGCTTGACGTCTTCTCACCCAATC
TGGTCCCCTATGCCTACACTGAACTTCTCTGTTCCAGTCTCTTGGAAACAGACCCCTGCA
AGCGTCAACCCGGCTTTGACCTAGCACGTTATGACTGGGCTCTCCTCAATCGCTATCGAA
CAGGCCATGGCCGGTGCGCCACTATGTTCCATCTCTGGGGAGCCAGAGACGACCCGAACT
GCCCCTGCGGCTACAGACAGACTATGACCCACATAATCAACGACTGCCACCTCTCCAGAT
TCAAAGGAGGTCTCAAAACTTTACATCAGGCTCAACCTGACGCTGTTGACTGGCTATGGA
AGAAGGGCAAACGCTAGAAGAAGAATGTGTTACTTTGACACAAAGCAGTTTGGCTCTGGG
AGGAGCATGGGAACTTCCCCAGGCTAGAATTGCCCCCCTTGGTGCCAGCCTGCTTAACAG
CTCTCATCTCACAGGATGCCCCCTGGTGCTGACCAGCATGAATTCCTTAACAACTCTTAT
CTCACAGGATGTCTTAGGCTGTTCTGCTCAGGATAGATGGGGGTGGGGGCAGCAGCAGCT
GCTTCTGTTTGCTGTCAGACAGGAGAGAAATATGAACACAGGTTATGCTAAAGAAATAGG
CATCTATTATCTGCATCAATCAGCCCTTAGTTAGCCTCTGCAGAAGTCACTGGAGTTGAC
ATTGAAGTTACTCTGTATTCTCTGAAGCAGTTGTTCTTTGAATTTTACTTAGTCCCTGAA
CCTCTTTGAAATAATTCAAAAATAAAATAAGTTGATTACATTTAAATAAATAGTATTTCC
CTTAATGCTGTCTTCTTTTCCTCCAAAGTATCTGTATGCATTCAGTATTGTTCCTATGAA
ACTAATGGATGCAGCAGAACTGGTTAAACAGCCTCCAGATGTCACTGAAAACCCTTACAG
AAAATCTGGGAAGGAAGCATCCATTGGGAAGCAAATTTCTGCTCCAGAGGTATGCTCTAA
TTGAGAGGTTGGATTTTCTTTTATTCATTTTTCTTCCTCTTTCCTTCTTTCTTTCTCTTT
TTTTTATAATTTTTAAAAATTTTTATTATCTTTTTTTATTGGATAGAAACAGTCATAAAT
TGAGAGGGTAGGGGGAGATAGAGAGGGAGAGAGACACCTGCAGCCCTGTTTCACCACTTG
CAAAGCTTTCCCCCTGCAGGTGAAGGCCAGGGGCTCGAGCCTGGGTCCTTGCGCACTGTA
ACGTGCACTCAAACAGGTGCACCACCACACGGCTCCCCCTTTTTACTAAGAAATATATAT
TTTTAATGACAGAAAGAGAGAGACAGGCAGACACACCAGATCACTGATTAGCACTGTTCA
GCTTATGATGGTGTTGGGGATTGGACCTGGGAGCTCAGAGTCTCAGGCATGAAAGACGTG
CATAACCGTTAAGCTGTTTCCCCAGCTCTGAGAGGTGGCATTTTCTTTCTTTCTTTCTTT
CTTTTAAATGTACAGTTTTTATTTATTTATTCCCTTTTGTTGCCCTTGTTTTATTGTTGT
AGTTATTATTATTGTTGTTATTGATGTCGTCATTGTTGGATAGGACAGAGAGAAATGGAG
AGAGGAAGGGAAGACAGAGAGGGGGAGAGAAAGATAGACACCTGCAGACCTGCTTCACCG
CCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCAGGGGCTCAAACCAGGATCCTTATGCC
GGTCCTTGAACTTTGCGCCATGTGCACTTAACCCGCTGCGCTACTGCCCAACTCCCGAGG
TGGCATTTTCTAATTAGAATGTCCACTACAGATGTGCTTTTCTTTACTGTAGTTTAGTTT
ACAGAAGTTTAATCCTTAAGAGTACAAGTTTTTTTTGTTTTTTGTTTTTTTTGTTGTTGT
TGTTTTTTTAACCAGAGCACTGCTCAGCTCTGGTTTATGGTGGTACAGAGGATTGAACAT
GGGATTTCGGAGCCTCAGGCATGAAAGTCTCTTTGCATAACCATTGTGCTATATACCTCC
ACCCCAAGTATTTCTATTCTTAGAAAATGGTGTTTAGAAAGGTTTAGTACATTACAGCTT
AGCTTGAAATAATTCTTTAAATTTGTAATGTGGGGTTAGTAGCATCATACATTAAGTCTA
TCTTTGTTGAAGCGTTATTTATTTTGCCACCAGGGTTATCACTGGGACTTAGAGCCCACA
CTAGGAATCCACCACTACTTGCAGACATTTTTCCTTTTTTTCTTTTTTATTTGACAGGAC
AGAAAGAAATGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTGCTTCCATGTTTTGGCTATTACAAATTGTGCTGCCAA
GAATATATGTGTACACAGATCTTTTTGGATGGATGTGTTGGGTTCCTTAGGATATATCCC
CAGGAGAGGAATTGCAGGGTCATAGGGTAGGTCCATTTCTAGTCTTCTGAGAGTTCTCCA
GACTGTTCTCCACAGAGGTTGGACCAATTGACATTCCCACCAGCAGTGCAGGAGGGTTCC
TTTGACCCCACACCCTCTCCAGCATTTGCTGCTGTTACCTTTTCTGATGTATGACATTCT
CACAGGAGTGAAGTGATATCTCATTGTTGTCTTGATTTGCATTTCTCTGACAATCATAGA
CTTGGAGCATTTTTTCATGTGTTTCTCAGCCTTTTGGATCTCTTCTGTGGTGAATATTCT
GTCCAAGTCCTCCCCCCATTTTTGGATGGGGTTATTTGTTGTCTTGTTGAGTCTGGCAAG
CTCTTTATATATGTTGGTTATTAAACTCTTGTCTGATGTATGGCATGTAAAGATCTTCTC
CCATTCTGTGAGGGGTCTCTTGGTTTGGGTAGTGGTTTCTTTTGCTGTGAAGAAGCTTTT
TAATTTGATGTAGTCCCATAGGTTTATACTTGCCTTAGTCTTCTTTGTAATTGGATTCAT
TTCATTGAAAATGTCTTTAAAATTTATGCGGAAAAGAGTTCTGCCAATATTTTCCTCTAA
GTATTTGCTAGTTTGTGGTCTAACATCCAAGTCCTTGATCCACTTGGAATTTACTTTTGT
ATTTGGTGAAATACAGTGATTCAGTTTCATTCTTCTGCATGTTTCAACCCATTGTTTCCA
ACACCATTTGTTGAAGAGACTCTGCTTTCCCCATGTAATAGTCTGGGCCCCTTTGTCAAA
GATTAGATGTCCATCTAAGGTTTATTCTTAACTTTTCTTTTTTAAAATAGGTTTTAAGAA
AATTCTTATTTAATAAGAGAAATTGAGATGGAAGGGGAGATAGAACTGAAAAAGAGACCC
ATAGCATTGCTTCACCACTAGTAAAGTTGCCCCCTTGTAGGTGGGGACTAGGGACTTGAA
CCTGGGTCCTTGCACATGGTAATGCATGTGCTCAACTGGGTTCACCGCTGTATGATCCCT
GTCCTTAATTTTTAAAGCAAAAATCCAACTCTTTGGTCACAGTGTAATTTGTAATTTTAT
AATGAGTGCTAGTGGGTAAGGAGGACACACTTTGAAACAATTCCTTTATAGCAGACTTTG
AAGTTAATTTCTTCTTTCCCTAAAACATAGAATATAAAATTCATTTATTAATATGGCCTG
CTTCCTATTTGTTAGCAACTATCTCATCTTTCTACTTAAAGTTCAGTTATTTACCTATGA
AAAGGAAACAAAATTTTCCTGGGTTCACATAGCTCTATAAAAGACAAGAATTGCTCTGTC
ACATATTTTAATTTGCTTTTGCAGAGAGGTACATTTTGTAGCTTCGGTAAGTGTGGAGAA
GTTTGACTGGCAGTTAAGGCATTAAGATTGGGAAGATGGTTTTCTTACCCAGAATAGAAT
TAGGAGGAAAGGTAGGTGTGACATGGCTGGGATGGTCTGTTGATAGTGAATGGCTACAAC
TGGTATAAGGGTTAGTTTAATAATATTTACTCTTCTTTCCTTGGCCATTTCAGGAAGAAT
CAATCTGTCAATTTTTCTTTGACTTAAATGAAAAGCAGGGAAGGAAGCGTTCATCCACAG
GAAGAGATAACAAATCTTCTCCTCACCCAAAACAGCCTCGTAGGCCTCGTAAGTACCTTG
GTACCAGGGGTTTCCTGTGCAAACAACAACTGTTATTTTAGGTCTTGTGGGAAGCATCAC
TGCTAAGTACTCTCTGGCAGAAGAATATTGTCCAATGAGTCATAAGACCAATAATCCAAA
AGTAACACAAAGATTGCCTGACTTTAGGGCTGTCCAAATGATTCTTGTTGTAACTATGGG
AAAAGGTCCTATAACAACTATCAAAAAAGCTTCATGTCTGGGAGGGCGGGTGGTGGTACA
CCCAGTTGAGTGTACATGTTACCATGTACAAGGACCCAGGTTCAAACCTGCAGGGAGGGG
TAAGCTTCATGATGGTAAAGCAATGCTACAGGCCTCTCACTTTCTCTCTCCTTCTCTGCC
ACCCCTCCCTCTCTCAATTTTTAATCTGCCCAATCAAATAATAAATTTATTAATTTTTTT
GCTTTACGTCTGTAGTCTGTAAACATATGACTTAAAGAACCCATAAAACCAATTTAGTTT
CTTAAAATAATAAACCAGTAGAAACAACTTATTTCACTGAGATCTTCTTCCTCTGCCCTT
TTGTTTCAAAGGTGAAGAAACTGACCTTGGAAGGGTCGGCTTATTACCTAGGGTTATGTA
GTGACATAGCTAAAGCTAAAATTGACTACTCTGATACCAAATTCAGTGTTCTTCATTGCA
GCCTACTCCAGTCACACGCTACTTTAGTCAGTGTGTGGTAATCCTCCAATGAGTCTATAT
TTGGACTAGTTGTAAATTTATAACTTTTAGTTATAAATTTAGTTTCATCAATTGTAATAA
TGGGGTATGGGTTGGGAGGGTTCTTGGTGAAGAGCACAAGAGGTCCATTACCATTGTGAC
AGTGATATATGCTCATTTTTTAAAATATTTATTTATTCCCTTTTGTTGCCCTTGATTTAT
TGTTGTAGTCATTATTGTTGTTGTTGATGTTGTCGTTATTGGATAGAACAGAAAGAAATG
GAGAGAGGAGGGGAAGACAGAGAGAAAGATTGACACCTGCAGACTTGCTTCATCACCTGT
GAAGCAACGCCCCTGCAGGTGGGGAGCCGGGGCTCAAACCGGGATCCTTACGCTGGTCCT
TGTGCTTTGCACCACCTGCATTTAACCCACTGCGCTACCGCCCAACTCCCTACATGCTCA
TATTTTTTTTTAAAAAAAGAATGTATTTATTCATGAGAAAGATAGGCATAGAGAGAGAAC
CAGACATCATTCTGGTACATGTGCTGCTGGGGATTGAACTCAGGACCTCATGGTTGAGAA
TCCAGTGCTTTATCCACTGCGCCATCTCCAAGACCACCTTATATGCTCATTTTTATAGGA
TATAAAGATATCAGTCCAGGTTGAATTCAATGGAGGTGATTACATGTTAAGAGTACCTTG
CCCATAATTAACATTGATTTTCTTCCTCATGAAGCTCAACTCCCGGCCCTGCTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGCAACCCACATTCAGCAATAATCACGGCCACATCTATAA
ATAAGGGGTGGAGCAAAATTTTAAAAAATAAGGGAGTTGGGCGGTAGCATAGCAGGTTAA
GCGCAGGTGGTGCAAAGCACAAGGACAGGAGTAAGGATCCCGGTTCGAGCCCCCGGCTCC
CCACCTGCAGGGGAGTCGCTTCACAGGTGGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCT
CTCCCCCCTCTGTCCTCCCCTCCTCCATTTCTCTCTGTCCTATCCAACAACAACATCAAT
AACAACAACAATAAAACAAGGGCAACAAAAAGGAATAAATAAATATTTAAAAAATAAATA
GGGGCCGGGTGGTGGTGCACCTGGTTGCGCACACATGTTACAGTGCCCAAAGACCCTGGT
TCGAGCCCCCGGCCCCCACCTACAGGGGGAAAGCTTCATTAGTGGTGAAGCAGGACTGCA
GGTGTCTCTCTCTCTCTCCTCTTCATTTCTGACAATCTCTATCCAATAAATAAATAAAGA
TGATAAAAATTAAGTAAATAAATAGTAAATAAAACCTTAAGTATACAATTAGTGATTTTT
TTTTTTTTTAGGAAGGTTACCTGGTTGTGTAACCATCAGGTAATACTTCCCAAAATAGAT
CTGTTTCTCTAACAGGATCCCCAATGCCCATTCACAGTTAGTTCTTGACCTTACCTTCAG
TCACAGCTAGTTATTAGTTCACTTTCTGTCTCAGAGGTTTACCTTTTTTTTAGGAGATGG
TTAGTTTTTTACTCCCTTTTGTTGCCCTCGTTTTATTGTTGTAGTTATAATTGCTGTCAT
TGTTGTTGGGTAGGACAGAGAGAAATGGAGAGAGGAGGGGGAGACGGGGGAGAGAAAGAC
ACCTACAGACTTGCTTCACCACCTGTAAAACGAACCCACTGCAGATGGGGAGCCGGAGGC
TTGAAACAGGATCCTTACGCCGGTCCTTGCGCTTTCCGCGACCTGCACTTAACTCTCTGT
GCTACCGTCCGACTCCCTAGTTTTTTGTTTCTAACTTCTCTTACTTGGCATATTTTTGAG
ACATCCTTGTTGTAGCATGTATCAGTATTGTTTCTTTCTGTGGTCAAATAGTATTCCACT
ATATCAATATCCCACATTTTGTCTACATCAGTTGATGGATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCATCTTGCTATTATTTTTAACATTTATTTACTATATCATGATATCGAT
GACTATTGTGTTGTCTCCCAGCTAGGCAGAGCAGTTTTAGTTGTCGTTTAACTGTTGGCA
CTCATTGTTAAAACTATATATTTTTCGGGAGTTGGACAGTAGCGCAGCAGGTTAAGCGCA
GATGGTGCAAAGCGCAGGGACCGTCATAAGGATCCCGGTTTGAGCCCCTGGCTCCCCACC
TGCAGGGGAGTCACATCACAGGCAGTGAAGCAGGTCTTCAGGTGTCTCTTTCTCTCCCCC
TCTCTGTCTTGCCCTCCTCTCTCCATTTCCCTCTTTCCTATCCAACAACGATGATATCAA
CTACAACAATAAAACAAAAAGGGCAATAAAAGGGAATAAATAAATAAATATTTAAGAAAA
GAAAACTTACGTTTCCTCTTTGGATGTATGAGTTTGAGGTTTTTCCTTTCTTCCACTTCT
TATATTTTATGTTTGCTCTCATTTGGTAGAGGTTAGTCTGGAGCTGGGCGGTGGTACACC
TGGCTGAGTACACACAATGCAGAATGAAAGGACCAGGTTCAAGCCCCAGGTCCCCACCTG
TAGGAGAGAAAGCTTGACAAGTGGGGAAGTCGGGCTGCAGGTGTCTCTCCCCCTCTCAAC
TTCTCTCTGTCTCTATCCAATAATAAATAATGGAAAAAGAGTGTAGTCTGCAATCTAAAG
CTGTAGGCATATAAAATTCGAATCACATCATTTTATACCCCCCCCCCTTTTTGTGGGCCC
AGGGAGTGTATGTGCAGGTGGATGGTGCTAATGGTTGCTGTTATAGGAAAACTGCCATTT
TGTATCTTTCTGTGTTTGAAGACCACAACTGAAAAATTGTTTTCAAGTTTGGGACCTGAG
AGGGGAAACCCAGGGTTTGTTGTAAGTCATCTTTGTTTTAATGGCGTCGCCTTTAGCACT
GGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTTTAGCACTGGGGGATTTAAAGCCAGAAACTTACATCCAGT
TCACTTGGTACTTATCTCTTTTTTAAAAATATTATCTTTATTTATTGGATAGACACAGCC
AGCAATCAAGAGGGAAGGGAGTGATAGAGATGGAGAGAGACAGAGAGACACTGCAGCCCT
GCTTCACCACTCACAAAGCTTTCCTCTTGCAGGTGGGGACCAGGGGCTCGAACCCCAGTC
CTTGTGCATTGTAACGTGCGCTAAACCAGGTGCACTACCACCCGGCCCCCACTTGGTACT
TACCTAATCTCAGTCTTCAGTGGGTACTTGAAAACAGTTATAACCTCTAAAATCAGATTT
TTTTTTTTTTTGTAATTCTGAAGTTGTTGATAGTGTCATAAGCACTTTTTCCATGCCCTC
ACTTTTAGTATTGGTGTGTTCCTTGAAGAATCATTTCCAGTATTGATGTCACAGTTCTGT
GTCTCCTCTTCAGTGCTACCTTGCTCTGGCCAAAGGAGGCTTATGTGATGACCATGTCCT
CATCCTACCCATTGGACACTACCAGTCAGTGGTAGAGCTTTCAGCAGAGGTAGTGGAAGA
GGTGGAGAAGTATAAGACTACACTTAAGCGGTTCTTCAGGAGTCGAGGAAAGCGGTGCAT
TCTATTTGAGAGAAATTATAAGAGTCAACACCTCCAGTTACAGGTAATCCCTACCCAGGA
ACTTGAAAGAAACTCCACAAGGATCTGACTTGATAATTTTCAATAAAATTCAATAAAATA
AAAAAGTGCTGGGAGTTGGGAGGTAGCGCAGTGGGTTAAGCGCACGTGGCGCAAAGCGCA
AGGACCGGCACAAGGATCCCGGTTCGAGCCCCCGGCTCCCCACCTGCAGGGGAGTCGCTT
CACAGGCGGTAAAGCAGGTCTGCAGGTGTCTGTCTTTCTCCCCCGTTTTCTGTCTTCCCC
ATCTCTCTCCATTTCTCTCTGTCCTATCTAACAACGACGACATCAATAACAACAACTACA
ACAACAATAAAAAGACAACAAGGGCAACAAAAGGGAAAATAAATAAATTAAATAAAAAAA
TAAAAATAAAAAAGTGCTTATGACCCTATCAACAGAAAATGTTGTAATTAAATATATGAA
TATTTAATTAAATATATGAATATTTCATTCTAATTCAAAGTTACATTTTAAGTTTTTAAT
GAATTCATTTATTATTGAGTGAGAACTGAGCATTATATACAGTGTCAGAACTGGAACCTA
AGGCCTTATATATGCAAGGCATGAGGTCTATCTGCTGAACCAATTCCCTAGCCCCACAAT
TTTTTTTTTTTTTTTTTTGCCTCCAGAGTTATCGATGGGGCTTGGTGCCTACACTACAAA
TCCATCACTCCTGGAGACCATTTTTCCCATTTTGTTCCCCTTGTTGTTATTGTTGCCATT
GCTGCTTGTTGTTGCATAGGACAGAGAAATCGAGAGAGGAGGGAAAGACAGAGAAGGGGA
GAGATAGACACCTGCAGACCTGCTTCACCGCCTGTGACGCAAACCCCCTGCAGATGTGGA
GCTGGGGGCTCAAACCGGGATCCTTACTCAGTTCCTTGGGCTTCTCACCATGTGTGCTTA
ACTCACTGACCCTGCCCTACAATTTTTTTTATACTATAACATTTAATACTAACTTTAATG
TATTTACATAATGTTCTTTTAAAAGATTAGAGAGTTTCTGATTAGAGATTTTTCCAGAGT
TTTCAGAAGGAAGTACATGGACACTGTACATGAACAGCACAGGCAGTAAATGCCTTGTTT
TAGAAAGGACTGAATAGAGAGTTAAAGAAGAAGAGGCCAAGAAAGGGTTTGGGCCTTGAT
AGAGTTTGTGAGACAGTGGGTAATCTTGTGGAATCTTCGTGCGAGAGGACATTTGAATAA
TCTGTTTATAGTGGTGGTAGTCCTCCTCCTGGCACATTTGTTAAGTTTTCAAATGGGCTT
GACTCTACCACATACATTACTTAGGAGCTGGCAAAGGCTTGATGACAAAGAGACCTCTCA
TCTCTCTCTTGCCTTCCCCTTGTCAGATATTGGCTCCTACAGAGTATCTCATAAGTTTAA
GTCCTTACAGACAGGCTGACACAAGCCTGTTTCGAGTGAGGAGAATCTATGCTGAGGGGT
GTTTCTCTGCCCCTATGATGGATTTCTACTTCTCAAGAGAATGTGCAGGAGGCATACCTT
CTCAGGATGTTCACAGAAAATTTCTCCCATATCTCCCCCCCTCCAGGTCATTCCTGTGCC
ACTTGGTCATTGCACTACTGGTGACATTAAAGATGCCTTCATTACCCAGGCACAGGAGCA
ACAGATAGAGTTATTGGAAATCCCAGAGCTCTCTGACATCAAGCAGGTGAAACAGGAAGG
GGGGGGAGGTGGTGTTCAGAGAACAATAAATAATAATAATAGCACTTTACTAAGATGAGC
AAGACATTTTCTAAGGTAGGAACTTAGAAGGATGGATGATAATGATTTATAGTTGTTTTG
GTACTACTGAGAGACTCTTTACAATATCTGTCAGTTTGGTTTTTTTAAACTCTAGTTTTA
GGAAGTGACTTGGGGTTTATAGCCACTCATATCCTTTATCTTGCTTTTCTGGACTCAGTT
CTTCAGCAAATTAAACCAGATAAGCTAGAATTTTAGATTTTTAAAAAACTATTATGAATC
CTCATATAATTCTGTTTACTTTAGATTGCACAACCAGGAACAGCATATTTTTATGTTGAG
CTCGATACAGGAGAGAAGCTTTTCCACAGAATTAAAAAAAATTTTCCTTTGCAGTTTGGA
AGGTTAGTAAAACTTATTATTATTATTATTATTATAGTGTATTTTTACTAGATTTACTAT
AAGCAACATAGTGGGTTGCAAAGATATTTGAGTGAAAAATCAAATTGTTTTTTAAAATAT
ATATATTTATTTAGTTATTCCCTTTTGTTGCCCAAGTTTTATTGTTGTAGTTATTATTAT
TGCTGTTATCCTGATGGTCTGTTGGATAGGACAGAGAGAAATGGAGAAAAGAGGGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATAT
TTACATATATGACAGTAATGTAATGCAGAATGGGAAATGTACTATTACAAAGTTTTGTAC
TTTAGAGAAGGGAGAATTTGTCTTTGCTTGTTGAAAGGCTTTAGAAAGGGTTCGAACTGA
ACCACAATTTTAAGGCAGTACAAAGTAAACAAGGCATGTGCATTCTCGCCTGTGGGAATA
AAGTGCTGTCATTAATAGAGCATGTTCTCTGTGCAAGAATCTATGCCAAGAACTATATAT
GTGTTGTCTCATTTCATCTGCACACTCTGTAGGGTAGCAACTGTCGCCTCCATTTATCAG
CGTGGAGGTGAGATGCTAGACCTGGACCCAGTAGAACTTGCTACAACGATGGAGATACAC
TTTGTTGTCCTATACAGGAACTACTAGCCACATGTTTTTACTTAGCATGTGATATGTGAC
TAATGCCATGAAGGAACTGAATTTTTAGTTTCATTAACAAGGATTAAAATTTAAATAGGG
GAATTGGGCAGTAGCACAGCAGGTTAAGTGCAGGTGGCGCAAAGCACAAGGACCGGTGTA
AGGATCCAGGTTAGAGCCCCCAGCTCCCCACCTGCAGGGGATTCGCTTCACAGGTGGTGA
AGCAGGTCTTCAAGTGTCTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCGT
TTCTCTCTGTCCTATCCAACCCAACAACAATGACATCAATAACAACAATAATAACTACAA
CAATAAAACAACAAGGGCAACAAAAGGGAAAATAAATTAATTTAAAACAAATTTAAATAG
CTAGATGTTGCTCCTGTAGTAGGAGACATGACTCAAGATAACTCAAGTTTTTCCATACTC
CATAGTGATAGTTTTAAAACTCAGGCCTGCTGGGCTGACCCCAAAAGCATGAGACTCCAA
TTTCCTTATCTTGTAGTGTCTTAAAGGCCTAGATGTGGTTTCATTCTACTTGTATCAGAA
AGACTGAAAAACCATAGGGGGTGTACTATAAATTGGGCAAAGAAATATGGTCCAAGAGGT
GGCACACCTGACTGAAGCATAGGACTTTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCAGTCCCAAGACATCACCCACTGTGTCACCTCCTGGGCCACCCTATT
TAAAAAAACAATCTCAATTTGCATTTCACAGGTGAGTAAGTCAAGACCAAGATCAAGGCC
CAGAGATGAAATAATCTAATCAAGTCACAGACAGCAAGTGGTAGAGCTGGGAGTGCATTC
CAGTCTCTAGACTTTCTGACACCAGATAGACCTGCCCTATTTCTACTTGGCTTCTCTGAG
TATCAGCAATATATAATAATTTCAGTATTTTCTAAGGTGATTGAAAAGTTTATGAAAGAG
TAGGTCACTTAAAATAGGCATGGTTTTAGTAGATAGAAAAGGCAGTCAAAAGGAAAATGA
TAGGAGCAAAGTCAGAATTTGTATGCTTTGTTGCTGAGGAGAGGGCTGTGCCTGAAGAGG
AGGAGGGAGTTTTGGGTTGATATTATCCATTTTGACTTATTTGTGCTCTTCCTCTAGGGA
GGTCCTGGCTAGTGAAGGCATCCTGAATATTCCTGACAAGTCGGACTGGAGGCAGTGTCA
GATCAGCAAGGAAGAGGAGGAAACTCTAGCTCTCCGCTTCCGAAAAGATTTTGAGCCCTT
TGACTTTACTCTGGATGACTAAGCAAAGTGAAAGCACTTTATGCATTTCATAGGAAGCAG
CAGCAGTCTGGGGTTAGTGAGTGAGTGAGTGTGTGTAACTTCAGTCTCCTGTGGGGACTA
TTTCCCTGCCTCTTTTTGGTACATTCCTGTGGAACCTGCCTGTAACAAGAGGCCCGAGAT
TGAATATATTGTAGAAAGCATCACACTCTAGGATCAGAAATTCTTTGTTAAAAGCATGTC
TATCAGCCCCAAGTACTGCTTATCTTTGTCAACATTTTCAGGAACATTTAATCAAATAAA
AAATTTTCCATAGTTGGGAAGTGTTTTATATTCATATTACCTATAATCATTGAAATTAAG
TTGTATATGTATGATATACATAGCAATTATTTCAGGTAGCTTCTGCCTGAGCAAGCCAAG
GTGGAGAAGAGACCCAACATAATTATCATTTACTCTTATAAGCAGCTTAAGCCATCATCA
TATTGATATAAAAAAGCTCATTCAGCAAACACCTGACTTCTTTGTGAAAAACATTTTTCT
GGGCTCTGGGAGTATAGCAGTGTCTTGACATGACCTCTGTTCCAGAATGTGTTTTGTAAA
GAGAAGGACCAGATTTATGAGGTGACGAGTTCTGCTTCAGATATATTGATCTTTAGTGTG
CCACTGAATAATTCTAAATCAAGGAACAGGGTAGGTGTCACAGGGGAAATGATGAGAATG
GTTGAAAATAGGTGAATACAATCCCAAAATGAAGTCCTAATGTGAAAAATACCAGTATTT
GGGAGTCAGGCTGTAGCGCAGTGGGTTAAGCGCAGGTGGCGCAAAGTGCAAGGACCAGAG
TAAGGATCCCGGTTCGAGCCCCCGGCTCCCCCACCTGCAGGGTGAGTCGCTTCTCAGGCG
GCGAAGCAGGTTTGCAAGTATCTATCTTTCTCCTCCCCCTCTCTGTCTTCCCTGCCTCTC
TCATTTCTTCTGGTCCTATCCAATAACGGTTGACACATGATTATAACTCCACAATATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3209..3293, 4326..4397, 4400..4403, 5167..5268, 6976..7190, 10688..10774, 10777..10788, 10791..10804, 16418..16502, 21908..22048, 25653..25767, 27194..27201, 27206..27271, 43253..43462, 45026..45145, 45484..45581, 47677..47818
1001..1023, 3209..3293, 4326..4397, 4400..4403, 5167..5268, 6976..7190, 10688..10774, 10777..10788, 10791..10804, 16418..16502, 21908..22048, 25653..25767, 27194..27201, 27206..27271, 43253..43462, 45026..45145, 45484..45581, 47677..47818
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved