Erinaceus_europaeus Locus ENSEEUG00000005292
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus ENSEEUG00000005292
Erinaceus_europaeus
ENSEEUG00000005292
GeneScaffold_6668
SNORA62
6708..6861
13779
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AACAGCTGAATTTAGAAAGAATTAAGGGGGGGGGATTCAACTTTCAGCTTGAGAGTAACA
GACCTAAGCTTAGATGTGTGATAGGTGCTGGGCAGGGTCGAGCGGGGCGAGGAGGAGGAG
CAGCACGTGCACACCATTAAAGCTCAGGGTGGAGGCCGGTTCTGGCCTGTGAACTTCTGA
GTGTCGGAGGTGTGCTACAGCAACGGCAGGGTTTCGCTAACACCAGGAGAGCTCGGCTCT
ATGACTGGAGTTTGCTAGTGCTCTCTGCCACATTCAGCTGCTCAGAGGAGTGTGCGTCGC
AGCACCTGGCCAGGGGTTGAGTGTCCTGCTGTCTCCTAGGCATCTACATCATCAACTTGA
AGAGGACCTGGGAGAAGCTGCTGCTGGCCGCGCGCGCTATTGTTGCCATAGAGAATCCAG
CTGACGTCAGTGTGATCTCTTCCAGGAACACTGGCCAGGTGTGCAGGGCCTGTGTGTTGG
GGTGAAGGACCTCCCCGTTGGAGTTTCCAGCTCCCCACCTGCAGGGGAGCTGGACAGGCA
GTGAAGCAGGTCTGCAGGTGTCTTACCTTTCTCCCCCTGTCTTCCCCTCCTCTCCATTTC
TCTGTCCTACCCAACAAGGACGCCAGTAACAATAACAACTACAATAATAAAAGGGCAACA
AAAGGAAAAGTGAGGGAGCAACAGGAACCCTGATGGTTCACATGTCGTTCAGTCTCACGG
ATGATGTATGCGCACCTCAGCTTTACACGTCACTTCGTGCCGCTGACCATCCGAGAGCTG
ATGGATTCATGACATTCTGTAGCTAAAGCAGAGCTTAATTTAACGTGTCTTTTGCAAAGG
TCTAAGGGAGGCCAGTTGTAAGGCAAATTAATCCTTTTGGTCTTCTGTTGACATGCTTTT
CTGTTGAAGATAATGGGGATCTTGAGGGTTGGCTTACAAGGTTTCAAGATTTCATCCCAT
TTCTGATTAAAATAGTTTGGCTTGGATTTTTTTATATGTGACAAATTACTGCTCTAGAAA
ACGTACTGGCTGTCCATCTAGATTGGTCTAGGTGATGTTTGGGGCTTAAGACAAAGCAGA
AGGGCCCTCACTTGGATCTCCTCTTTTGTGAGTGTGGTTAGTAGGTTACAAGACTAAGAT
TACAATGTATTAGTTCACCAAAATTCTGTGTCCTCACCTTCCTGCCTCCCAAAGATAACC
ATCATAATTCTCACAAGTCTATGAAAGTTAGCTTTTAATCTCTAGAAAAGCAATTTTACC
TCTTAATAGAAAATGGAGAAAATCAGCAGAACACAAGACAGATTTGGTGCCATTAGATTG
GACCCACAGTCCACAGCTCTTCCTGGGTTGCAGCTTGCTTTTTTGAAATTAACACGCAGA
GAAGGGTGATAGTGTTTATATAGGTAGCGCGGAGATTTTGGCCAGAGGCTGGGGAGATTT
GATTGCCACACTCCCATGTATTAATTAGCTTGATTTCCATAGCTATGAGGAACTTGCCCA
CATCACTCCTGAGTAGTCCACTTGTAAGAAACCCAGGACAGTGGTTCCGGTGCCTTAGGA
AGCAGTGATTCAGATAACCAAAGAAAAGTGTCGGTGGAAAGTTAACTTGCAGAGGGTCTG
GGTCTTGGGTGGAGGCTTGTTTCACATTCCCTGGCTTTTAAGTGCTCTTTTTGTTTTTTT
TGTTTGTGGATGTAGCAATACAGACTGATAGAACTATTTGGCAGTTTTAGTGTTTTGAGA
AGTTTGAGGTTTTCAACTAGATGTAATGGTGACAGTCTGGAAAGATTTTATGACTCCCTC
TAAAGTGCTCCTGTTCTTAGCGAGCTGTGCTGAAGTTGCTGCTGCCACTGGAGCCACTCC
GATTGCTGGTCGCTTCACTTCTGGAACTTTCACTAACAGATCAAGCTGCTTCTGGGAGCA
AGGCTTCTCGTGGTTACTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGGACCATTCCGAGTCAGGCTCCGCCCTACTTCCGCTGACCCGTCGTTGTCATTGGCTC
GTGGCGGACTATATAAACACGTCACTTCCGCCCGCCGCTCCTTTCCGCACTACCCAAAGA
CGGGCCCATACGGCGTTGTTCTCGGTGAGTTCGCAGGGGCGTGTGTTGCGTCTCCCAGCC
CCGCCGGCACGGGCTTTATTTGCTCGGAAGAGGGTGTAGGAGCACTGGAGGTGGGAGCCC
GCCGGCAGCTTGAACCTGCGGCTCGCGGGGCGCTTCTTGGCGCGGCGGCCGGCGCGTGGC
GGCCCGCGGGCTCCCGCAAGGCCCGGCGAGAGGAGGCGCGGGGGCGCGCACCGGGTCCCC
CCAGCACCTGCGCCGGCTCCGCGGCGTGGCGGCTTAGGGCCCTGGGGCCAGGGAGAACGT
GGCCACGCTCCCAGCCGCCAGCGGGGCGATCCTGGGTGGGTTCTGGCCCCCGCCCGGGCG
GTCAGAATGCGCCGAAGTCACTGGCCAGACGGGCTCGGTCGGCCTGCTTCAGCGTTTTGC
CCCAGGTCCGTGTGCATCCGCCCTCTAGAAGCCACGTGAGTGGAGCCATGTGGGAGACGC
GTTTCTTTTTATTTTATGTATTACTGGTCTGAGACCGAGAAGTTGGGAAGATTGCGAGAG
CCAGACACCTGCAGCCCTGCTTCACTCGCCACGTTTCCCCCCGCAGGTGCAGGACCAGGG
GCTTGAACGCGGGTCCTCGGGCGCCGTAATGTGAGCGCCCAACCAGGCGCGCCACCCTTG
ATGCCTTGTATTGCACTTAACTGTTTTTTTTTTTGAGTGTTTATTTTATTCCCTTTTGAC
GTCCTTGTTTTACTGTGGTTACTGTTGGATAGGACAGAGAACTGGAAAGAGATGGGGAAG
ACGGGAGAGAAAGACAGACACCTGCAGACCTGCTTCACCGCCCGTGAAGCGACTCCCCTG
CAGGTGGGGAGCCGGGGGCTCGAACCGGGATCCTTAACGCCGGTCCTTGCGCTTTGCGCC
ACGTGCGCTTAACCCGCTGCGCCACCGCCCGACTCCCAGTATTTCACTTCTGTAGGTAGT
TACACTCTGCGCCATCACTTGCAGTTCTTGTCCCGAAGGATGCTACTTTTGATTGCAGAG
TAGTAGTCCACGACGTGTCCATAACCTGAGCCACTCAACTCTCGGTAGGCGCACTTAGGC
TGTTTCCATCCTTTGGCCACTGGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTT
TTAATCTCTAGAAAAGCAATTTTACCTCTTAATAGAAAATGGAGAAAATCAGCAGAACAC
AAGACAGATTTGGTGCCATTAGATTGGACCCACAGTCCACAGCTCTTCCTGGGTTGCAGC
TTGCTTTTTTGAAATTAACACGCAGAGAAGGGTGATAGTGTTTATATAGGTAGCGCGGAG
ATTTTGGCCAGAGGCTGGGGAGATTTGATTGCCACACTCCCATGTATTAATTAGCTTGAT
TTCCATAGCTATGAGGAACTTGCCCACATCACTCCTGAGTAGTCCACTTGTAAGAAACCC
AGGACAGTGGTTCCGGTGCCTTAGGAAGCAGTGATTCAGATAACCAAAGAAAAGTGTCGG
TGGAAAGTTAACTTGCAGAGGGTCTGGGTCTTGGGTGGAGGCTTGTTTCACATTCCCTGG
CTTTTAAGTGCTCTTTTTTTTTTTTTTTTTTTTGGATGTAGCAATACAGACTGATAGAAC
TATTTGGCAGTTTTAGTGTTTTGAGAAGTTTGAGGTTTTCAACTAGATGTAATGGTGACA
GTCTGGAAAGATTTTATGACTCCCTCTAAAGTGCTCCTGTCCTTAGCGAGCTGTGCTGAA
GTTTGCTGCTGCCACTGGAGCCACTCCGATTGCTGGTCGCTTCACTCCTGGAACCTTCAC
TAACCAGATCCAGGCTGCTTTCCGGGAGCCAAGGCTTCTCGTGGTTACTGACCCCAGGGC
CGACCACCAGCCTCTCACAGAGGCTTCTTACGTTAACCTGCCTACCATCGCCCTGTGTAA
CACAGACTCTCCTCTGCGCTATGTGGACATTGCCATTCCCTGCAACAACAAGGTACGGGT
TGACCTCAGGTTCAGTACAAGTGCTCTAGGAAAACTTGGGGAGATTCATCTGCACATTGT
TAGAGCTTGGAGTTGAGGCCACTGGCTGGCTTGTGAACTCTCAAGTGTAGGTAGTGTGCT
ACACGAGGGGCAAGTTTTTCGCTAACACCACGAGGGTCTCTGGCCCAATGAGTGGAGTTG
GATAGTAATTCTTGCTACAATATGTAAAGTTGATGTGTTTTAGTAATGATGAAATTTTTT
TGTAGTATTTTTATTTTTATTTATTCCCTTTTTGTTGTCCTTGCTGTTTATTGTTGTTGA
TGTTGGATAGGACAGAAATGGAGAGAGGGGAAGACAGACACCTGCAGACCTGCTTCACTG
CCTGTGAAGCGACTCCTCTGCAGGTGGGGAGCCGGGGGCTCAAACCGGTATCTTTAAAAA
TCCCGTGTTATTTTGTCCCTTTCGCTGTATTATTACTTAAATTCTTGTGGGCTCTTGGCC
AAGTGACATGAGGTTTAAATTGACCTATTTTTGGCTCAGGTCTACTGGTTCAACAAGACC
CAAATGTCCACACTATTCCCAGGATTTGTTATATTTATATATTGGTTAGAGAGAGCCAGA
AATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGCTTGTGAACTC
TCAAGTGTAGGTAGTGTGCTACACGAGGGGCAAGTTTTTCGCTAACACCACGAGGGTCTC
TGGCCCAATGAGTGGAGTTGGATAGTAATTCTTGCTACAATATGTAAAGTTGATGTGTTT
TAGTAATGATGAAATTTTTTTGTAGTATTTTTATTTTTATTTATTCCCTTTTTGTTGTCC
TTGCTGTTTATTGTTGTTGATGTTGGATAGGACAGAAATGGAGAGAGGGGAAGACAGACA
CCTGCAGACCTGCTTCACTGCCTGTGAAGCGACTCCTCTGCAGGTGGGGAGCCGGGGGCT
CAAACCGGTATCTTTAAAAATCCCGTGTTATTTTGTCCCTTTCGCTGTATTATTACTTAA
ATTCTTGTGGGCTCTTGGCCAAGTGACATGAGGTTTAAATTGACCTATTTTTGGCTCAGG
TCTACTGGTTCAACAAGACCCAAATGTCCACACTATTCCCAGGATTTGTTATATTTATAT
ATTGGTTAGAGAGAGCCAGAAATTCAAAGGAAAGGGGAAAGACAGAGAATAGAGACAACT
TACAGCACTGGTTCTCTTGTGAAACTTCACTTGTCGGGGGGGGGGGGTTACGCCTGGGTC
CTTGCACATGGTAAAATATGTGCTCAACCTGGTACACTACCACCCAAGCCCCAAGAATCT
TTATGGTTTCAATTTGTAGTCAAAGTAGAAAACCACTGACTTAGTAATAGTTAGCTAGAT
GATATGGAGAGGCAGGTAGTGTTTTAAATACTTTACACGAGAGTAGAGAGAATCCTAGGG
TCACTCTGGCATGCGTAATGCTGGGAATTAAACTGAGGACTTCATGTTTGAATCCAACAC
TTGACTACACCCCTCCAGTGACCACTTTCTAATAATTTTGACTCTTTGCAGGGAGCCCAC
TCAGTGGGTCTCATGTGGTGGATGCTGGCCCGTGAAGTTCTGCGCATGCGTGGCACTATC
TCCCGTGAACACCCCTGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAGGAG
GTAAGCTCATGGTGTACCGTAAGCAAACTTGAGGGGTTCATCCATGATTCAGGGAAGCGG
TTGTCAATCCAGTAAACCTTTTCTCCTCGCCAAAAATCAGATTGAGAAGGAAGAACAGGC
TGCTGCTGAAAAGGCTGTGACCAAGGAGGAGTTCCAGGGCGAATGGACGGCTCCAGCCCC
AGAGTTCACCGCAGCCCAGCCTGAGGTCGCAGACTGGTCTGAGGGCGTGCAGGTGCCCTC
CGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGGAGCCCCCGCGTCCCCCCCCCCCCTTCCGCAGGGG
AAGTTCTTTCCCCCGCGTCAAGCAAATTTATTGGTTTCTTTCTTTTTCTTCCCCCCTTTG
CTTTCCTCCATTTCTTTCTGTCCTGTCCAACAACGACATCAGTACCTACAACAATAAAAT
TACATGGCCAACCGAAGTGAATAAATAAAAATTTTAAAAAGTTTTAAAAAATGGGGTTGG
GGTTTTGGTGGGGATAACATTGAATTTGTGTATCAGCCTGATCATATTCTTAACTGGAGA
AGGCTTTTTACTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCTTAAACTCATTCTTTCTAG
AGCCCAAGCTTGTACATTATTTATCATAGCTGGGACTTCACACACTTGGAATTCTGTAAA
ATGGCTTATTGCTCAGTGAGCCAGGGCCTTAAAAGCCTGACAAACATTTTAGCAAAAATA
CACTGTCCAAAGCATCTAGCACATAGGTCTCCTGGAACCGGGATCCTTATGCCTGTCTTT
GCACTTGGCGCCACCTGTGCTTAACCCACTACGCTACCACCTGACCCCCTCTCCATTTCC
TAACACAAAGAGTGAATAAGTTGGTCTGGGAGTAGTAGTTTCATGGATGTGTGAGCTCCT
GGCACCAGAGAAAAACAAATACCACTGGTGACACAGTGCCCTTGGATAGAGGGTTCCTTA
GCCGTATCTATGACCAAGGTTTGAACCCGGTCCCCACCACACAAGGAAACTTTGATGCTG
TGGTCTCTTTCATTGTACTTTGCCTTTCCACCTCTTTTGTTTCTATTAAAATCATTAGGG
GGTCAGGAAGATAGAATAATGGTTATGCAAGGTTTTTCCCATTTGAGCCTTAAGGAATTC
AGGTTCAAACCCTTTCGTATTCATTAGATGAGTCTTCCGTATTTTACAGCTTTTATTCTT
TAGTCAATTCTAGTCTACCCTACACAGAACAACCACAATCAGGATCAAATTTGAATCCTT
CAAGCTCCATCCAAGATGGGCGGAAAACGGTGAAATCACCGTTTTTAACAGCTGAGTGGT
ATTCCATTGTGTATATAGACCACAACTTGCTCAGCCACTCATCTGTTGCTGGACACCTGG
GTTGATTCCAGGTTTTGCCCATTAAGATTGTGCTGCTATGAACATATGTGTGCACAGATA
TTTTTTAATGGCATGTTTGGTTCCTCAGGATATATCCCCAGCAGAGGAATTGCAGGGTCA
TAGGGTAGGTCCACTTCTAGCCTTCTGGGAGTTCTCCAGACCGCTCTCCACAGAGGTTTC
GAGCAATTGACATTCCCACCAGCAGTGCAGGAAGGTTCCTTTGTCCCCACAACCTCCCCA
ACATTTGTTACTGCTTTTAAATTCTGTATATTTTTTTTATGCATTACACACACACACTTT
CTCTTTAACATTCCATTTTAAGGAGAGAGAGAAAGGCCAGAGCACTGCTCATCTATGGCT
TATGGTGGTGCTGGGGAATGAACCTAGGATCTCAGCCTCAAGCAGGAAAGTCTTGCAGAA
CCAGTATGCTGTCTCCTCAGCCCCTGCATTAGTCTCTTGTCACAGTGGATTTAAGAAGCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCAGCCCCCCACTGCTCCAGGCCACTGGAGTGGGTGGAACAACTACTGAGTGGTCTTAA
ACTGTTCTCCACTAAAATCAGAGAGCGGCAAGTGAACATTTTCTATTTGATGGGAAATAA
AACATTTCTAAACATTGAGTCCATTTACTTTGGTTGTAGATGTGACATACATACATAGGT
TTTTAGTCTTCATTTCCTAGGGCAAGTCATCTGTAAAAGTTAGGCAAGACTCATGGCCAA
GGTGCTGCCGTCCCAGATTCAATCCCCAGCGCCACTGAAGTCAGAGCTGAGAGTACAGAA
ACACCTGTGAGCCCTCTACCCCTGATTGTCCTTTGTCCAGCTCGTTTACGATCTGTGGTA
CCGGAGCCTTTACATAACCAATCCCACCAACGTGTGGGCCTTGCAATTTTCACTTTTTCT
TTTATTGGAGGATTGATGTTTTATATTCGACAGTAAATACAATGGTTTGTACGTATATAA
CATTTCTGTTTTCCACGTAACAATACAACCACCACTGAGTTCTCTTAGCCATTTCCAGGA
CCTGTGTTCTCTCCCACTCACCGCAGTCTTTTACTATAGTGCAATGCACTAACAATTTTC
ACTTTAGATGTAAACATGGCACCAGAGTACTGTCTCGCCATTTGTGATGTTGCCCTGAAT
TCATATTCTAAACACGGCCATGTACTAAATGGCTCACATGAAAAAGTCCCAAGTTTACAT
GACAAAACATTGGCCCATAGAGCAGAACCTGTTCCCCTCCAGCAGGGAGTCGTTTCACAG
GGGGTGAAGCAGGTTTGCAGGTGTTTTATCTTTCTTTTCCCCTCTCCATTTCTGTCTTAT
CCAACGACAGCAGTAACAAGGGCAACAAAAGGGGGGGAAATGCCTCCAGGAGCAGTGGAT
TTGCAGTGCAGGCGCCAAGCCCCAGCAATAAACCTTGAGGGGAAAAAGTGTGGGGCCAGT
TGGTGTGTGCACCTGTTACAATGCATAAGGACCCATGTTCAAGCCCCTGGTCCCCACCTA
CAGAGGGAAAGCTTCACAAGTGGTGAAGCAGGGTTGCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 6406..6651, 8271..8399, 8500..8665, 12580..12621, 12726..12737, 12739..12779
1001..1117, 6406..6651, 8271..8399, 8500..8665, 12580..12621, 12726..12737, 12739..12776
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved