Erinaceus_europaeus Locus GLTSCR2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus GLTSCR2
Erinaceus_europaeus
GLTSCR2
GeneScaffold_1795
SNORD23
12283..12396
14697
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTTGTTGTTATTATTGTTGCTGCTGGATAGAACACGAT
AGAGGATGGAGAGAGGAGTGGAAGACAAGGAAGGGGAGAGAAAGACAGACACCTGCAGAC
CTGCTTCACCACTTGCAAAGCTTTCCCCCTGCAGGTGGGGACCGGGGCCTTGAACCTGGG
TCCTTGTGCACTGTAATGTGTGCTCTCAATCAGGTGAGCCACCACCTGCCCCCGACTTTT
TTTTTTCTTTTAAAAAAAATTGTCTTTATTGGAGACAGCCAGATATTGAGAAGGGGGAGA
CAGGGAGAGCGACACACACCCGCAGCCCTGCTTCACCACTTATGAAGCTTTCCCCTCTGC
AGGTGGGGGTCGGGGGCTTGAACCTAGGTCCTTCCGCACTTTAATATGTGCCCTCAACCA
GGTGCGCCATCACCCAGCTCCGAGGCTTTTTAAAAAAAATTTTATAATTTCTTTATTGGG
GAATTAATGTTTTACATTCAACAGTAAATACAATAGTTTCTACATGCATAACATCCCCCA
GTTTCCCATATAACAATACAACCCCCACTAGGTCCTCTGTCATCCTTCTTGGACCTGTGT
TCTCCCCAGCCACCCACCCACCCACCCCAGAGTCTTTTACTTTGTTGCGATGCTCTGAGG
CTTTTTAAAAAGACATTTCATTCATTTATTTTTACCAGAGCACTGCTCATCTCTGGCTTT
TGGTGGTGCTGGGTAAACCTAGGAACTCTGGTGTCTCAGGCATGAAACCACCATGCTGTA
TACCCAGCCGTATACATTGAGACTTTACATAGGGAGGAGCCATGTTGATTTTACCAAAAG
AGTGATCGGAAGTACGTCACTGGAGGGGTGGGAGCCCTGCGTGCGGCACGCCCTCAACCG
GATGTCGAGGCGTCAGCGAGGTCGAAGTTTCCTTTGACAAGATGGCGGCGGGGAGGTCTG
GCAGTGTCGTCAGGCGCCGCTCGAAAAGCGAGGCCGATTCCGGCTTTTTGGGGCTGCGGC
CCACTTCAGTGGACCCGGCGCTGAGAAAGCGGAGGCGGGGCCCGAGAAATAAGAAACGGG
GCTGGCGGAGGCTTGCGGAGGAGCCACTGGGCCTAGAGCTCGACCAGTTTCTAGAGGATG
TGCGGCTACAGGAGCGCACGAGCGGGTGCGTGAGGCGGGATTTCCGGTCTCTGGGCGGCC
TCCCTGGGAGGACTTCCGGGGAGGCGGGGAAACTTCTTAATCTTTCAGGGCGCGACGGGA
CTGGGTTGCTGGGTACTGCGGGTCGGGAGCTTGGAGGGGGCTTGATATGGTGATCAGACT
TAGCAAAACAAAAACGAACAAACAAGCAAGCAAAAAGCCGGGGCATTCAGTTAACTTGGC
ATTTCAAATGTGTTTTTTTTTCGGTGGCATCAAGTTCCACCCGCCGCCCCGACTTAGTAC
ATTTCAAATCCTGGAAAGCACGGGGGAGATCTCAGCCTGGAGTCCTGTAGGGGGAGGAGA
GTGTGTGCATTGTTATACTCATGCACAGAGGAATGCCAGAGGAATAGCTCACTTGGATGG
TGTGCTGCTTTGCCATGTGCTTGACCCGGGTGTTCGAGCCCGGCCTCGGCTGCATTGAAA
GAAGCTTTTGTGCTGTGGTCTCGTTCTCTGCCTGTTTCTATTTAAAAGAACGAGCAACTA
TATATTGGAAAACTGGGCTCTTAGGGCACTCCTCTGCACTCCCCCTCTCCCCCCATTTTG
GTTGACCTGGGCTGACTGGGGCATTTATATCTTACAGGGGTTTGGTGTCAGAGGCCCCAG
ATGAAAAACTCTTCTTCGTGGACACCGGCCCCAAGGACAAAGGTGAGGAAGTGCTTTCCA
GGTGATGGCGCACAAGGCACTGAATGACTGGTCCCTACACTCACTCCTTTCTCTGAGGGT
TAGAAAATGTTAAGGGTTTGATGGGCTGGGGAGACAGCATAATGGTTCTGTGAAAAGACT
TTCAGGCCTGAGGCTCTAAGGTCCCAAGTTCAGTCCCTAGCACCAACATAAGGCAGAGAT
GAGCAGTGCCCTGGTCTCTTATCTCATTAAAATGGACATTTTAAAAAAGAAAGAAAATGT
GAAGGTCTGGTGCTCACAGAAGGCCAGTTAATCAAGAGCCAAGAGGTGGCGCAAGGAAAG
CTTGGGAAACAAGATGGCAGACTTTTGTTTTGAATGGGTGGGGTGACGGAGGGTGGCTCA
TTTGGTAGAGAACACATGTCACAGGGGCTGGGTGGTGGCACACCTGGTTGAGAGCACCTG
TTACAATGCTCAAGGACCTAGGTTCAAGCCTCTGATCCCCACCTGCAGGGGGAAAGTTTC
AGGAATGGTGAAGCAAGACTACAGGTGTCTCTCTGTCGTTCTCCCTCTCTAAATTCCCCT
TCCCTCTCAATTTCTGTCTATCCAATGAATAAGTAAATAATCAAAAAGAGAGAGAGCACA
TTACCACTTGACCTTTGGTCAAGTCCTTGATCCCCACCCGTGGGGGAAGGGTTGCTTCAT
GGGCTGTTGTAATAAAAAAAATTCTGTAATATAGCTTAAGAGTAACCAAAGAACGAGACC
TGAGGCCACATGGAGGGTAGGGAATTACATTTATTTTACCATAACCAGTTACAGGCTGAT
TCCTGTCAGTCCTGCATAGCTTGTGCTGCAGCACCCAGCTTTTATCAGTTTCAAACTGCA
TGTCACACGCTGATTGGTTAGAAACAAAGTCCATCAAGGTGCTGACAATAAAGGTGAGAG
CGGGTTGGTTACCATCGGAGTTCACCATTGGGATGCTGGAATACAGAAGTGGCCGTCCAC
CAGGAGCCTATGGATTTTTCCTTTCACTGTGAAGCACTGCTGCAGATGTCTCTCTTGATC
TCCCCTTCTCAATTTTTCTATCCAAAATAATTTTTTTAAGTGCCAAAGGTTAGGGGTTCA
GGGTTTTTATTAAAGGGTCAGTGGGGAAAAGTTTTTTGGTGTTGATAATACTGCCTGGAC
TCTGTTGGGTGAGGCATGGTCACATGGAACAATTTACTGAGGCTGGTGGTCTGCTCCTTG
TAAAATAAGAGAGCATCATTAAGCAACACCCTTCCCCCAGTTTGTCATTCCCTGGTGTCA
GGAGACGAGGCAAAAGGGCAGGTAGGCATTGTTTTCTTTTTTCCGCCACCAGGGTTATTA
CTGGGTCCTGGTGCCTGCATTGTGACTCCACCATTCCCAGTGGCATTTTTATTTTTAGTA
TTATTTCCTTGATAAAGACAGGGAGAAAGACAACTACAGCGCTGTCTGACCACGTCTAGG
AACTTGAACCGTGATCATGTTGCATGGTGATTTGTACACTAGGTGCACCACCTCCTGGCC
CAAATACAAGTTAAAGGCCTTTCCTTGAAAGTGTTTTTGACTCCTAGGAAGTGCCAAGGA
TATAGGAAAATGTATGTTGGGTGGGAGAGATAGCACAGTGGTTATGTAAAAAACACTTGT
GCCTGAGGCTTTAAAGTGCCAGATTCCGTCCCCATGACCACCATAAGCCAGAACTGTATA
TTGATGTCTGGAGGGCAGTGTGGATTCTATAAATATAAAGCTCACTATAAAGAGGTTGAT
GACGGGGGCCAGGTGGTGGTGCGCCTGGTTGAGCTCATGTATTACAATGAGCAAGGACCC
AGGTTCAAGCTCCCGGTCCCCACCTACAGGAGGAAAGCTTTGCAAGAGGTGAAGTAGTGC
TGCAGGTGTCTCTCTGTCTCCCTCTCTATCACCCTCTTGATTTTTGGCTGTCAGAGGTTG
ATGACAAAGCTTGAAAGAGAAAACAGCATTTATATTACAAGCAAGAGGTCCTTGATGCTA
ACAGAAAGCAAGTTTGACACTAACTTACGGAAGGCAGGTTTTGTTTTTCGGAGCTCCATG
TCATAGAAGAGCCAGACAGGTTTCTGTCTTGATGAGGTGATTACACATGAATAAAATTTT
TGCAAACACGGGGACCCTTCTGCAAGAAGTTACACATGTTTTAGTTAATAGTTAGCACTT
TGATTAAAAGTAAGTGAGTCTCTCTAGAGAGAGAATGAGCTAGAACATCTTTCTGGTACA
TGTAACATTGGGGATCGAACCCAGCACCTGTCTGCCTGTCTTGGTCCGCTTTGCTCTTGC
CTACTCACTAGATAGGCATTCCCCCTTAACCCCTTTGACTTTAATTTGGCAACATGCAGG
GTCCAGATCTGCAGAAACCAGTAGAGAAGGGGAGTGAGTCAGGAGTTGTTCAGGTTGGTG
TTAACATACAGAAAAGCCAACAGCATAAAGCTTGCTTTAGTGAGGGGGCTAGGAAACAAG
CTGAAAACCAGTTTGAATGAAAAGGCTGATTGCTTTAAGGAGCAAAGTGATAAGCTGCTT
AGCAACAGCTGGGGGCCTAGGGCCAGGGAAATAGAATAGCTCACTTGAATAGTGTGCTGC
TTTGTCACGCACTTGGCTCAGGTTTGAGCCCAGTCCCCATCTCATTGAAGGGAGCTTAAG
TGTTTTATTTATCATAAAGAGACAAATCAAAAGGGAAGGGGAACATGGGAGAGAGAAAGA
TATCTGCAGCACTGCTGGAGGACCCCCCCCCCACAAGTGGGGGCTGGGGACTTGAACCTA
GGTCCTTAACTATAGAAATGTGAGCCACCGCCCAGGTGTATTTGTCTCCCCTTCATTTCT
TCATTAAAAAAAAAAAAAATTTTCTATTAGTGATTTAATAATGACTAACAAGATTGAAAG
ATAACAGGAGTATAATTTCACACAGTTCCCACCACTAGAGTTCTATGTCCCATCCGTTCC
AATGGAAGCTTCCCTATTCTTTATCCCTCTGGGAGTCTGGACCAAAATTCTTTGAGGGTT
AGGGTTAGATGATGTCTGGCTTCTTTTTCTTTATTAACAAAAGAACAGAGCATCACTTTG
GCTCATGCAGTAATGACAGGGACCTCCAGCTCTTATGCCCAATGCTCTAGTCGTTTATTG
CTTGACCTCCCAGGCCATAAGAAATTTATTTATTTATTTTTTTAACCAGAGCACTTCTCA
GCTCTGGTTTATGGTGGTGCAGGGGATTGAACCTGGGACTTTGGAGCCTCAGGCCTGAGA
GTCTCTTTGCATAACCATTATGCTATCTACTCCCACCCCAAGAAATTGATTTTTAAGAAC
TTCTCTGACTAGTGGGAAATCTCCCTAAGCAGTTTATAGGTTCTGTTTTAGTTTAAGGGG
GTTAAAAAAAAAAAAAGAGTCTAGGTCAGGGAGAAGCTCAGCATACTAGAGCACAGGACT
TGCATGCCTGAGACCTCAGAAGTCCCAGGTTCAGTCCTGGACACCCCCACCACCTTCTCC
CAGAACTGAGTAAGGCTCAGCTGTTTCTTATTTCCACACTTAAAAAACAGAGTTAAGCGC
AGGTGGCGCAAAGCACAAGGACCGGCATAAGGATCCCGGTTCGAACCCTGGCTCCCCACC
TGCAGGGGAGTCGCTTCACAGGCGGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCT
CCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACGACAACAACAAT
AATAACTACAACAATGAAACAACAAGGACAACAAAAGGGAATAAATAAATAAAATAAATA
TTAAAAAAAAAAAGTGACTCACAGCTGCTCTGTGCCCCTCATAGTGCCTCCACACAGCCC
CATGAGGTGGGCTATAGCGTCCTCCTCTGGGGGAGGGAAGGAGCAAGAGGGACAGAATGG
CTCCTGGGACCCTACAGCTGATGTTGGAAGGATCCAGATCCGACCTCATCTGTTCTGCCC
CAGAGTTCTTGCCATCAGCCATTCATTATCAGAAATAAAAGGCAGGGAATCCTGTTGTGC
TGAGAACATCACCGTCTGTGGGTCCTCCTGGACCTCTGAGTCACCTGACTGCCGCTCTGC
CTCAGTGTCAGTGGGTCTGGGGCCTTCCCTCCAGGCTGTGGCTGTAAGTCTGGTCCCTCC
TGTGTCCCCAGCAGTGGGCCGTCTCCAGCTAGACCAGAAGTGGTGTGTGCGTGCATGTGT
TGGGGGTTGGAGTTGGGAACTGTGGGCTTTGGGGGCCTCTTTTTTTCCTCAGGTCAGGGT
CCTGGACCTCCATGAAAACCTTGTCTCCTCTCTCTCATCCCCAGAGCTGCCCAGGAAGAA
GCCCAGACACCAGAAGAGGTCACTGCTTCTCAAGAAGCCCCTTCGAGCTGACCTCATCCT
TGAGAACACATCCAAGGTCCCTGCCCCCAAAGAGTGAGTGTCACCCCCACACACATTTGA
CCCTTCTTCCTCCTGGTGTCTGGCCCTGTGCAGTTCCCTGCAGCAGCTCCCCCCGCCCCA
CAGTTCTGACCTAGAAGAACTGGGGCATAGAGGGAGGGCCTGTCCCTCAGTGCAGGGGTC
AGTGAGGGGAGTTCAAGGACTGAGGCTGTGGGGGTGTGGCGGGGAGGGTGTTGAAATTGG
AATGAGCAAGAAGGGCTCAGGAGAGAGGCCAGGGCAGAGATGGGGAGGGGTCTCTTGTGG
TCTCTGCCTGGCCTCACCTGTTGGCCCCTGCCCTCTCCCGCACCAGCATCCTCGCCCACC
AGGTCCCCAACGCCAAGAAGCTCAGGCGGAAGGAGCAGCTATGGGAGCGGCTGGCAAAGC
AGGGCGAGCTCCCGCGGGACGTGCGCAAGGCCCAGGCGCGGCTGCTCAGCCCTCCTGCCC
CCAGAGCCAAGCCTGGGCCCCAGGACACAGCTGAGCGGCCCTTCTATGACCTCTGGGCCA
AAGACAGTGAGTGTTGTGTGTTCCCCTCCCCATTCCCCTGCCACTGGAGGTCAGGGCCTG
ATGGTCTCTTCCAGTGATGGCCTTCCCTGTTCCTGTGTCTTGGGTGGGGGACAGGGGAGG
GTGGTGGTCTCTGTCTCCAGCTGGGGTCTGAAGCTTCAGGACCATCCTGCCAGGAGGAGG
AGGGAAGGGAACCCCCAGGAGCCATCCCTCACTGCTCCCTCCCACCACCCCAGATCCTCT
GGACAGACCGCTGGTTGGCCAGGACGAGTTTTTCCTGGAGCAGACCAAAAAGAAAGGAGT
GAAGGTGAGGAAGTGGCAGGGTGCCCTGGGTGGAGGGTCTTGGAGCCCAGGAGCCGGAGC
AGTGGCCTGGCTTCCTGTCTGCCCCTCGGTGAGTGTGGGGGCTCCCGGGTCCCCTCCTCC
AGCATGTGGATGACGGCTTCACAAGGCTCCTAGGTAGGGCATTAGAACGGTCTCTGTGCA
GGACCTGAAAAGTTCATGTTGGTATCAGACTATTTTAAAGGGGTTTTTCTCTTTGTGTAT
TGTTTCATTGTTTATTTTTAATAAGAGAGAGAGAGAGAAAAAAAAACAGACCCATCGCTC
AGCTCTGGCTGACGGTAGTGCTGAGGCTTAAACCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCCA
TTTCTCCTCTGTCCAATCCAACAACAATGACAGCCAATAACAATAACGATGATAAACAAG
GGCAACAGAAGGGGAAAAAATGAATAAAGTTTAAAAAATTATATAAAAAGAGCCAGAGGA
GGCCAGGCAGTAGCGTACCTGGTTAAAGTGCACACATTACCGTGAGCGAGGACCTGGGCC
CAAAGCCCCTGGTCCCCAGCTGCAGAGAGAAAGCTTCACGAGTGGTGAAACAGGGCTGCA
GGTATCTCTCTGTCTCCCCCACCCCTCTTGATTTCTCTCTGTCTTTATCCAATAATAAAA
TAAAGAGACAGCGATGGTGTAAGAGCCAGAGGAGGAGAGACCCTGCGGCTCCGTACTCCT
TCTGTGGAGTTGCCCATGGCGCTCTCTCGCGCCGTGTTGGGCTCAGTCTGGGTCCTTGCA
GGTGTAGCATGTGCCCTCTCAGGTGAGCTGTCTCCTGGCCCACATGCTGATTGGTTTTTT
TTTTTTTTTTTTATGAGCTAGAGAAGCAAGAACACCAGTGAGCTCTGGCTGATGGGGATG
CGGGAGATTGAACCTGGGCCCTTGGGCTCACCAGCCCCGTGCACTGCCCTGAGACCCTTC
CCCTGCCCTGTAGCTTCTGCCTCCCTGAGTGGTCTGGTCAAGGCCCAGCCTCCTATACTT
AGCAGGTCACAAGTGACCTCCCCTGCCAAGTGCCAGAACTGGAGGCTCATCCAGGCCCAG
AAGCAGGTAGACCCAGCAGCCTGTCGGGAGTGGCTGGGCCGAGAGTTCAGGGCGGGGTCC
CAGCCCCGAAGCTCAGAGACTTGAGTCACTGACCTCCCTTGTGTCCTTTGCAGCGGCCTC
AGCGCCTTCACGTCAAGCCGTCCCCGGCTCCTGCTGTGGAGGTGATGCCCGCCGGAGCCT
CCTACAACCCAACCTTTGAGGACCACCAGGTACGTGTCGTCTGTGTTCCTCTTTTGAATC
AGTGTGATGCAGAAAGGGAGAGACACAGAGAGGAATGCATGCAGAATTTCTCTGCCATCT
GTGAAGCTTCCCTCCTCCAGGTAGAGATGAGGGGCTTAAACCTAGGTCCTCGAGCATGGT
AACACTTGTAGTCTACTGGGCAGGCCACCGTCCAGCCCTATATTTAATGGTTGGAGGGGG
AGGGGGTTTTGATAGGGGTTCAAACACAACGCGAGTGGGCCGCCCTCAGGGGGTTGGTTC
TAGAGAGAAAATGCCCCCCGGTGTCACCCAGTCGCGCGGGGGGGTGGAGAGAAGTCAAAC
CGGTCGACCCCAAGTAGGGGGGTCCTCCTTCGTTGTGTCTCTATTAAAAAAGCGCCGGGA
GAGAAAAAAACAGTTAGGGAGATGAGCGCCTGTGTATGTGAGTTAAACATAAAAGGGTTC
CCCCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTG
TATCAATCAGACGATAAGTTTCTGACTGACTTATAGCAGTATGTTGGGAGTGATTCATGC
TGAAAAGGTAAAGTCTATAAGAGAGACGTACTCGTATAGTAGAAGTATAATGTTACTGTA
CCCCATCAATTTGATCTGGCGCCCACATTCAGCACAGGACGCTATGGGACCCCTGCATCC
CTGTAGGTCTGAGCTGGCATTCTGTGGTTACGGGCTAGGAACATTCCAGGCTGTACCAAT
TTCAGGACCCATCTCCCTCGGGTTGTGGGTAGAGTATGTTGTCCAGCCTCCCTTTGGAGA
ACACAACATTCCCTACCATTGTTGATCCACATTGAGGGCAAGGTCCTATCCACCCCCTTT
TTAAAGCACCCAGTGTGGGCCTTTGACTGATGACTTGCTGAGCCATTTAGAGAGGGCAGG
GGACAGACACCTTTGGGGTAAATGGCAGCGTGTCGTGTTGTCCTGCTTCACTCAGTGGTA
TGGCAGGTTTGAGAAAGAGCAGCGAGATTTCATGCCTATCGGCCACCACCCCCTAATTGT
CACCCCTGAGACTGTGTCTTCCCTGAGCTTAGGTGGCCTCACCTCTCCTTCCCGTCTCTT
TGTAGTCTCTTCTGGGAGATGGAAGTGCTGGGGGTGGGGAGACAGCTGAGCCTGAGAGGA
GAGTTTGGGCTGGGATAGCAGAGCCCATCCACTACCCGTAGGTCCAAAACCTGCCACTGT
ATGTGTCTATCCATCCTGGGCACCAGTGAGAGGAGGAGGGTTACTGGGTGGGGGCACAGG
TAGGAAGTCAGAGGGCCAAGACCTGACTCACCCTCTCACCCCCCACAGACCCTGCTCTTG
GCCGCCCATGAGGTAGAGCTGCAGCGGCAGAAGGAGGCGGAGAAGCTGGAGCGGCAGCTG
GCCCTGCCCCCAGGGGAGCCGGTGGCCACGCAGGTGAGCCCGTCCCATCCTGCCCCATGC
TGCCCTCCGGTCCCTTCGAGGGCCTGACCCCTTCTCCATCTCCTCCAGGAGTCTACCTTC
CAGGAGATGTGCCAGGGGCTATTGGAGGAATCAGATGAGGAGGGCGAGCCTGACAGGGGC
CAGGACCAAGGGGCCCAGCCCGGAGATGCTGCACCCTCATCCGCGCCCACTCGAGCAGCT
GCCTCAGAGAAAAAGACAGAGCAGCAGCGGCGGCGGGGAGAAGGCTGCTCGGACCCTGGT
GAGCCCTGGGATACCCTGTGCCATTTTCTGTCCTTAAGCCCTGCAGCCAACCGACTTGGG
TCGCCTGGGTCTCTCCGCTGCATTTTGCCCAGTGGCCAAGGCTGGCTGTGAACTTGGGGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCCTAGACCCACT
CTTGCGCCACCCCCATCTCTGCCCCCATGAGTGCCCCCCATCTTCTCCCAGGTACAAGCC
CCCGACATTGATGTGCAGCTCAGCTCAGAGCTGTCCGACTCGCTCAGGACCCTGAAGGTG
AGCACTACCTCTCTGGGGTGATGGGCCCTTGGGGGAACCCTCGTGCCCGGTGATGACACC
CATCCTTGCTCCCCGTGCCCTCCCAGCAGGGCTTTGGGCGACATCCTGGCTGCCCCTGGG
CAGGGCCGGTTGGGCTGATGCCTGGGGGCTGAGGGCACGAGGTCTCTGAGTAGTGCCAGG
GGGTGGAGGGACGGGTTGTGGTCTGGAGACCCTCCTTCCCCTATGGCCCTGCTGTCTAGG
CCCCGGGAGGAGGCCCAGCCCTGACCTGCCCTGGGGTCAGCCAGCTGGCCTTCCTGGGTG
GCCTGACTACGCTCTGCTCCCTCTGACACTTGACCTTTGGCCCCCCTCCCATGCCCCTTT
CCTTTGTGCACCAGCCCCCTTCCTGTGGGGTCCTCTAAGCCCACTCAGGCAGCCTGGGAG
TGGAGGGTCATTCTCTTTTGAGTGGGGGCGGGGGAAGGTCATGAGCCCTTCTTGTGAGGC
AAGAAGTGCAGGAGAGTCTTGACTGCTAGGGAGGCCAAGTCTGAAACACTCCCTGCCCCT
AATGTCTCGCAGCCGGAGGGGAACATCCTGCGAGACCGCTTCAAGAGCTTCCAGAGGAGG
AACATGATTGAGCCTCGAGAGAGAGCCAAGTGAGGGCGGGGACTGTAGGGGATGGGAGAG
GGGGTGGGGCTCGAGGCCCAGGACCCCCACCACGCACGCACACGCGCACACACACACACA
CACACCATCTCTAACACACATGCACATGCACACCATCTCTAACACACAAGACCACTGAAC
CACATGGACACAAACGCCAGTTCTACACACACATACACACACCATCTCTAACACACACAC
ACCATCTCTAACACACACACACCATCTCTAACACACACACACACCATCTCAACACACACA
CACACTATCTCTAACACACATGCACACACACACCATCTCTAACACACACACCATCTAACA
CACACACATACCATCTCTAACACGCACACACCATCTCTAACACACATGCACACACACACC
ATCTCTAACACACACACACGCCATCTCTAACACACAGACACACCATCTCTAACGCGTGCA
CGCACACATGCGCACACACGCACGCACGCGCACCCTCTCTCTACCTGTGGGCTTGCTGCT
CCCTAACTGCTTGTTTGCTCCCCTCCCCCAGGTTCAAGCGAAAGTACAAAGTGAAGCTGG
TAGAGAAGCGGGCCTTCCGAGAGATCCAGTGAGTGCTGCTCATGCGCTCCCAGAAACACG
CCTCCCCCTGCTCAGCCTGAAGAAGCGGGGAGCCTTCCCCTATAACTGGCTGTTGATTGA
GCAATACCCCCCAGGCCGGGGCCTAGTGGAAGGCCAGCCCCTGTCCAGTGCACCTGAATA
CAGAGTCAGGGTGGTGGGGGACAGAAAGGGAGGGAGGGAGGCAGGTCACTGTCAACCCAC
CCATCTCCAGGGTTGTAGCTGCCTTGCTGCTGCCGGAAAGAAGGGAAGCCGGAGCCGTGT
TCATCAATAAAGCACCTTCTGACCATCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGTCTTCC
TGTATTTCTCATAAAAACAAATAAAATATTGTGGTCTGGGAGGTGTCGCAGTGCATAAAG
CCTTGGACTCTCAAGCATGAGGTCCTGAGTTCAGTCCTCACCAGCACATATACCGGAGTC
ATGTCTTTTTTTTCTCTTCCTATCTTCATGAATAAAGTCTTTATATATTAATTTTAACAA
AGCCTTAAAAAAGGTTTTATGAGAAGAGGAAGATAAAACCAAAGCATCACTGTGGCACAT
GTGGTGCCAGGAATCAAACTCCTGCCTATGAGTCGTAACACTCCACCCAGGCCAGGTGCT
TTTTAAGCAGAGGGACTCCCCTCATTGAGCCTTCAGGACTTACTGAGGTCAAGGGGTGGG
GGAAGGGACTAGTGTGATCCCTATATTACTAAAATGGAGAAAACTAAAACCCATTGTGGG
GGCTAATCCCATGCACACACACACACATTGTTTAAAAATGACTTAAGGGGGTCGGGCAGT
GGTGCAGTGGGTTAGGCGCACATGGCGCCAAAGCTCAAGGACCTGTGTGAGGATCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1224, 1837..1901, 6224..6332, 6646..6845, 7073..7143, 8633..8728, 10788..10892, 10968..11133, 11135..11157, 11604..11779, 12171..12174, 12177..12236, 12792..12868, 13411..13467, 13691..13697
1001..1224, 1837..1901, 6224..6332, 6646..6845, 7073..7143, 8633..8728, 10788..10892, 10968..11133, 11135..11157, 11604..11779, 12171..12174, 12177..12236, 12792..12868, 13411..13467, 13691..13694
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved