Erinaceus_europaeus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus TNPO2
Erinaceus_europaeus
TNPO2
GeneScaffold_1810
SNORD41
7312..7385
9241
TTACTGGGCTCTGCCTGCTGGTGGTCCGAGGATTGAAACTAGGGCCTCAGGCAGGAGGA
TCCTTTGCAGAACCATCATGCTGTCTCCTAGGTCCAGTTTTGTTCCTTGTTGATTTCTAA
ACCCTTGACATATGTGGCATTTTTTTTTTTTTTTAATCCTGAGTTCTACTGAGCTCTGGC
TGACGGTGGTGCTGAGGATCCAAACCTGGACCTCAGAGCCTCAGCAGAAGAGATTTTGTT
TTTCCACAGAACCGTTATGCTGCCTCCCTGGCCCTCTGTTGATTCATTCACGAGTGGAAG
TGAAACCGGAGCTTCCCTCAGGGTGGTGTGTGTGTTTGGGGTCGGGGTGGAGGGTCGAAC
CTAAACCCAGGTGTGCGTGTGCGTGTAAGGACCCCCAGTGTGGCCTCCGCTCCTGGGCCA
CACGCCCCTGGTGGCCCCAGGGCACCCGGCAGCCCTTGCCTGCCTGAGGCGGCGTTTTTG
TCTCTGCGGCGGCCTCAGGCATTCTCATCACCACCATCGCTTCCAAGGGCGAGCTGCAGA
TGTGGCCGGAGCTGCTGCCCCAGCTGTGTAACCTGCTCAACTCCGAGGACTACAATACCT
GTGAGGTAGGGAGGGAGGGGTGGGAGTCCCGGGCATGGGGGGTTCAGCTGTGCAGACCCC
TAGCACCCTTAACCCCTGGTCTCTGCTGCCCCGCCTTCCCCAGGGAGCCTTCGGGGCCCT
GCAGAAGATCTGCGAGGATTCCTCGGAGCTGTTAGATAGCGACGCCCTCAACAGACCCCT
CAACGTCATGATCCCCAAGTTCCTGCAGTTCTTCAAGCACTGCAGCCCCAAGATCCGGTG
GGTGCGGCTTCTGGGATGGGTCCCCGGAGAGCGGGCGGTGCTGGGGGGGCCAGCGTGGGA
GGGACCAGCCTGTCCCTGTGTCCACCCCCGCCGCCAGGTCCCACGCCATCGCCTGCGTGA
ACCAGTTCATCATGGACCGGGCCCAGGCGCTCATGGACAACATCGACACCTTCATCGAGG
TGGGCGTGCGGGCTGGGGCTGGGGAGGCGGGGAGCAACCCAGGAGGGGGTGGGGGTCCCC
CTTCCCCACAGCACCCACCCTCGGTGGCCCGCCCCCCACCCCCGTGCAGCACCTATTCGC
CCTGGCCGTGGACGACGACCCCGAGGTGCGGAAGAACGTGTGCCGGGCCCTGGTGATGCT
GCTGGAGGTGCGGATCGACCGGCTCATCCCGCACATGCACAGCATCATTCAGGTGCGAGC
TGCAGCCTGCCTGGGGCGAGGATGGGGCTGGGGCGAGGCCGAGGGGGGTAGGGCGGGGGG
CGGAGGACAGGCCTGGGCCAAGCTGCAGCCCGTGTCTCCCCAGTATATGCTGCAGCGACG
CAGGACCACGACGAGAACGTGGCCCTGGAAGCCTGTGAGTTCTTGCTGACGCTGGCGACA
GCCCATCTGCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCGGTTACCCACTGCGCTACCGCCCGACTCCCAGCGGTCATTTTTAATAAAAAT
TATTGGAAGGAGAGCCAGAAACTGAGAGGGTAGGGACATACACAGAGAGAGAGGGAGAGA
CAGCCCTGCTTCACCACTCCTGAAGCTTCCCGCCCTTGCAGGTGGGGACTAGGAGCTTGA
ATGGGTTCCTTGTGCACGGTAACGTGTGGTCAGCCAAGGTGCGCCACCACTCGGCCCCCT
CGACCACTACACCCCATGCACAACACCAGTCAAATGCAAGTACCTGGGTTCAAGTCCCTG
CTCCCCACCTGCAGGGGTTCCGCTTTATGATGGTGAAGCTGGTCTGCAGGTGGCTGTCGT
TCTGTTTCCCCTGTCCCCTCTCAGTTTCTCTCTGTCCGCTCTAATAAAAATTTCAAGAGA
AAAAGAAAAAAAAAATGTCCTCTGGGAATAGAGAGAGGGTCTGTAGTGCTGGCACTGAGC
CCCAGCAATAACACTGGTAGAAAAAGAAAATGAATCAATGTAGTTATTGATGAGGGCCCA
GGTGGTGGCACACCCGGTTGAGCACTCAGATTACACAGTGTGCAAAGTCCTGGGTTCAAG
CCCTCTGGTCCCCAGCTGCAGGGGGAAACCTTCATGAGTGATGAAGCAGGCCTGCGGGTG
TCACTGTCTTCCTTTTTCTCTCTCCTCATTCTCTCTTACTAGCAAACAATGGAAACTATA
ATAAAAACCTTATTTATTGCGAGGATGAGGAAGAGAGGAGCAGGGTGTCAGGCTGCCGTG
TACGATGCTGGGGAATCAACTTGGGACTTTAGAATCGAGAGTCAAGTGGTTTTTTGTTTT
TGTTTTTTATTTAATGATTTCATTTATTTATTGAGAAAGATAGAAGAGAGAGAGAGAGAG
AGAGAGAAAGAACCAGACATCACTCTGGTACATGTGCTACTGGGGATTGAACTCAGGACC
TCATGGCTTTTGAGAGTCTAGTGCTTTATCCACTGTGCCACCTCCCAGACCACGAGAGTC
AAATGTTTTATCCGGAGAGATAGACCAGAGCCCTGCCCAGCTCTGGCTAGTGGGGGTACT
GGGGATTGAACCTGGGGCGGGCCTGACAGCGTCAGGCAGGAGAGTCTTTGGCAGAACTGG
TGTATTTCAGAGAGAGAGGGAGGAGGGGCCTGCATGGGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCATCAGAGAGGAGAGTTCTCTGTGTCTCTGTTCTCATATACCCCCTCCTGTGGC
AGCCAGGGGTCGCAAATCCCCCCCAGGCGATGTGCACCCCAGTTTCTTCCAGGAGGTACA
CTAATTCCCTAGTATATCCCTATATCGCTCACACCCCAACCCTTTAGAGGGGGAACAAAC
GGAAACTCGAGGTACTGACAAAAAAAACCCGCTCCCACCACATCACGAACCATTGACCAC
AAGAGAGAGCCCGACTCCCAGAGCCTTTTCCCCATCACCTATCCCCACCAAAACATGTGC
CGCCCCCCCTGAGGCCCCCGCCATAAGACCCCACCACAGGAAAGAGAAGTCCTGAAAGCT
TGGCCACGCAATGTTTTTGGAGTTATTGGTACTGGAGTGGACCCGGTGGTGCCCCCTCTT
ATGTTCCAGCCCGTTTGCCATGCACCCCTGGACCCAGACCCTGCCTTTCCTCCCCACCCC
CAGAGCCTTTTCCCACCCCGGAGGAGGAGGGGCGTCCAGGAGAGTTTGTCCCTAACCTCA
GCTACATCCTGGACACCCTGGTCTTTGCCTTCGGGAAATACCAGCACAAGAACCTGCTCA
TCCTCTACGACGCCATCGGCACGCTGGCCGACTCGGTGGGCCACCACCTCAACCAGCCTG
TGAGTGCCACCCGCGCCGCGCCAAAACCCACGGGGACCCTGGGGGCGCGGAGAGCCCAGC
CCTCCAGCACCACTTCCCTGCCCTCCACCCCCCAGGAATATATCCAGAAGCTGATGCCAC
CGCTCATCCAGAAGTGGAACGAACTCAAGGATGAGGACAAGGACCTGTTCCCGCTGCTGG
AGGTGGGTCAGGCTGGCTGCCCCTGCCCCGCCCAGGGCCGCGCCCCCCAGCCCCTCTCCC
AGGGCGTATTCCCAGCCGTGGCCAGGGCCCCCGGGAGGTGATGACACTCTGAACGCTTGA
TCACCGCAATGATTTCTCACTGAGTATTCGTACTGGCTGATCCCGGGGGCACCCAGTCTC
CTGCTCCTGCTCCCTCTCCCCGCACCCACCACCTGGCCTCGCCCCCTACCTCCTACCCTA
CACCGGTCCCGCTCCCCAGGTCACCCCTTCCCTCCCGCAGTGCCTGTCCTCGGTGGCCAC
CGCCCTGCAGAGCGGCTTCCTGCCCTACTGCGAGCCCGTCTACCAGCGCTGCGTGACCCT
GGTGCAGAAGACGCTGGCCCAGGCCATGGTGAGTGTCTCCCCTCCTGCGGGGGGCCCCCC
CTTCTCTGTCTGCTGCTCCCCCCGTCCTCACCCTGCCGTCTCTGCCCAGATGTACACCCA
GCACCCCGAGCAGTATGAGGCCCCCGACAAGGACTTCATGATCGTGGCTCTGGACCTGCT
CAGTGGCCTGGCCGAGGGGCTGGGCGGCCACGTGGAGCAGCTGGTGGCTCGCAGTAACGT
CATGACACTCCTCTTCCAGTGCATGCAGGTCGGGGGCCGGCCGAGGGCACCCTGGAATCT
GGGAGCGGGGCTGGGGGTGGGGTGGCCAGGCTGACCCCTCCCTCACCCCCAGGACTCCAT
GCCCGAGGTCCGACAGAGCTCCTTTGCCCTCCTGGGCGACCTCACCAAGGCCTGCTTCAT
CCACGTCAAGCCCTGCATCGGTGTGTGCGCCCCACTTCTTTGTGGGGTACCCTCTCCACC
TCCCACCCCCCACCCCCGGCCCCACGTGATGGAGCCTTCACTGCCCAGGGAGCCTCCGTG
ACCACTCTGGCTTGTATTCGTACTGTCTGATGGGGCCTTACCCCCTCCAAGAATGGGGGC
CCAAGGGAGGATCCACCCCCCCTCAAAGACCACCTGGTGACTCACCTCATGCCCCCTCAC
CAGGCGAGTTCATGCCCATCCTGGGCACCAACCTGAACCCCGAGTTCATCTCTGTGTGTA
ACAACGCCACGTGGGCCATCGGAGAGATCTGCATGCAGATGGGTGAGTGCTCTCACTCCA
GAACCTGGCTCTCGGGGGGCTACCTGTGATTGGATGTCCTCTCATGGGCTCTGGGCAGAC
TCTTGGGTGTTCTGGTGATTGCGGATCAGACTCTGACCTGGGGGGGCTCCTGCAGGGGCC
GAGATGCAGCTCTATGTCCAGATGGTCCTAAACAATTCTGGTGGAGATTATCAACCGGCC
CAACACACTCAAGACACTGCTAGAGAACACAGGTGGGGGCACTTCTGAGAAGATGGGGGG
TGGCCAGGAGGGAGTGAGGGGGCCGACACTCTCTCACAGCGGCCTCCTGACGTCTCTCTG
ACCTTGCAGCCATCACCATCGGCCGCCTGGGCTACGTGTGCTCTCAGAGGTGGCTCTTAT
GTACAGAAGTTCATTCTGGCTCTGGTGCGTGTTCCCAGGGCAGGAGGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1105, 1204..1337, 1438..1519, 1630..1752, 1864..1875, 1878..1934, 1939..1979, 5380..5440, 5541..5706, 5807..5959, 6060..6285, 6864..6866, 6868..7039, 7136..7222, 7501..7608, 7690..7848, 7933..8020, 8244..8342, 8476..8516, 8518..8572, 8642..8652, 8654..8704, 8707..8721, 8724..8733, 8735..8742
1001..1105, 1204..1337, 1438..1519, 1630..1752, 1864..1875, 1878..1934, 1939..1979, 5380..5440, 5541..5706, 5807..5959, 6060..6285, 6864..6866, 6868..7039, 7136..7222, 7501..7608, 7690..7848, 7933..8020, 8244..8342, 8476..8516, 8518..8572, 8642..8652, 8654..8704, 8707..8721, 8724..8733, 8735..8742
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved